Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:VPS53-ZZEF1

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: VPS53-ZZEF1
	FusionPDB ID: 98494
	FusionGDB2.0 ID: 98494
		Hgene	Tgene
	Gene symbol	VPS53	ZZEF1
	Gene ID	55275	23140
	Gene name	VPS53 subunit of GARP complex	zinc finger ZZ-type and EF-hand domain containing 1
	Synonyms	HCCS1\|PCH2E\|hVps53L\|pp13624	ZZZ4
	Cytomap	17p13.3	17p13.2
	Type of gene	protein-coding	protein-coding
	Description	vacuolar protein sorting-associated protein 53 homologVPS53, GARP complex subunit	zinc finger ZZ-type and EF-hand domain-containing protein 1zinc finger, ZZ-type with EF hand domain 1
	Modification date	20200313	20200313
	UniProtAcc	.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000291074, ENST00000401468, ENST00000437048, ENST00000571805, ENST00000446250, ENST00000574029, ENST00000576149,	ENST00000574474, ENST00000381638,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	18 X 15 X 14=3780	12 X 15 X 6=1080
	# samples	24	15
	** MAII score	log2(24/3780*10)=-3.97727992349992 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(15/1080*10)=-2.84799690655495 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: VPS53 [Title/Abstract] AND ZZEF1 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: VPS53 [Title/Abstract] AND ZZEF1 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	VPS53(600658)-ZZEF1(4027345), # samples:3
Anticipated loss of major functional domain due to fusion event.	VPS53-ZZEF1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. VPS53-ZZEF1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. VPS53-ZZEF1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. VPS53-ZZEF1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner

Gene

GO ID

GO term

PubMed ID

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr17:600658/chr17:4027345)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across VPS53 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across ZZEF1 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000437048	VPS53	chr17	600658	-	ENST00000381638	ZZEF1	chr17	4027345	-	11409	432	147	8963	2938
ENST00000291074	VPS53	chr17	600658	-	ENST00000381638	ZZEF1	chr17	4027345	-	11396	419	134	8950	2938
ENST00000571805	VPS53	chr17	600658	-	ENST00000381638	ZZEF1	chr17	4027345	-	11399	422	137	8953	2938
ENST00000401468	VPS53	chr17	600658	-	ENST00000381638	ZZEF1	chr17	4027345	-	11262	285	0	8816	2938

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000437048	ENST00000381638	VPS53	chr17	600658	-	ZZEF1	chr17	4027345	-	0.001780142	0.9982198
ENST00000291074	ENST00000381638	VPS53	chr17	600658	-	ZZEF1	chr17	4027345	-	0.001746772	0.99825317
ENST00000571805	ENST00000381638	VPS53	chr17	600658	-	ZZEF1	chr17	4027345	-	0.001750397	0.9982496
ENST00000401468	ENST00000381638	VPS53	chr17	600658	-	ZZEF1	chr17	4027345	-	0.001512021	0.99848795

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for VPS53-ZZEF1

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
VPS53	chr17	600658	ZZEF1	chr17	4027345	285	95	VRGQTNVGQDGRQAFAQFDAEGDGTV
VPS53	chr17	600658	ZZEF1	chr17	4027345	419	95	VRGQTNVGQDGRQAFAQFDAEGDGTV
VPS53	chr17	600658	ZZEF1	chr17	4027345	422	95	VRGQTNVGQDGRQAFAQFDAEGDGTV
VPS53	chr17	600658	ZZEF1	chr17	4027345	432	95	VRGQTNVGQDGRQAFAQFDAEGDGTV

Top

Potential FusionNeoAntigen Information of VPS53-ZZEF1 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

VPS53-ZZEF1_600658_4027345.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	HLA-B15:03	GQDGRQAF	0.9757	0.7528	7	15
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	HLA-B13:01	GQDGRQAFAQF	0.9894	0.9594	7	18
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	HLA-B39:08	GQDGRQAF	0.8828	0.7952	7	15
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	HLA-C03:14	VGQDGRQAF	0.7371	0.95	6	15
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	HLA-B15:07	GQDGRQAFAQF	0.9986	0.7262	7	18
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	HLA-C03:02	VGQDGRQAF	0.9964	0.9365	6	15
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	HLA-C16:01	VGQDGRQAF	0.8282	0.9528	6	15
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	HLA-B15:35	GQDGRQAFAQF	0.9986	0.8865	7	18
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	HLA-B15:68	GQDGRQAFAQF	0.9985	0.6176	7	18

Top

Potential FusionNeoAntigen Information of VPS53-ZZEF1 in HLA II

VPS53-ZZEF1_600658_4027345.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0301	QTNVGQDGRQAFAQF	3	18
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0301	GQTNVGQDGRQAFAQ	2	17
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0307	QTNVGQDGRQAFAQF	3	18
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0307	GQTNVGQDGRQAFAQ	2	17
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0310	GQTNVGQDGRQAFAQ	2	17
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0310	QTNVGQDGRQAFAQF	3	18
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0310	RGQTNVGQDGRQAFA	1	16
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0313	QTNVGQDGRQAFAQF	3	18
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0313	GQTNVGQDGRQAFAQ	2	17
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0315	GQTNVGQDGRQAFAQ	2	17
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0315	QTNVGQDGRQAFAQF	3	18
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0318	QTNVGQDGRQAFAQF	3	18
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0318	GQTNVGQDGRQAFAQ	2	17
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0320	QTNVGQDGRQAFAQF	3	18
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0320	GQTNVGQDGRQAFAQ	2	17
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0322	QTNVGQDGRQAFAQF	3	18
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0322	GQTNVGQDGRQAFAQ	2	17
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0326	QTNVGQDGRQAFAQF	3	18
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0326	GQTNVGQDGRQAFAQ	2	17
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0328	QTNVGQDGRQAFAQF	3	18
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0328	GQTNVGQDGRQAFAQ	2	17
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0330	QTNVGQDGRQAFAQF	3	18
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0330	GQTNVGQDGRQAFAQ	2	17
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0332	QTNVGQDGRQAFAQF	3	18
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0332	GQTNVGQDGRQAFAQ	2	17
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0334	QTNVGQDGRQAFAQF	3	18
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0334	GQTNVGQDGRQAFAQ	2	17
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0336	QTNVGQDGRQAFAQF	3	18
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0336	GQTNVGQDGRQAFAQ	2	17
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0344	QTNVGQDGRQAFAQF	3	18
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0344	GQTNVGQDGRQAFAQ	2	17
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0346	QTNVGQDGRQAFAQF	3	18
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0346	GQTNVGQDGRQAFAQ	2	17
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0348	QTNVGQDGRQAFAQF	3	18
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0348	GQTNVGQDGRQAFAQ	2	17
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0350	QTNVGQDGRQAFAQF	3	18
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0350	GQTNVGQDGRQAFAQ	2	17
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0352	QTNVGQDGRQAFAQF	3	18
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0352	GQTNVGQDGRQAFAQ	2	17
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0354	QTNVGQDGRQAFAQF	3	18
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0354	GQTNVGQDGRQAFAQ	2	17
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0405	RQAFAQFDAEGDGTV	11	26
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0405	GRQAFAQFDAEGDGT	10	25
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0405	DGRQAFAQFDAEGDG	9	24
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0409	RQAFAQFDAEGDGTV	11	26
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0409	GRQAFAQFDAEGDGT	10	25
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0417	RQAFAQFDAEGDGTV	11	26
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0417	GRQAFAQFDAEGDGT	10	25
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0417	DGRQAFAQFDAEGDG	9	24
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0424	RQAFAQFDAEGDGTV	11	26
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0424	GRQAFAQFDAEGDGT	10	25
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0424	DGRQAFAQFDAEGDG	9	24
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0429	RQAFAQFDAEGDGTV	11	26
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0429	GRQAFAQFDAEGDGT	10	25
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0429	DGRQAFAQFDAEGDG	9	24
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0430	RQAFAQFDAEGDGTV	11	26
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0430	GRQAFAQFDAEGDGT	10	25
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0430	DGRQAFAQFDAEGDG	9	24
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0445	RQAFAQFDAEGDGTV	11	26
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0445	GRQAFAQFDAEGDGT	10	25
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0445	DGRQAFAQFDAEGDG	9	24
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0448	RQAFAQFDAEGDGTV	11	26
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0448	GRQAFAQFDAEGDGT	10	25
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0448	DGRQAFAQFDAEGDG	9	24
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0457	RQAFAQFDAEGDGTV	11	26
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0457	GRQAFAQFDAEGDGT	10	25
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0457	DGRQAFAQFDAEGDG	9	24
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0462	RQAFAQFDAEGDGTV	11	26
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0462	GRQAFAQFDAEGDGT	10	25
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0477	RQAFAQFDAEGDGTV	11	26
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0477	GRQAFAQFDAEGDGT	10	25
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0477	DGRQAFAQFDAEGDG	9	24
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0480	RQAFAQFDAEGDGTV	11	26
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0480	GRQAFAQFDAEGDGT	10	25
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0480	DGRQAFAQFDAEGDG	9	24
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0482	RQAFAQFDAEGDGTV	11	26
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0483	RQAFAQFDAEGDGTV	11	26
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0483	GRQAFAQFDAEGDGT	10	25
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0483	DGRQAFAQFDAEGDG	9	24
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0484	RQAFAQFDAEGDGTV	11	26
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0484	GRQAFAQFDAEGDGT	10	25
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0484	DGRQAFAQFDAEGDG	9	24
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0486	RQAFAQFDAEGDGTV	11	26
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0486	GRQAFAQFDAEGDGT	10	25
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0486	DGRQAFAQFDAEGDG	9	24
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0487	RQAFAQFDAEGDGTV	11	26
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0487	GRQAFAQFDAEGDGT	10	25
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0487	DGRQAFAQFDAEGDG	9	24
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0489	RQAFAQFDAEGDGTV	11	26
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0489	GRQAFAQFDAEGDGT	10	25
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0489	DGRQAFAQFDAEGDG	9	24
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0903	RQAFAQFDAEGDGTV	11	26
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0903	GRQAFAQFDAEGDGT	10	25
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0908	RQAFAQFDAEGDGTV	11	26
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0908	GRQAFAQFDAEGDGT	10	25
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-0908	DGRQAFAQFDAEGDG	9	24
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-1107	QTNVGQDGRQAFAQF	3	18
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-1107	GQTNVGQDGRQAFAQ	2	17
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-1476	GQTNVGQDGRQAFAQ	2	17
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-1476	QTNVGQDGRQAFAQF	3	18
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-1479	GQTNVGQDGRQAFAQ	2	17
VPS53-ZZEF1	chr17	600658	chr17	4027345	419	DRB1-1479	QTNVGQDGRQAFAQF	3	18

Top

Fusion breakpoint peptide structures of VPS53-ZZEF1

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
9958	VGQDGRQAFAQFDA	VPS53	ZZEF1	chr17	600658	chr17	4027345	419

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of VPS53-ZZEF1

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	9958	VGQDGRQAFAQFDA	-8.55667	-8.74867
HLA-B14:02	3BVN	9958	VGQDGRQAFAQFDA	-3.49457	-4.25557
HLA-B52:01	3W39	9958	VGQDGRQAFAQFDA	-7.26725	-7.45925
HLA-B52:01	3W39	9958	VGQDGRQAFAQFDA	-4.01461	-4.77561
HLA-A24:02	5HGA	9958	VGQDGRQAFAQFDA	-7.65911	-8.42011
HLA-A24:02	5HGA	9958	VGQDGRQAFAQFDA	-7.10204	-7.29404
HLA-B44:05	3DX8	9958	VGQDGRQAFAQFDA	-7.5556	-8.3166
HLA-B44:05	3DX8	9958	VGQDGRQAFAQFDA	-2.76159	-2.95359

Top

Vaccine Design for the FusionNeoAntigens of VPS53-ZZEF1

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
VPS53-ZZEF1	chr17	600658	chr17	4027345	6	15	VGQDGRQAF	GTGGGGCAGGATGGACGGCAAGCCTTT
VPS53-ZZEF1	chr17	600658	chr17	4027345	7	15	GQDGRQAF	GGGCAGGATGGACGGCAAGCCTTT
VPS53-ZZEF1	chr17	600658	chr17	4027345	7	18	GQDGRQAFAQF	GGGCAGGATGGACGGCAAGCCTTTGCCCAGTTT

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
VPS53-ZZEF1	chr17	600658	chr17	4027345	1	16	RGQTNVGQDGRQAFA	AGAGGTCAGACGAACGTGGGGCAGGATGGACGGCAAGCCTTTGCC
VPS53-ZZEF1	chr17	600658	chr17	4027345	10	25	GRQAFAQFDAEGDGT	GGACGGCAAGCCTTTGCCCAGTTTGATGCTGAGGGTGATGGGACA
VPS53-ZZEF1	chr17	600658	chr17	4027345	11	26	RQAFAQFDAEGDGTV	CGGCAAGCCTTTGCCCAGTTTGATGCTGAGGGTGATGGGACAGTT
VPS53-ZZEF1	chr17	600658	chr17	4027345	2	17	GQTNVGQDGRQAFAQ	GGTCAGACGAACGTGGGGCAGGATGGACGGCAAGCCTTTGCCCAG
VPS53-ZZEF1	chr17	600658	chr17	4027345	3	18	QTNVGQDGRQAFAQF	CAGACGAACGTGGGGCAGGATGGACGGCAAGCCTTTGCCCAGTTT
VPS53-ZZEF1	chr17	600658	chr17	4027345	9	24	DGRQAFAQFDAEGDG	GATGGACGGCAAGCCTTTGCCCAGTTTGATGCTGAGGGTGATGGG

Top

Information of the samples that have these potential fusion neoantigens of VPS53-ZZEF1

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
LUAD	VPS53-ZZEF1	chr17	600658	ENST00000291074	chr17	4027345	ENST00000381638	TCGA-55-8087-01A

Top

Potential target of CAR-T therapy development for VPS53-ZZEF1

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to VPS53-ZZEF1

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to VPS53-ZZEF1

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)