Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:BLOC1S6-SCMH1

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: BLOC1S6-SCMH1
	FusionPDB ID: 9836
	FusionGDB2.0 ID: 66116
		Hgene	Tgene
	Gene symbol	BLOC1S6	SCMH1
	Gene ID	26258	22955
	Gene name	biogenesis of lysosomal organelles complex 1 subunit 6	Scm polycomb group protein homolog 1
	Synonyms	BLOS6\|HPS9\|PA\|PALLID\|PLDN	Scml3
	Cytomap	15q21.1	1p34.2
	Type of gene	protein-coding	protein-coding
	Description	biogenesis of lysosome-related organelles complex 1 subunit 6BLOC-1 subunit 6BLOC-1 subunit pallidinbiogenesis of lysosomal organelles complex-1, subunit 5, pallidinbiogenesis of lysosomal organelles complex-1, subunit 6, pallidinpallid protein homol	polycomb protein SCMH1sex comb on midleg homolog 1
	Modification date	20200327	20200313
	UniProtAcc	Q9UL45 Main function of 5'-partner protein: FUNCTION: Component of the BLOC-1 complex, a complex that is required for normal biogenesis of lysosome-related organelles (LRO), such as platelet dense granules and melanosomes. In concert with the AP-3 complex, the BLOC-1 complex is required to target membrane protein cargos into vesicles assembled at cell bodies for delivery into neurites and nerve terminals. The BLOC-1 complex, in association with SNARE proteins, is also proposed to be involved in neurite extension. May play a role in intracellular vesicle trafficking, particularly in the vesicle-docking and fusion process. {ECO:0000269\|PubMed:17182842, ECO:0000269\|PubMed:21998198}.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000567740, ENST00000220531, ENST00000565216, ENST00000565323, ENST00000566753, ENST00000562384, ENST00000564765, ENST00000565409, ENST00000567461, ENST00000568816,	ENST00000326197, ENST00000337495, ENST00000361191, ENST00000361705, ENST00000372595, ENST00000372596, ENST00000372597, ENST00000397171, ENST00000397174, ENST00000402904, ENST00000456518, ENST00000472037,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	4 X 3 X 3=36	12 X 9 X 6=648
	# samples	5	14
	** MAII score	log2(5/36*10)=0.473931188332412 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0	log2(14/648*10)=-2.21056698593966 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: BLOC1S6 [Title/Abstract] AND SCMH1 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: BLOC1S6 [Title/Abstract] AND SCMH1 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	BLOC1S6(45884474)-SCMH1(41514562), # samples:2
Anticipated loss of major functional domain due to fusion event.	BLOC1S6-SCMH1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. BLOC1S6-SCMH1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. BLOC1S6-SCMH1 seems lost the major protein functional domain in Tgene partner, which is a epigenetic factor due to the frame-shifted ORF. BLOC1S6-SCMH1 seems lost the major protein functional domain in Tgene partner, which is a transcription factor due to the frame-shifted ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	BLOC1S6	GO:0032402	melanosome transport	17182842
Hgene	BLOC1S6	GO:0035646	endosome to melanosome transport	17182842
Hgene	BLOC1S6	GO:0050942	positive regulation of pigment cell differentiation	17182842

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr15:45884474/chr1:41514562)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across BLOC1S6 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across SCMH1 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000220531	BLOC1S6	chr15	45879723	+	ENST00000456518	SCMH1	chr1	41514562	-	2239	403	288	1244	318
ENST00000220531	BLOC1S6	chr15	45879723	+	ENST00000397174	SCMH1	chr1	41514562	-	2239	403	288	1244	318
ENST00000220531	BLOC1S6	chr15	45879723	+	ENST00000402904	SCMH1	chr1	41514562	-	2305	403	288	1310	340
ENST00000220531	BLOC1S6	chr15	45879723	+	ENST00000361191	SCMH1	chr1	41514562	-	2239	403	288	1244	318
ENST00000220531	BLOC1S6	chr15	45879723	+	ENST00000397171	SCMH1	chr1	41514562	-	2239	403	288	1244	318
ENST00000220531	BLOC1S6	chr15	45879723	+	ENST00000361705	SCMH1	chr1	41514562	-	2239	403	288	1244	318
ENST00000220531	BLOC1S6	chr15	45879723	+	ENST00000326197	SCMH1	chr1	41514562	-	2303	403	288	1310	340
ENST00000220531	BLOC1S6	chr15	45879723	+	ENST00000372595	SCMH1	chr1	41514562	-	2303	403	288	1310	340
ENST00000220531	BLOC1S6	chr15	45879723	+	ENST00000337495	SCMH1	chr1	41514562	-	2237	403	288	1244	318
ENST00000220531	BLOC1S6	chr15	45879723	+	ENST00000372596	SCMH1	chr1	41514562	-	2237	403	288	1244	318
ENST00000220531	BLOC1S6	chr15	45879723	+	ENST00000372597	SCMH1	chr1	41514562	-	2237	403	288	1244	318
ENST00000566753	BLOC1S6	chr15	45879723	+	ENST00000456518	SCMH1	chr1	41514562	-	2007	171	56	1012	318
ENST00000566753	BLOC1S6	chr15	45879723	+	ENST00000397174	SCMH1	chr1	41514562	-	2007	171	56	1012	318
ENST00000566753	BLOC1S6	chr15	45879723	+	ENST00000402904	SCMH1	chr1	41514562	-	2073	171	56	1078	340
ENST00000566753	BLOC1S6	chr15	45879723	+	ENST00000361191	SCMH1	chr1	41514562	-	2007	171	56	1012	318
ENST00000566753	BLOC1S6	chr15	45879723	+	ENST00000397171	SCMH1	chr1	41514562	-	2007	171	56	1012	318
ENST00000566753	BLOC1S6	chr15	45879723	+	ENST00000361705	SCMH1	chr1	41514562	-	2007	171	56	1012	318
ENST00000566753	BLOC1S6	chr15	45879723	+	ENST00000326197	SCMH1	chr1	41514562	-	2071	171	56	1078	340
ENST00000566753	BLOC1S6	chr15	45879723	+	ENST00000372595	SCMH1	chr1	41514562	-	2071	171	56	1078	340
ENST00000566753	BLOC1S6	chr15	45879723	+	ENST00000337495	SCMH1	chr1	41514562	-	2005	171	56	1012	318
ENST00000566753	BLOC1S6	chr15	45879723	+	ENST00000372596	SCMH1	chr1	41514562	-	2005	171	56	1012	318
ENST00000566753	BLOC1S6	chr15	45879723	+	ENST00000372597	SCMH1	chr1	41514562	-	2005	171	56	1012	318
ENST00000565216	BLOC1S6	chr15	45879723	+	ENST00000456518	SCMH1	chr1	41514562	-	1938	102	20	943	307
ENST00000565216	BLOC1S6	chr15	45879723	+	ENST00000397174	SCMH1	chr1	41514562	-	1938	102	20	943	307
ENST00000565216	BLOC1S6	chr15	45879723	+	ENST00000402904	SCMH1	chr1	41514562	-	2004	102	20	1009	329
ENST00000565216	BLOC1S6	chr15	45879723	+	ENST00000361191	SCMH1	chr1	41514562	-	1938	102	20	943	307
ENST00000565216	BLOC1S6	chr15	45879723	+	ENST00000397171	SCMH1	chr1	41514562	-	1938	102	20	943	307
ENST00000565216	BLOC1S6	chr15	45879723	+	ENST00000361705	SCMH1	chr1	41514562	-	1938	102	20	943	307
ENST00000565216	BLOC1S6	chr15	45879723	+	ENST00000326197	SCMH1	chr1	41514562	-	2002	102	20	1009	329
ENST00000565216	BLOC1S6	chr15	45879723	+	ENST00000372595	SCMH1	chr1	41514562	-	2002	102	20	1009	329
ENST00000565216	BLOC1S6	chr15	45879723	+	ENST00000337495	SCMH1	chr1	41514562	-	1936	102	20	943	307
ENST00000565216	BLOC1S6	chr15	45879723	+	ENST00000372596	SCMH1	chr1	41514562	-	1936	102	20	943	307
ENST00000565216	BLOC1S6	chr15	45879723	+	ENST00000372597	SCMH1	chr1	41514562	-	1936	102	20	943	307

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000220531	ENST00000456518	BLOC1S6	chr15	45879723	+	SCMH1	chr1	41514562	-	0.041341666	0.9586583
ENST00000220531	ENST00000397174	BLOC1S6	chr15	45879723	+	SCMH1	chr1	41514562	-	0.041341666	0.9586583
ENST00000220531	ENST00000402904	BLOC1S6	chr15	45879723	+	SCMH1	chr1	41514562	-	0.030722313	0.9692777
ENST00000220531	ENST00000361191	BLOC1S6	chr15	45879723	+	SCMH1	chr1	41514562	-	0.041341666	0.9586583
ENST00000220531	ENST00000397171	BLOC1S6	chr15	45879723	+	SCMH1	chr1	41514562	-	0.041341666	0.9586583
ENST00000220531	ENST00000361705	BLOC1S6	chr15	45879723	+	SCMH1	chr1	41514562	-	0.041341666	0.9586583
ENST00000220531	ENST00000326197	BLOC1S6	chr15	45879723	+	SCMH1	chr1	41514562	-	0.03068374	0.96931624
ENST00000220531	ENST00000372595	BLOC1S6	chr15	45879723	+	SCMH1	chr1	41514562	-	0.03068374	0.96931624
ENST00000220531	ENST00000337495	BLOC1S6	chr15	45879723	+	SCMH1	chr1	41514562	-	0.04131836	0.95868164
ENST00000220531	ENST00000372596	BLOC1S6	chr15	45879723	+	SCMH1	chr1	41514562	-	0.04131836	0.95868164
ENST00000220531	ENST00000372597	BLOC1S6	chr15	45879723	+	SCMH1	chr1	41514562	-	0.04131836	0.95868164
ENST00000566753	ENST00000456518	BLOC1S6	chr15	45879723	+	SCMH1	chr1	41514562	-	0.038580284	0.9614197
ENST00000566753	ENST00000397174	BLOC1S6	chr15	45879723	+	SCMH1	chr1	41514562	-	0.038580284	0.9614197
ENST00000566753	ENST00000402904	BLOC1S6	chr15	45879723	+	SCMH1	chr1	41514562	-	0.027123168	0.97287685
ENST00000566753	ENST00000361191	BLOC1S6	chr15	45879723	+	SCMH1	chr1	41514562	-	0.038580284	0.9614197
ENST00000566753	ENST00000397171	BLOC1S6	chr15	45879723	+	SCMH1	chr1	41514562	-	0.038580284	0.9614197
ENST00000566753	ENST00000361705	BLOC1S6	chr15	45879723	+	SCMH1	chr1	41514562	-	0.038580284	0.9614197
ENST00000566753	ENST00000326197	BLOC1S6	chr15	45879723	+	SCMH1	chr1	41514562	-	0.027219981	0.97278005
ENST00000566753	ENST00000372595	BLOC1S6	chr15	45879723	+	SCMH1	chr1	41514562	-	0.027219981	0.97278005
ENST00000566753	ENST00000337495	BLOC1S6	chr15	45879723	+	SCMH1	chr1	41514562	-	0.03864483	0.96135515
ENST00000566753	ENST00000372596	BLOC1S6	chr15	45879723	+	SCMH1	chr1	41514562	-	0.03864483	0.96135515
ENST00000566753	ENST00000372597	BLOC1S6	chr15	45879723	+	SCMH1	chr1	41514562	-	0.03864483	0.96135515
ENST00000565216	ENST00000456518	BLOC1S6	chr15	45879723	+	SCMH1	chr1	41514562	-	0.04053673	0.95946324
ENST00000565216	ENST00000397174	BLOC1S6	chr15	45879723	+	SCMH1	chr1	41514562	-	0.04053673	0.95946324
ENST00000565216	ENST00000402904	BLOC1S6	chr15	45879723	+	SCMH1	chr1	41514562	-	0.029887095	0.9701129
ENST00000565216	ENST00000361191	BLOC1S6	chr15	45879723	+	SCMH1	chr1	41514562	-	0.04053673	0.95946324
ENST00000565216	ENST00000397171	BLOC1S6	chr15	45879723	+	SCMH1	chr1	41514562	-	0.04053673	0.95946324
ENST00000565216	ENST00000361705	BLOC1S6	chr15	45879723	+	SCMH1	chr1	41514562	-	0.04053673	0.95946324
ENST00000565216	ENST00000326197	BLOC1S6	chr15	45879723	+	SCMH1	chr1	41514562	-	0.02993312	0.9700669
ENST00000565216	ENST00000372595	BLOC1S6	chr15	45879723	+	SCMH1	chr1	41514562	-	0.02993312	0.9700669
ENST00000565216	ENST00000337495	BLOC1S6	chr15	45879723	+	SCMH1	chr1	41514562	-	0.040484075	0.95951587
ENST00000565216	ENST00000372596	BLOC1S6	chr15	45879723	+	SCMH1	chr1	41514562	-	0.040484075	0.95951587
ENST00000565216	ENST00000372597	BLOC1S6	chr15	45879723	+	SCMH1	chr1	41514562	-	0.040484075	0.95951587

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for BLOC1S6-SCMH1

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
BLOC1S6	chr15	45879723	SCMH1	chr1	41514562	102	27	RPPYCLEAGEPTPVCIYLNKNGSTGP
BLOC1S6	chr15	45879723	SCMH1	chr1	41514562	171	38	RPPYCLEAGEPTPVCIYLNKNGSTGP
BLOC1S6	chr15	45879723	SCMH1	chr1	41514562	403	38	RPPYCLEAGEPTPVCIYLNKNGSTGP

Top

Potential FusionNeoAntigen Information of BLOC1S6-SCMH1 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

BLOC1S6-SCMH1_45879723_41514562.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
BLOC1S6-SCMH1	chr15	45879723	chr1	41514562	403	HLA-B35:01	EPTPVCIY	0.9738	0.7127	9	17
BLOC1S6-SCMH1	chr15	45879723	chr1	41514562	403	HLA-B35:08	EPTPVCIY	0.9589	0.672	9	17
BLOC1S6-SCMH1	chr15	45879723	chr1	41514562	403	HLA-B35:03	EPTPVCIYL	0.9531	0.7466	9	18
BLOC1S6-SCMH1	chr15	45879723	chr1	41514562	403	HLA-B35:01	EPTPVCIYL	0.9394	0.717	9	18
BLOC1S6-SCMH1	chr15	45879723	chr1	41514562	403	HLA-B44:03	GEPTPVCIY	0.9085	0.9317	8	17
BLOC1S6-SCMH1	chr15	45879723	chr1	41514562	403	HLA-B35:02	EPTPVCIYL	0.8605	0.8119	9	18
BLOC1S6-SCMH1	chr15	45879723	chr1	41514562	403	HLA-B35:04	EPTPVCIYL	0.8605	0.8119	9	18
BLOC1S6-SCMH1	chr15	45879723	chr1	41514562	403	HLA-B47:01	GEPTPVCIY	0.7537	0.527	8	17
BLOC1S6-SCMH1	chr15	45879723	chr1	41514562	403	HLA-B50:01	LEAGEPTPV	0.7097	0.9742	5	14
BLOC1S6-SCMH1	chr15	45879723	chr1	41514562	403	HLA-B41:01	LEAGEPTPV	0.5592	0.9673	5	14
BLOC1S6-SCMH1	chr15	45879723	chr1	41514562	403	HLA-B18:01	GEPTPVCIY	0.5055	0.9266	8	17
BLOC1S6-SCMH1	chr15	45879723	chr1	41514562	403	HLA-B35:12	EPTPVCIYL	0.8605	0.8119	9	18
BLOC1S6-SCMH1	chr15	45879723	chr1	41514562	403	HLA-B39:08	LEAGEPTPV	0.474	0.9584	5	14
BLOC1S6-SCMH1	chr15	45879723	chr1	41514562	403	HLA-B39:10	EPTPVCIYL	0.4317	0.7585	9	18
BLOC1S6-SCMH1	chr15	45879723	chr1	41514562	403	HLA-B35:77	EPTPVCIY	0.9738	0.7127	9	17
BLOC1S6-SCMH1	chr15	45879723	chr1	41514562	403	HLA-B35:23	EPTPVCIY	0.9734	0.7126	9	17
BLOC1S6-SCMH1	chr15	45879723	chr1	41514562	403	HLA-B35:24	EPTPVCIY	0.9571	0.8168	9	17
BLOC1S6-SCMH1	chr15	45879723	chr1	41514562	403	HLA-B18:07	EPTPVCIY	0.7881	0.7868	9	17
BLOC1S6-SCMH1	chr15	45879723	chr1	41514562	403	HLA-B40:04	LEAGEPTPV	0.9933	0.9642	5	14
BLOC1S6-SCMH1	chr15	45879723	chr1	41514562	403	HLA-B40:49	LEAGEPTPV	0.977	0.8276	5	14
BLOC1S6-SCMH1	chr15	45879723	chr1	41514562	403	HLA-B35:23	EPTPVCIYL	0.9428	0.7112	9	18
BLOC1S6-SCMH1	chr15	45879723	chr1	41514562	403	HLA-B35:77	EPTPVCIYL	0.9394	0.717	9	18
BLOC1S6-SCMH1	chr15	45879723	chr1	41514562	403	HLA-B44:26	GEPTPVCIY	0.9085	0.9317	8	17
BLOC1S6-SCMH1	chr15	45879723	chr1	41514562	403	HLA-B44:07	GEPTPVCIY	0.9085	0.9317	8	17
BLOC1S6-SCMH1	chr15	45879723	chr1	41514562	403	HLA-B44:13	GEPTPVCIY	0.9085	0.9317	8	17
BLOC1S6-SCMH1	chr15	45879723	chr1	41514562	403	HLA-B35:09	EPTPVCIYL	0.8605	0.8119	9	18
BLOC1S6-SCMH1	chr15	45879723	chr1	41514562	403	HLA-B35:30	EPTPVCIYL	0.8222	0.5651	9	18
BLOC1S6-SCMH1	chr15	45879723	chr1	41514562	403	HLA-B35:17	EPTPVCIYL	0.8222	0.5651	9	18
BLOC1S6-SCMH1	chr15	45879723	chr1	41514562	403	HLA-B35:24	EPTPVCIYL	0.7608	0.7882	9	18
BLOC1S6-SCMH1	chr15	45879723	chr1	41514562	403	HLA-B50:05	LEAGEPTPV	0.7097	0.9742	5	14
BLOC1S6-SCMH1	chr15	45879723	chr1	41514562	403	HLA-B50:04	LEAGEPTPV	0.7097	0.9742	5	14
BLOC1S6-SCMH1	chr15	45879723	chr1	41514562	403	HLA-B18:11	GEPTPVCIY	0.5614	0.87	8	17
BLOC1S6-SCMH1	chr15	45879723	chr1	41514562	403	HLA-B18:05	GEPTPVCIY	0.5055	0.9266	8	17
BLOC1S6-SCMH1	chr15	45879723	chr1	41514562	403	HLA-B18:08	GEPTPVCIY	0.5026	0.9086	8	17
BLOC1S6-SCMH1	chr15	45879723	chr1	41514562	403	HLA-B18:06	GEPTPVCIY	0.4785	0.9253	8	17
BLOC1S6-SCMH1	chr15	45879723	chr1	41514562	403	HLA-B15:53	GEPTPVCIY	0.0981	0.8076	8	17
BLOC1S6-SCMH1	chr15	45879723	chr1	41514562	403	HLA-B18:07	EPTPVCIYL	0.0815	0.7519	9	18
BLOC1S6-SCMH1	chr15	45879723	chr1	41514562	403	HLA-B48:02	GEPTPVCIY	0.0076	0.8762	8	17

Top

Potential FusionNeoAntigen Information of BLOC1S6-SCMH1 in HLA II

BLOC1S6-SCMH1_45879723_41514562.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
BLOC1S6-SCMH1	chr15	45879723	chr1	41514562	403	DRB3-0201	TPVCIYLNKNGSTGP	11	26
BLOC1S6-SCMH1	chr15	45879723	chr1	41514562	403	DRB3-0214	TPVCIYLNKNGSTGP	11	26
BLOC1S6-SCMH1	chr15	45879723	chr1	41514562	403	DRB3-0224	TPVCIYLNKNGSTGP	11	26

Top

Fusion breakpoint peptide structures of BLOC1S6-SCMH1

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
1520	EAGEPTPVCIYLNK	BLOC1S6	SCMH1	chr15	45879723	chr1	41514562	403

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of BLOC1S6-SCMH1

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	1520	EAGEPTPVCIYLNK	-6.9888	-7.1022
HLA-B14:02	3BVN	1520	EAGEPTPVCIYLNK	-3.71338	-4.74868
HLA-B52:01	3W39	1520	EAGEPTPVCIYLNK	-5.59342	-6.62872
HLA-B52:01	3W39	1520	EAGEPTPVCIYLNK	-5.47943	-5.59283
HLA-A24:02	5HGA	1520	EAGEPTPVCIYLNK	-6.88714	-7.00054
HLA-A24:02	5HGA	1520	EAGEPTPVCIYLNK	-6.46973	-7.50503
HLA-B44:05	3DX8	1520	EAGEPTPVCIYLNK	-6.00524	-6.11864
HLA-B44:05	3DX8	1520	EAGEPTPVCIYLNK	-5.7663	-6.8016

Top

Vaccine Design for the FusionNeoAntigens of BLOC1S6-SCMH1

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
BLOC1S6-SCMH1	chr15	45879723	chr1	41514562	5	14	LEAGEPTPV	TGGAGGCCGGGGAGCCGACGCCTGTTT
BLOC1S6-SCMH1	chr15	45879723	chr1	41514562	8	17	GEPTPVCIY	GGGAGCCGACGCCTGTTTGTATCTACT
BLOC1S6-SCMH1	chr15	45879723	chr1	41514562	9	17	EPTPVCIY	AGCCGACGCCTGTTTGTATCTACT
BLOC1S6-SCMH1	chr15	45879723	chr1	41514562	9	18	EPTPVCIYL	AGCCGACGCCTGTTTGTATCTACTTGA

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
BLOC1S6-SCMH1	chr15	45879723	chr1	41514562	11	26	TPVCIYLNKNGSTGP	CGCCTGTTTGTATCTACTTGAACAAGAATGGCAGCACAGGCCCCC

Top

Information of the samples that have these potential fusion neoantigens of BLOC1S6-SCMH1

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
PRAD	BLOC1S6-SCMH1	chr15	45879723	ENST00000220531	chr1	41514562	ENST00000326197	TCGA-V1-A9O9

Top

Potential target of CAR-T therapy development for BLOC1S6-SCMH1

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to BLOC1S6-SCMH1

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to BLOC1S6-SCMH1

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)