Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:VEGFA-RSPH9

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: VEGFA-RSPH9
	FusionPDB ID: 98036
	FusionGDB2.0 ID: 98036
		Hgene	Tgene
	Gene symbol	VEGFA	RSPH9
	Gene ID	7422	221421
	Gene name	vascular endothelial growth factor A	radial spoke head component 9
	Synonyms	MVCD1\|VEGF\|VPF	C6orf206\|CILD12\|MRPS18AL1
	Cytomap	6p21.1	6p21.1
	Type of gene	protein-coding	protein-coding
	Description	vascular endothelial growth factor Avascular endothelial growth factor A121vascular endothelial growth factor A165vascular permeability factor	radial spoke head protein 9 homologradial spoke head 9 homolog
	Modification date	20200329	20200313
	UniProtAcc	.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000230480, ENST00000372055, ENST00000372064, ENST00000372067, ENST00000372077, ENST00000413642, ENST00000417285, ENST00000425836, ENST00000482630, ENST00000518689, ENST00000518824, ENST00000520948, ENST00000523125, ENST00000523873, ENST00000523950, ENST00000324450, ENST00000457104,	ENST00000372163, ENST00000372165,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	13 X 10 X 8=1040	6 X 5 X 4=120
	# samples	14	8
	** MAII score	log2(14/1040*10)=-2.89308479608349 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(8/120*10)=-0.584962500721156 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: VEGFA [Title/Abstract] AND RSPH9 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: VEGFA [Title/Abstract] AND RSPH9 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	VEGFA(43746655)-RSPH9(43638526), # samples:2
Anticipated loss of major functional domain due to fusion event.	VEGFA-RSPH9 seems lost the major protein functional domain in Hgene partner, which is a tumor suppressor due to the frame-shifted ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	VEGFA	GO:0000122	negative regulation of transcription by RNA polymerase II	18093989
Hgene	VEGFA	GO:0001525	angiogenesis	11427521\|21771332
Hgene	VEGFA	GO:0001666	response to hypoxia	16490744
Hgene	VEGFA	GO:0001934	positive regulation of protein phosphorylation	18386220\|19033661
Hgene	VEGFA	GO:0001938	positive regulation of endothelial cell proliferation	9202027\|10022831\|12714610\|16489009\|18386220\|18577655\|20497126
Hgene	VEGFA	GO:0002042	cell migration involved in sprouting angiogenesis	18059339\|20660291
Hgene	VEGFA	GO:0002092	positive regulation of receptor internalization	20660291
Hgene	VEGFA	GO:0008284	positive regulation of cell proliferation	7929439
Hgene	VEGFA	GO:0008360	regulation of cell shape	7929439\|10527820
Hgene	VEGFA	GO:0010595	positive regulation of endothelial cell migration	10022831\|19033661
Hgene	VEGFA	GO:0010628	positive regulation of gene expression	18386220
Hgene	VEGFA	GO:0010629	negative regulation of gene expression	28977001
Hgene	VEGFA	GO:0010749	regulation of nitric oxide mediated signal transduction	16150726
Hgene	VEGFA	GO:0030224	monocyte differentiation	21149635
Hgene	VEGFA	GO:0030225	macrophage differentiation	21149635
Hgene	VEGFA	GO:0030335	positive regulation of cell migration	7929439\|17470632
Hgene	VEGFA	GO:0030949	positive regulation of vascular endothelial growth factor receptor signaling pathway	1312256\|7929439
Hgene	VEGFA	GO:0031334	positive regulation of protein complex assembly	16489009\|19033661
Hgene	VEGFA	GO:0031954	positive regulation of protein autophosphorylation	20497126
Hgene	VEGFA	GO:0032147	activation of protein kinase activity	18059339\|20497126
Hgene	VEGFA	GO:0032793	positive regulation of CREB transcription factor activity	20497126
Hgene	VEGFA	GO:0033138	positive regulation of peptidyl-serine phosphorylation	18440775\|20497126
Hgene	VEGFA	GO:0035148	tube formation	19033661
Hgene	VEGFA	GO:0035767	endothelial cell chemotaxis	18440775
Hgene	VEGFA	GO:0035924	cellular response to vascular endothelial growth factor stimulus	18440775\|20497126
Hgene	VEGFA	GO:0038033	positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway	18440775\|20497126\|21245381
Hgene	VEGFA	GO:0038091	positive regulation of cell proliferation by VEGF-activated platelet derived growth factor receptor signaling pathway	17470632
Hgene	VEGFA	GO:0042531	positive regulation of tyrosine phosphorylation of STAT protein	19390056
Hgene	VEGFA	GO:0043117	positive regulation of vascular permeability	26598555
Hgene	VEGFA	GO:0043154	negative regulation of cysteine-type endopeptidase activity involved in apoptotic process	18386220
Hgene	VEGFA	GO:0043406	positive regulation of MAP kinase activity	18440775
Hgene	VEGFA	GO:0043536	positive regulation of blood vessel endothelial cell migration	9202027\|18440775\|20497126
Hgene	VEGFA	GO:0045766	positive regulation of angiogenesis	18440775\|18577655\|19033661\|20497126
Hgene	VEGFA	GO:0045785	positive regulation of cell adhesion	19674970
Hgene	VEGFA	GO:0045944	positive regulation of transcription by RNA polymerase II	18059339
Hgene	VEGFA	GO:0048010	vascular endothelial growth factor receptor signaling pathway	21245381
Hgene	VEGFA	GO:0050731	positive regulation of peptidyl-tyrosine phosphorylation	10022831\|16489009\|20048167\|21245381\|26598555
Hgene	VEGFA	GO:0050918	positive chemotaxis	20497126
Hgene	VEGFA	GO:0050927	positive regulation of positive chemotaxis	7929439\|12744932
Hgene	VEGFA	GO:0051272	positive regulation of cellular component movement	10527820\|12744932
Hgene	VEGFA	GO:0051894	positive regulation of focal adhesion assembly	16489009
Hgene	VEGFA	GO:0071456	cellular response to hypoxia	10575000
Hgene	VEGFA	GO:0090037	positive regulation of protein kinase C signaling	18059339
Hgene	VEGFA	GO:0090050	positive regulation of cell migration involved in sprouting angiogenesis	20551324
Hgene	VEGFA	GO:0097533	cellular stress response to acid chemical	26299712
Hgene	VEGFA	GO:1900086	positive regulation of peptidyl-tyrosine autophosphorylation	20660291
Hgene	VEGFA	GO:1900745	positive regulation of p38MAPK cascade	18386220
Hgene	VEGFA	GO:1901727	positive regulation of histone deacetylase activity	20497126
Hgene	VEGFA	GO:1903141	negative regulation of establishment of endothelial barrier	20048167
Hgene	VEGFA	GO:1903392	negative regulation of adherens junction organization	26598555
Hgene	VEGFA	GO:1903572	positive regulation of protein kinase D signaling	20497126
Hgene	VEGFA	GO:1903672	positive regulation of sprouting angiogenesis	26299712
Hgene	VEGFA	GO:2000048	negative regulation of cell-cell adhesion mediated by cadherin	26598555

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr6:43746655/chr6:43638526)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across VEGFA (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across RSPH9 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000372067	VEGFA	chr6	43746655	+	ENST00000372165	RSPH9	chr6	43638525	+	3267	1456	494	1654	386
ENST00000417285	VEGFA	chr6	43746655	+	ENST00000372165	RSPH9	chr6	43638525	+	2773	962	0	1160	386
ENST00000413642	VEGFA	chr6	43746655	+	ENST00000372165	RSPH9	chr6	43638525	+	2773	962	0	1160	386
ENST00000372055	VEGFA	chr6	43746655	+	ENST00000372165	RSPH9	chr6	43638525	+	2773	962	0	1160	386
ENST00000482630	VEGFA	chr6	43746655	+	ENST00000372165	RSPH9	chr6	43638525	+	2773	962	0	1160	386
ENST00000425836	VEGFA	chr6	43746655	+	ENST00000372165	RSPH9	chr6	43638525	+	2773	962	0	1160	386
ENST00000372064	VEGFA	chr6	43746655	+	ENST00000372165	RSPH9	chr6	43638525	+	2773	962	0	1160	386
ENST00000372077	VEGFA	chr6	43746655	+	ENST00000372165	RSPH9	chr6	43638525	+	2698	887	78	1085	335
ENST00000520948	VEGFA	chr6	43746655	+	ENST00000372165	RSPH9	chr6	43638525	+	2397	586	38	784	248
ENST00000523873	VEGFA	chr6	43746655	+	ENST00000372165	RSPH9	chr6	43638525	+	2271	460	38	658	206
ENST00000523950	VEGFA	chr6	43746655	+	ENST00000372165	RSPH9	chr6	43638525	+	2271	460	38	658	206
ENST00000518689	VEGFA	chr6	43746655	+	ENST00000372165	RSPH9	chr6	43638525	+	2233	422	0	620	206
ENST00000523125	VEGFA	chr6	43746655	+	ENST00000372165	RSPH9	chr6	43638525	+	2233	422	0	620	206
ENST00000518824	VEGFA	chr6	43746655	+	ENST00000372165	RSPH9	chr6	43638525	+	2233	422	0	620	206
ENST00000230480	VEGFA	chr6	43746655	+	ENST00000372165	RSPH9	chr6	43638525	+	2277	466	128	664	178
ENST00000372067	VEGFA	chr6	43746655	+	ENST00000372165	RSPH9	chr6	43638526	+	3267	1456	494	1654	386
ENST00000417285	VEGFA	chr6	43746655	+	ENST00000372165	RSPH9	chr6	43638526	+	2773	962	0	1160	386
ENST00000413642	VEGFA	chr6	43746655	+	ENST00000372165	RSPH9	chr6	43638526	+	2773	962	0	1160	386
ENST00000372055	VEGFA	chr6	43746655	+	ENST00000372165	RSPH9	chr6	43638526	+	2773	962	0	1160	386
ENST00000482630	VEGFA	chr6	43746655	+	ENST00000372165	RSPH9	chr6	43638526	+	2773	962	0	1160	386
ENST00000425836	VEGFA	chr6	43746655	+	ENST00000372165	RSPH9	chr6	43638526	+	2773	962	0	1160	386
ENST00000372064	VEGFA	chr6	43746655	+	ENST00000372165	RSPH9	chr6	43638526	+	2773	962	0	1160	386
ENST00000372077	VEGFA	chr6	43746655	+	ENST00000372165	RSPH9	chr6	43638526	+	2698	887	78	1085	335
ENST00000520948	VEGFA	chr6	43746655	+	ENST00000372165	RSPH9	chr6	43638526	+	2397	586	38	784	248
ENST00000523873	VEGFA	chr6	43746655	+	ENST00000372165	RSPH9	chr6	43638526	+	2271	460	38	658	206
ENST00000523950	VEGFA	chr6	43746655	+	ENST00000372165	RSPH9	chr6	43638526	+	2271	460	38	658	206
ENST00000518689	VEGFA	chr6	43746655	+	ENST00000372165	RSPH9	chr6	43638526	+	2233	422	0	620	206
ENST00000523125	VEGFA	chr6	43746655	+	ENST00000372165	RSPH9	chr6	43638526	+	2233	422	0	620	206
ENST00000518824	VEGFA	chr6	43746655	+	ENST00000372165	RSPH9	chr6	43638526	+	2233	422	0	620	206
ENST00000230480	VEGFA	chr6	43746655	+	ENST00000372165	RSPH9	chr6	43638526	+	2277	466	128	664	178
ENST00000372067	VEGFA	chr6	43746654	+	ENST00000372165	RSPH9	chr6	43638525	+	3267	1456	494	1654	386
ENST00000417285	VEGFA	chr6	43746654	+	ENST00000372165	RSPH9	chr6	43638525	+	2773	962	0	1160	386
ENST00000413642	VEGFA	chr6	43746654	+	ENST00000372165	RSPH9	chr6	43638525	+	2773	962	0	1160	386
ENST00000372055	VEGFA	chr6	43746654	+	ENST00000372165	RSPH9	chr6	43638525	+	2773	962	0	1160	386
ENST00000482630	VEGFA	chr6	43746654	+	ENST00000372165	RSPH9	chr6	43638525	+	2773	962	0	1160	386
ENST00000425836	VEGFA	chr6	43746654	+	ENST00000372165	RSPH9	chr6	43638525	+	2773	962	0	1160	386
ENST00000372064	VEGFA	chr6	43746654	+	ENST00000372165	RSPH9	chr6	43638525	+	2773	962	0	1160	386
ENST00000372077	VEGFA	chr6	43746654	+	ENST00000372165	RSPH9	chr6	43638525	+	2698	887	78	1085	335
ENST00000520948	VEGFA	chr6	43746654	+	ENST00000372165	RSPH9	chr6	43638525	+	2397	586	38	784	248
ENST00000523873	VEGFA	chr6	43746654	+	ENST00000372165	RSPH9	chr6	43638525	+	2271	460	38	658	206
ENST00000523950	VEGFA	chr6	43746654	+	ENST00000372165	RSPH9	chr6	43638525	+	2271	460	38	658	206
ENST00000518689	VEGFA	chr6	43746654	+	ENST00000372165	RSPH9	chr6	43638525	+	2233	422	0	620	206
ENST00000523125	VEGFA	chr6	43746654	+	ENST00000372165	RSPH9	chr6	43638525	+	2233	422	0	620	206
ENST00000518824	VEGFA	chr6	43746654	+	ENST00000372165	RSPH9	chr6	43638525	+	2233	422	0	620	206
ENST00000230480	VEGFA	chr6	43746654	+	ENST00000372165	RSPH9	chr6	43638525	+	2277	466	128	664	178

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000372067	ENST00000372165	VEGFA	chr6	43746655	+	RSPH9	chr6	43638525	+	0.19361189	0.80638814
ENST00000417285	ENST00000372165	VEGFA	chr6	43746655	+	RSPH9	chr6	43638525	+	0.1424665	0.8575335
ENST00000413642	ENST00000372165	VEGFA	chr6	43746655	+	RSPH9	chr6	43638525	+	0.1424665	0.8575335
ENST00000372055	ENST00000372165	VEGFA	chr6	43746655	+	RSPH9	chr6	43638525	+	0.1424665	0.8575335
ENST00000482630	ENST00000372165	VEGFA	chr6	43746655	+	RSPH9	chr6	43638525	+	0.1424665	0.8575335
ENST00000425836	ENST00000372165	VEGFA	chr6	43746655	+	RSPH9	chr6	43638525	+	0.1424665	0.8575335
ENST00000372064	ENST00000372165	VEGFA	chr6	43746655	+	RSPH9	chr6	43638525	+	0.1424665	0.8575335
ENST00000372077	ENST00000372165	VEGFA	chr6	43746655	+	RSPH9	chr6	43638525	+	0.14898354	0.85101646
ENST00000520948	ENST00000372165	VEGFA	chr6	43746655	+	RSPH9	chr6	43638525	+	0.16571102	0.83428895
ENST00000523873	ENST00000372165	VEGFA	chr6	43746655	+	RSPH9	chr6	43638525	+	0.15937775	0.84062225
ENST00000523950	ENST00000372165	VEGFA	chr6	43746655	+	RSPH9	chr6	43638525	+	0.15937775	0.84062225
ENST00000518689	ENST00000372165	VEGFA	chr6	43746655	+	RSPH9	chr6	43638525	+	0.16749682	0.83250314
ENST00000523125	ENST00000372165	VEGFA	chr6	43746655	+	RSPH9	chr6	43638525	+	0.16749682	0.83250314
ENST00000518824	ENST00000372165	VEGFA	chr6	43746655	+	RSPH9	chr6	43638525	+	0.16749682	0.83250314
ENST00000230480	ENST00000372165	VEGFA	chr6	43746655	+	RSPH9	chr6	43638525	+	0.15487221	0.84512776
ENST00000372067	ENST00000372165	VEGFA	chr6	43746655	+	RSPH9	chr6	43638526	+	0.19361189	0.80638814
ENST00000417285	ENST00000372165	VEGFA	chr6	43746655	+	RSPH9	chr6	43638526	+	0.1424665	0.8575335
ENST00000413642	ENST00000372165	VEGFA	chr6	43746655	+	RSPH9	chr6	43638526	+	0.1424665	0.8575335
ENST00000372055	ENST00000372165	VEGFA	chr6	43746655	+	RSPH9	chr6	43638526	+	0.1424665	0.8575335
ENST00000482630	ENST00000372165	VEGFA	chr6	43746655	+	RSPH9	chr6	43638526	+	0.1424665	0.8575335
ENST00000425836	ENST00000372165	VEGFA	chr6	43746655	+	RSPH9	chr6	43638526	+	0.1424665	0.8575335
ENST00000372064	ENST00000372165	VEGFA	chr6	43746655	+	RSPH9	chr6	43638526	+	0.1424665	0.8575335
ENST00000372077	ENST00000372165	VEGFA	chr6	43746655	+	RSPH9	chr6	43638526	+	0.14898354	0.85101646
ENST00000520948	ENST00000372165	VEGFA	chr6	43746655	+	RSPH9	chr6	43638526	+	0.16571102	0.83428895
ENST00000523873	ENST00000372165	VEGFA	chr6	43746655	+	RSPH9	chr6	43638526	+	0.15937775	0.84062225
ENST00000523950	ENST00000372165	VEGFA	chr6	43746655	+	RSPH9	chr6	43638526	+	0.15937775	0.84062225
ENST00000518689	ENST00000372165	VEGFA	chr6	43746655	+	RSPH9	chr6	43638526	+	0.16749682	0.83250314
ENST00000523125	ENST00000372165	VEGFA	chr6	43746655	+	RSPH9	chr6	43638526	+	0.16749682	0.83250314
ENST00000518824	ENST00000372165	VEGFA	chr6	43746655	+	RSPH9	chr6	43638526	+	0.16749682	0.83250314
ENST00000230480	ENST00000372165	VEGFA	chr6	43746655	+	RSPH9	chr6	43638526	+	0.15487221	0.84512776
ENST00000372067	ENST00000372165	VEGFA	chr6	43746654	+	RSPH9	chr6	43638525	+	0.19361189	0.80638814
ENST00000417285	ENST00000372165	VEGFA	chr6	43746654	+	RSPH9	chr6	43638525	+	0.1424665	0.8575335
ENST00000413642	ENST00000372165	VEGFA	chr6	43746654	+	RSPH9	chr6	43638525	+	0.1424665	0.8575335
ENST00000372055	ENST00000372165	VEGFA	chr6	43746654	+	RSPH9	chr6	43638525	+	0.1424665	0.8575335
ENST00000482630	ENST00000372165	VEGFA	chr6	43746654	+	RSPH9	chr6	43638525	+	0.1424665	0.8575335
ENST00000425836	ENST00000372165	VEGFA	chr6	43746654	+	RSPH9	chr6	43638525	+	0.1424665	0.8575335
ENST00000372064	ENST00000372165	VEGFA	chr6	43746654	+	RSPH9	chr6	43638525	+	0.1424665	0.8575335
ENST00000372077	ENST00000372165	VEGFA	chr6	43746654	+	RSPH9	chr6	43638525	+	0.14898354	0.85101646
ENST00000520948	ENST00000372165	VEGFA	chr6	43746654	+	RSPH9	chr6	43638525	+	0.16571102	0.83428895
ENST00000523873	ENST00000372165	VEGFA	chr6	43746654	+	RSPH9	chr6	43638525	+	0.15937775	0.84062225
ENST00000523950	ENST00000372165	VEGFA	chr6	43746654	+	RSPH9	chr6	43638525	+	0.15937775	0.84062225
ENST00000518689	ENST00000372165	VEGFA	chr6	43746654	+	RSPH9	chr6	43638525	+	0.16749682	0.83250314
ENST00000523125	ENST00000372165	VEGFA	chr6	43746654	+	RSPH9	chr6	43638525	+	0.16749682	0.83250314
ENST00000518824	ENST00000372165	VEGFA	chr6	43746654	+	RSPH9	chr6	43638525	+	0.16749682	0.83250314
ENST00000230480	ENST00000372165	VEGFA	chr6	43746654	+	RSPH9	chr6	43638525	+	0.15487221	0.84512776

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for VEGFA-RSPH9

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
VEGFA	chr6	43746654	RSPH9	chr6	43638525	1456	321	ECRPKKDRARQEKVLEHPDGEGQCPG
VEGFA	chr6	43746654	RSPH9	chr6	43638525	422	141	ECRPKKDRARQEKVLEHPDGEGQCPG
VEGFA	chr6	43746654	RSPH9	chr6	43638525	460	141	ECRPKKDRARQEKVLEHPDGEGQCPG
VEGFA	chr6	43746654	RSPH9	chr6	43638525	466	113	ECRPKKDRARQEKVLEHPDGEGQCPG
VEGFA	chr6	43746654	RSPH9	chr6	43638525	586	183	ECRPKKDRARQEKVLEHPDGEGQCPG
VEGFA	chr6	43746654	RSPH9	chr6	43638525	887	270	ECRPKKDRARQEKVLEHPDGEGQCPG
VEGFA	chr6	43746654	RSPH9	chr6	43638525	962	321	ECRPKKDRARQEKVLEHPDGEGQCPG
VEGFA	chr6	43746655	RSPH9	chr6	43638525	1456	321	ECRPKKDRARQEKVLEHPDGEGQCPG
VEGFA	chr6	43746655	RSPH9	chr6	43638525	422	141	ECRPKKDRARQEKVLEHPDGEGQCPG
VEGFA	chr6	43746655	RSPH9	chr6	43638525	460	141	ECRPKKDRARQEKVLEHPDGEGQCPG
VEGFA	chr6	43746655	RSPH9	chr6	43638525	466	113	ECRPKKDRARQEKVLEHPDGEGQCPG
VEGFA	chr6	43746655	RSPH9	chr6	43638525	586	183	ECRPKKDRARQEKVLEHPDGEGQCPG
VEGFA	chr6	43746655	RSPH9	chr6	43638525	887	270	ECRPKKDRARQEKVLEHPDGEGQCPG
VEGFA	chr6	43746655	RSPH9	chr6	43638525	962	321	ECRPKKDRARQEKVLEHPDGEGQCPG
VEGFA	chr6	43746655	RSPH9	chr6	43638526	1456	321	ECRPKKDRARQEKVLEHPDGEGQCPG
VEGFA	chr6	43746655	RSPH9	chr6	43638526	422	141	ECRPKKDRARQEKVLEHPDGEGQCPG
VEGFA	chr6	43746655	RSPH9	chr6	43638526	460	141	ECRPKKDRARQEKVLEHPDGEGQCPG
VEGFA	chr6	43746655	RSPH9	chr6	43638526	466	113	ECRPKKDRARQEKVLEHPDGEGQCPG
VEGFA	chr6	43746655	RSPH9	chr6	43638526	586	183	ECRPKKDRARQEKVLEHPDGEGQCPG
VEGFA	chr6	43746655	RSPH9	chr6	43638526	887	270	ECRPKKDRARQEKVLEHPDGEGQCPG
VEGFA	chr6	43746655	RSPH9	chr6	43638526	962	321	ECRPKKDRARQEKVLEHPDGEGQCPG

Top

Potential FusionNeoAntigen Information of VEGFA-RSPH9 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

VEGFA-RSPH9_43746654_43638525.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
VEGFA-RSPH9	chr6	43746654	chr6	43638525	466	HLA-B27:05	ARQEKVLEH	0.9991	0.5984	8	17
VEGFA-RSPH9	chr6	43746654	chr6	43638525	466	HLA-B27:04	ARQEKVLEH	0.999	0.6746	8	17
VEGFA-RSPH9	chr6	43746654	chr6	43638525	466	HLA-B14:01	DRARQEKVL	0.9966	0.772	6	15
VEGFA-RSPH9	chr6	43746654	chr6	43638525	466	HLA-B14:02	DRARQEKVL	0.9966	0.772	6	15
VEGFA-RSPH9	chr6	43746654	chr6	43638525	466	HLA-B39:01	DRARQEKVL	0.9825	0.7635	6	15
VEGFA-RSPH9	chr6	43746654	chr6	43638525	466	HLA-B15:37	DRARQEKVL	0.9344	0.64	6	15
VEGFA-RSPH9	chr6	43746654	chr6	43638525	466	HLA-B38:02	DRARQEKVL	0.9162	0.8242	6	15
VEGFA-RSPH9	chr6	43746654	chr6	43638525	466	HLA-B15:10	DRARQEKVL	0.9061	0.5302	6	15
VEGFA-RSPH9	chr6	43746654	chr6	43638525	466	HLA-B27:14	ARQEKVLEH	0.9989	0.5949	8	17
VEGFA-RSPH9	chr6	43746654	chr6	43638525	466	HLA-C07:95	ARQEKVLEH	0.9895	0.6521	8	17
VEGFA-RSPH9	chr6	43746654	chr6	43638525	466	HLA-B27:03	ARQEKVLEH	0.9849	0.6234	8	17
VEGFA-RSPH9	chr6	43746654	chr6	43638525	466	HLA-C07:27	ARQEKVLEH	0.9798	0.9325	8	17
VEGFA-RSPH9	chr6	43746654	chr6	43638525	466	HLA-C07:05	ARQEKVLEH	0.9786	0.9355	8	17
VEGFA-RSPH9	chr6	43746654	chr6	43638525	466	HLA-B39:12	DRARQEKVL	0.9744	0.7642	6	15
VEGFA-RSPH9	chr6	43746654	chr6	43638525	466	HLA-C07:19	ARQEKVLEH	0.8132	0.7562	8	17
VEGFA-RSPH9	chr6	43746654	chr6	43638525	466	HLA-C07:46	ARQEKVLEH	0.8049	0.9077	8	17
VEGFA-RSPH9	chr6	43746654	chr6	43638525	466	HLA-C07:80	ARQEKVLEH	0.7991	0.9501	8	17
VEGFA-RSPH9	chr6	43746654	chr6	43638525	466	HLA-C07:67	ARQEKVLEH	0.7991	0.9501	8	17
VEGFA-RSPH9	chr6	43746654	chr6	43638525	466	HLA-C07:10	ARQEKVLEH	0.7968	0.971	8	17
VEGFA-RSPH9	chr6	43746654	chr6	43638525	466	HLA-B14:03	DRARQEKVL	0.7045	0.7463	6	15
VEGFA-RSPH9	chr6	43746654	chr6	43638525	466	HLA-C12:16	ARQEKVLEH	0.0154	0.9114	8	17
VEGFA-RSPH9	chr6	43746654	chr6	43638525	466	HLA-B27:08	ARQEKVLEH	0.9991	0.5243	8	17
VEGFA-RSPH9	chr6	43746654	chr6	43638525	466	HLA-B27:10	ARQEKVLEH	0.999	0.769	8	17
VEGFA-RSPH9	chr6	43746654	chr6	43638525	466	HLA-C07:01	ARQEKVLEH	0.9925	0.6465	8	17
VEGFA-RSPH9	chr6	43746654	chr6	43638525	466	HLA-B39:31	DRARQEKVL	0.9802	0.7617	6	15
VEGFA-RSPH9	chr6	43746654	chr6	43638525	466	HLA-C07:17	ARQEKVLEH	0.8229	0.9546	8	17
VEGFA-RSPH9	chr6	43746654	chr6	43638525	466	HLA-C07:02	ARQEKVLEH	0.7991	0.9501	8	17
VEGFA-RSPH9	chr6	43746654	chr6	43638525	466	HLA-B15:09	DRARQEKVL	0.712	0.6087	6	15
VEGFA-RSPH9	chr6	43746654	chr6	43638525	466	HLA-C07:22	ARQEKVLEH	0.6055	0.6287	8	17
VEGFA-RSPH9	chr6	43746654	chr6	43638525	466	HLA-B27:10	RARQEKVLEH	0.9914	0.7203	7	17

Top

Potential FusionNeoAntigen Information of VEGFA-RSPH9 in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of VEGFA-RSPH9

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
1362	DRARQEKVLEHPDG	VEGFA	RSPH9	chr6	43746654	chr6	43638525	466

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of VEGFA-RSPH9

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	1362	DRARQEKVLEHPDG	-7.9962	-8.1096
HLA-B14:02	3BVN	1362	DRARQEKVLEHPDG	-5.70842	-6.74372
HLA-B52:01	3W39	1362	DRARQEKVLEHPDG	-6.83737	-6.95077
HLA-B52:01	3W39	1362	DRARQEKVLEHPDG	-4.4836	-5.5189
HLA-A11:01	4UQ2	1362	DRARQEKVLEHPDG	-10.0067	-10.1201
HLA-A11:01	4UQ2	1362	DRARQEKVLEHPDG	-9.03915	-10.0745
HLA-A24:02	5HGA	1362	DRARQEKVLEHPDG	-6.56204	-6.67544
HLA-A24:02	5HGA	1362	DRARQEKVLEHPDG	-5.42271	-6.45801
HLA-B44:05	3DX8	1362	DRARQEKVLEHPDG	-7.85648	-8.89178
HLA-B44:05	3DX8	1362	DRARQEKVLEHPDG	-5.3978	-5.5112
HLA-A02:01	6TDR	1362	DRARQEKVLEHPDG	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of VEGFA-RSPH9

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
VEGFA-RSPH9	chr6	43746654	chr6	43638525	6	15	DRARQEKVL	AGATAGAGCAAGACAAGAAAAGGTCCT
VEGFA-RSPH9	chr6	43746654	chr6	43638525	7	17	RARQEKVLEH	TAGAGCAAGACAAGAAAAGGTCCTGGAGCA
VEGFA-RSPH9	chr6	43746654	chr6	43638525	8	17	ARQEKVLEH	AGCAAGACAAGAAAAGGTCCTGGAGCA

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of VEGFA-RSPH9

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
CESC	VEGFA-RSPH9	chr6	43746654	ENST00000230480	chr6	43638525	ENST00000372165	TCGA-DS-A3LQ-01A

Top

Potential target of CAR-T therapy development for VEGFA-RSPH9

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to VEGFA-RSPH9

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to VEGFA-RSPH9

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)