Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:WDR20-PPP2R5C

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: WDR20-PPP2R5C
	FusionPDB ID: 98912
	FusionGDB2.0 ID: 98912
		Hgene	Tgene
	Gene symbol	WDR20	PPP2R5C
	Gene ID	91833	5527
	Gene name	WD repeat domain 20	protein phosphatase 2 regulatory subunit B'gamma
	Synonyms	DMR	B56G\|B56gamma\|PR61G
	Cytomap	14q32.31	14q32.31
	Type of gene	protein-coding	protein-coding
	Description	WD repeat-containing protein 20	serine/threonine-protein phosphatase 2A 56 kDa regulatory subunit gamma isoformB' alpha regulatory subunitPP2A B subunit isoform B'-gammaPP2A B subunit isoform B56-gammaPP2A B subunit isoform PR61-gammaPP2A B subunit isoform R5-gammaprotein phosphat
	Modification date	20200313	20200313
	UniProtAcc	.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000557186, ENST00000299135, ENST00000322340, ENST00000335263, ENST00000342702, ENST00000424963, ENST00000454394, ENST00000556511, ENST00000556807, ENST00000558567, ENST00000499851, ENST00000545563,	ENST00000422945, ENST00000328724, ENST00000334743, ENST00000350249, ENST00000445439, ENST00000554442, ENST00000556068, ENST00000556260, ENST00000556946, ENST00000557095, ENST00000557714,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	12 X 7 X 8=672	15 X 17 X 10=2550
	# samples	16	22
	** MAII score	log2(16/672*10)=-2.0703893278914 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(22/2550*10)=-3.53492181822156 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: WDR20 [Title/Abstract] AND PPP2R5C [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: WDR20 [Title/Abstract] AND PPP2R5C [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	WDR20(102661457)-PPP2R5C(102323023), # samples:2 WDR20(102661457)-PPP2R5C(102302506), # samples:2
Anticipated loss of major functional domain due to fusion event.	WDR20-PPP2R5C seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. WDR20-PPP2R5C seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. WDR20-PPP2R5C seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. WDR20-PPP2R5C seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. WDR20-PPP2R5C seems lost the major protein functional domain in Hgene partner, which is a essential gene due to the frame-shifted ORF. WDR20-PPP2R5C seems lost the major protein functional domain in Tgene partner, which is a essential gene due to the frame-shifted ORF. WDR20-PPP2R5C seems lost the major protein functional domain in Tgene partner, which is a tumor suppressor due to the frame-shifted ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Tgene	PPP2R5C	GO:0008285	negative regulation of cell proliferation	17245430

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr14:102661457/chr14:102323023)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across WDR20 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across PPP2R5C (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000335263	WDR20	chr14	102606509	+	ENST00000422945	PPP2R5C	chr14	102384168	+	3295	329	68	577	169
ENST00000322340	WDR20	chr14	102606509	+	ENST00000422945	PPP2R5C	chr14	102384168	+	3264	298	37	546	169
ENST00000342702	WDR20	chr14	102606509	+	ENST00000422945	PPP2R5C	chr14	102384168	+	3246	280	19	528	169
ENST00000556807	WDR20	chr14	102606509	+	ENST00000422945	PPP2R5C	chr14	102384168	+	3246	280	19	528	169
ENST00000558567	WDR20	chr14	102606509	+	ENST00000422945	PPP2R5C	chr14	102384168	+	3242	276	15	524	169
ENST00000299135	WDR20	chr14	102606509	+	ENST00000422945	PPP2R5C	chr14	102384168	+	3228	262	1	510	169
ENST00000454394	WDR20	chr14	102606509	+	ENST00000422945	PPP2R5C	chr14	102384168	+	3225	259	10	507	165
ENST00000556511	WDR20	chr14	102606509	+	ENST00000422945	PPP2R5C	chr14	102384168	+	3215	249	0	497	165

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000335263	ENST00000422945	WDR20	chr14	102606509	+	PPP2R5C	chr14	102384168	+	0.00480065	0.9951994
ENST00000322340	ENST00000422945	WDR20	chr14	102606509	+	PPP2R5C	chr14	102384168	+	0.004603183	0.9953968
ENST00000342702	ENST00000422945	WDR20	chr14	102606509	+	PPP2R5C	chr14	102384168	+	0.004622406	0.99537754
ENST00000556807	ENST00000422945	WDR20	chr14	102606509	+	PPP2R5C	chr14	102384168	+	0.004622406	0.99537754
ENST00000558567	ENST00000422945	WDR20	chr14	102606509	+	PPP2R5C	chr14	102384168	+	0.004659049	0.99534094
ENST00000299135	ENST00000422945	WDR20	chr14	102606509	+	PPP2R5C	chr14	102384168	+	0.004686269	0.99531376
ENST00000454394	ENST00000422945	WDR20	chr14	102606509	+	PPP2R5C	chr14	102384168	+	0.004674467	0.99532557
ENST00000556511	ENST00000422945	WDR20	chr14	102606509	+	PPP2R5C	chr14	102384168	+	0.004638111	0.99536186

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for WDR20-PPP2R5C

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
WDR20	chr14	102606509	PPP2R5C	chr14	102384168	249	83	RELYFYIYKGVRKYTVYSQASTMSIP
WDR20	chr14	102606509	PPP2R5C	chr14	102384168	259	83	RELYFYIYKGVRKYTVYSQASTMSIP
WDR20	chr14	102606509	PPP2R5C	chr14	102384168	262	87	RELYFYIYKGVRKYTVYSQASTMSIP
WDR20	chr14	102606509	PPP2R5C	chr14	102384168	276	87	RELYFYIYKGVRKYTVYSQASTMSIP
WDR20	chr14	102606509	PPP2R5C	chr14	102384168	280	87	RELYFYIYKGVRKYTVYSQASTMSIP
WDR20	chr14	102606509	PPP2R5C	chr14	102384168	298	87	RELYFYIYKGVRKYTVYSQASTMSIP
WDR20	chr14	102606509	PPP2R5C	chr14	102384168	329	87	RELYFYIYKGVRKYTVYSQASTMSIP

Top

Potential FusionNeoAntigen Information of WDR20-PPP2R5C in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

WDR20-PPP2R5C_102606509_102384168.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	HLA-B15:01	YIYKGVRKY	0.9984	0.671	5	14
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	HLA-B15:25	YIYKGVRKY	0.9969	0.6565	5	14
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	HLA-B15:02	YIYKGVRKY	0.9917	0.6851	5	14
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	HLA-B15:17	YIYKGVRKY	0.9612	0.6174	5	14
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	HLA-B35:01	YIYKGVRKY	0.8496	0.6252	5	14
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	HLA-A32:13	YIYKGVRKY	0.651	0.5964	5	14
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	HLA-B15:21	YIYKGVRKY	0.9905	0.6005	5	14
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	HLA-B15:05	YIYKGVRKY	0.9184	0.5655	5	14
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	HLA-B15:31	YIYKGVRKY	0.8542	0.571	5	14
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	HLA-B15:04	YIYKGVRKY	0.8438	0.7118	5	14
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	HLA-C12:16	YIYKGVRKY	0.8268	0.7922	5	14
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	HLA-C07:67	YIYKGVRKY	0.6285	0.6454	5	14
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	HLA-C07:80	YIYKGVRKY	0.6285	0.6454	5	14
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	HLA-C07:10	YIYKGVRKY	0.5876	0.7582	5	14
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	HLA-C07:27	YIYKGVRKY	0.464	0.7053	5	14
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	HLA-C15:04	YIYKGVRKY	0.4324	0.7799	5	14
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	HLA-C12:12	YIYKGVRKY	0.4311	0.757	5	14
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	HLA-C07:05	YIYKGVRKY	0.3828	0.7078	5	14
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	HLA-C12:04	YIYKGVRKY	0.3069	0.9511	5	14
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	HLA-C06:03	YIYKGVRKY	0.2856	0.9435	5	14
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	HLA-C03:14	YIYKGVRKY	0.1415	0.861	5	14
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	HLA-B73:01	VRKYTVYSQA	0.9704	0.745	10	20
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	HLA-C07:80	FYIYKGVRKY	0.8789	0.6301	4	14
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	HLA-C07:67	FYIYKGVRKY	0.8789	0.6301	4	14
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	HLA-C12:16	FYIYKGVRKY	0.8637	0.9154	4	14
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	HLA-C07:27	FYIYKGVRKY	0.8581	0.7336	4	14
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	HLA-C07:10	FYIYKGVRKY	0.8514	0.8084	4	14
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	HLA-C07:05	FYIYKGVRKY	0.8433	0.6959	4	14
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	HLA-C14:03	IYKGVRKY	0.6449	0.7471	6	14
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	HLA-C14:02	IYKGVRKY	0.6449	0.7471	6	14
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	HLA-B15:27	YIYKGVRKY	0.9985	0.7149	5	14
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	HLA-B15:34	YIYKGVRKY	0.9984	0.671	5	14
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	HLA-B15:33	YIYKGVRKY	0.9984	0.671	5	14
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	HLA-B15:125	YIYKGVRKY	0.9984	0.671	5	14
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	HLA-B15:135	YIYKGVRKY	0.998	0.6923	5	14
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	HLA-B15:50	YIYKGVRKY	0.9979	0.6451	5	14
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	HLA-B15:35	YIYKGVRKY	0.9967	0.5529	5	14
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	HLA-B15:11	YIYKGVRKY	0.9962	0.537	5	14
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	HLA-B15:08	YIYKGVRKY	0.9962	0.5228	5	14
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	HLA-B35:43	YIYKGVRKY	0.9944	0.5536	5	14
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	HLA-B15:12	YIYKGVRKY	0.9937	0.508	5	14
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	HLA-B15:53	YIYKGVRKY	0.9925	0.5549	5	14
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	HLA-B35:11	YIYKGVRKY	0.9913	0.5914	5	14
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	HLA-B15:24	YIYKGVRKY	0.9901	0.586	5	14
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	HLA-A30:01	GVRKYTVYS	0.974	0.7331	9	18
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	HLA-B15:20	YIYKGVRKY	0.9215	0.6902	5	14
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	HLA-A25:01	YIYKGVRKY	0.9084	0.5049	5	14
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	HLA-B35:28	YIYKGVRKY	0.8653	0.7097	5	14
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	HLA-B35:23	YIYKGVRKY	0.8562	0.6075	5	14
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	HLA-B35:77	YIYKGVRKY	0.8496	0.6252	5	14
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	HLA-B35:20	YIYKGVRKY	0.8386	0.7274	5	14
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	HLA-C03:02	YIYKGVRKY	0.8186	0.8053	5	14
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	HLA-C12:02	YIYKGVRKY	0.7536	0.7956	5	14
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	HLA-B15:54	YIYKGVRKY	0.7501	0.505	5	14
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	HLA-A32:01	YIYKGVRKY	0.6728	0.6638	5	14
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	HLA-C07:17	YIYKGVRKY	0.6489	0.9021	5	14
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	HLA-C07:02	YIYKGVRKY	0.6285	0.6454	5	14
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	HLA-C16:04	YIYKGVRKY	0.5994	0.9005	5	14
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	HLA-C12:03	YIYKGVRKY	0.5744	0.8902	5	14
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	HLA-B35:24	YIYKGVRKY	0.5389	0.652	5	14
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	HLA-C15:09	YIYKGVRKY	0.4324	0.7799	5	14
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	HLA-C16:01	YIYKGVRKY	0.34	0.8722	5	14
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	HLA-C06:17	YIYKGVRKY	0.3043	0.941	5	14
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	HLA-C06:02	YIYKGVRKY	0.3043	0.941	5	14
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	HLA-B48:02	YIYKGVRKY	0.2607	0.6749	5	14
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	HLA-B18:04	YIYKGVRKY	0.2264	0.7905	5	14
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	HLA-B18:07	YIYKGVRKY	0.1285	0.6832	5	14
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	HLA-C16:02	YIYKGVRKY	0.1203	0.9326	5	14
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	HLA-C14:03	YIYKGVRKY	0.1179	0.756	5	14
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	HLA-C14:02	YIYKGVRKY	0.1179	0.756	5	14
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	HLA-C06:06	YIYKGVRKY	0.0845	0.896	5	14
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	HLA-C06:08	YIYKGVRKY	0.017	0.8514	5	14
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	HLA-C02:10	YIYKGVRKY	0.0039	0.8105	5	14
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	HLA-C02:02	YIYKGVRKY	0.0039	0.8105	5	14
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	HLA-B15:35	FYIYKGVRKY	0.9575	0.6649	4	14
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	HLA-C07:02	FYIYKGVRKY	0.8789	0.6301	4	14
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	HLA-C07:17	FYIYKGVRKY	0.8575	0.9052	4	14
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	HLA-C14:03	FYIYKGVRKY	0.4265	0.7701	4	14
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	HLA-C14:02	FYIYKGVRKY	0.4265	0.7701	4	14

Top

Potential FusionNeoAntigen Information of WDR20-PPP2R5C in HLA II

WDR20-PPP2R5C_102606509_102384168.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	DRB1-1108	RELYFYIYKGVRKYT	0	15
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	DRB1-1119	RELYFYIYKGVRKYT	0	15
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	DRB1-1131	RELYFYIYKGVRKYT	0	15
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	DRB1-1145	RELYFYIYKGVRKYT	0	15
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	DRB1-1164	RELYFYIYKGVRKYT	0	15
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	DRB1-1172	RELYFYIYKGVRKYT	0	15
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	DRB1-1356	RELYFYIYKGVRKYT	0	15
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	DRB1-1382	RELYFYIYKGVRKYT	0	15
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	DRB1-1386	RELYFYIYKGVRKYT	0	15
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	DRB1-1403	RELYFYIYKGVRKYT	0	15
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	DRB1-1440	RELYFYIYKGVRKYT	0	15
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	DRB1-1457	YKGVRKYTVYSQAST	7	22
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	DRB1-1467	RELYFYIYKGVRKYT	0	15
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	DRB1-1477	RELYFYIYKGVRKYT	0	15
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	DRB1-1498	RELYFYIYKGVRKYT	0	15
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	DRB1-1510	YKGVRKYTVYSQAST	7	22
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	DRB5-0102	RELYFYIYKGVRKYT	0	15
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	DRB5-0103	RELYFYIYKGVRKYT	0	15
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	DRB5-0103	ELYFYIYKGVRKYTV	1	16
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	DRB5-0108N	RELYFYIYKGVRKYT	0	15
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	DRB5-0111	ELYFYIYKGVRKYTV	1	16
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	DRB5-0111	RELYFYIYKGVRKYT	0	15
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	DRB5-0203	ELYFYIYKGVRKYTV	1	16
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	DRB5-0203	RELYFYIYKGVRKYT	0	15
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	262	DRB5-0203	LYFYIYKGVRKYTVY	2	17

Top

Fusion breakpoint peptide structures of WDR20-PPP2R5C

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
4081	IYKGVRKYTVYSQA	WDR20	PPP2R5C	chr14	102606509	chr14	102384168	262

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of WDR20-PPP2R5C

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	4081	IYKGVRKYTVYSQA	-7.9962	-8.1096
HLA-B14:02	3BVN	4081	IYKGVRKYTVYSQA	-5.70842	-6.74372
HLA-B52:01	3W39	4081	IYKGVRKYTVYSQA	-6.83737	-6.95077
HLA-B52:01	3W39	4081	IYKGVRKYTVYSQA	-4.4836	-5.5189
HLA-A11:01	4UQ2	4081	IYKGVRKYTVYSQA	-10.0067	-10.1201
HLA-A11:01	4UQ2	4081	IYKGVRKYTVYSQA	-9.03915	-10.0745
HLA-A24:02	5HGA	4081	IYKGVRKYTVYSQA	-6.56204	-6.67544
HLA-A24:02	5HGA	4081	IYKGVRKYTVYSQA	-5.42271	-6.45801
HLA-B44:05	3DX8	4081	IYKGVRKYTVYSQA	-7.85648	-8.89178
HLA-B44:05	3DX8	4081	IYKGVRKYTVYSQA	-5.3978	-5.5112
HLA-A02:01	6TDR	4081	IYKGVRKYTVYSQA	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of WDR20-PPP2R5C

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	10	20	VRKYTVYSQA	GTCCGCAAGTACACAGTGTATAGTCAAGCC
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	4	14	FYIYKGVRKY	TTCTATATCTACAAGGGGGTCCGCAAGTAC
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	5	14	YIYKGVRKY	TATATCTACAAGGGGGTCCGCAAGTAC
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	6	14	IYKGVRKY	ATCTACAAGGGGGTCCGCAAGTAC
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	9	18	GVRKYTVYS	GGGGTCCGCAAGTACACAGTGTATAGT

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	0	15	RELYFYIYKGVRKYT	CGGGAGCTGTACTTCTATATCTACAAGGGGGTCCGCAAGTACACA
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	1	16	ELYFYIYKGVRKYTV	GAGCTGTACTTCTATATCTACAAGGGGGTCCGCAAGTACACAGTG
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	2	17	LYFYIYKGVRKYTVY	CTGTACTTCTATATCTACAAGGGGGTCCGCAAGTACACAGTGTAT
WDR20-PPP2R5C	chr14	102606509	chr14	102384168	7	22	YKGVRKYTVYSQAST	TACAAGGGGGTCCGCAAGTACACAGTGTATAGTCAAGCCAGCACC

Top

Information of the samples that have these potential fusion neoantigens of WDR20-PPP2R5C

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
UCEC	WDR20-PPP2R5C	chr14	102606509	ENST00000299135	chr14	102384168	ENST00000422945	TCGA-D1-A0ZP-01A

Top

Potential target of CAR-T therapy development for WDR20-PPP2R5C

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to WDR20-PPP2R5C

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to WDR20-PPP2R5C

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)