Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:YAP1-TMEM123

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: YAP1-TMEM123
	FusionPDB ID: 99896
	FusionGDB2.0 ID: 99896
		Hgene	Tgene
	Gene symbol	YAP1	TMEM123
	Gene ID	10413	114908
	Gene name	Yes1 associated transcriptional regulator	transmembrane protein 123
	Synonyms	COB1\|YAP\|YAP2\|YAP65\|YKI	KCT3\|PORIMIN\|PORMIN
	Cytomap	11q22.1	11q22.2
	Type of gene	protein-coding	protein-coding
	Description	transcriptional coactivator YAP165 kDa Yes-associated proteinYes associated protein 1protein yorkie homologyes-associated protein 1yes-associated protein 2yes-associated protein YAP65 homologyorkie homolog	poriminKCT-3keratinocytes associated transmembrane protein 3pro-oncosis receptor inducing membrane injuryserine/threonine-rich receptor
	Modification date	20200329	20200313
	UniProtAcc	.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000282441, ENST00000345877, ENST00000524575, ENST00000526343, ENST00000531439, ENST00000537274, ENST00000528834,	ENST00000525577, ENST00000532161, ENST00000361236, ENST00000398136,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	23 X 13 X 14=4186	11 X 8 X 5=440
	# samples	25	11
	** MAII score	log2(25/4186*10)=-4.06557231159362 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(11/440*10)=-2 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: YAP1 [Title/Abstract] AND TMEM123 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: YAP1 [Title/Abstract] AND TMEM123 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	TMEM123(102323254)-YAP1(102033186), # samples:1 YAP1(102033302)-TMEM123(102272937), # samples:1
Anticipated loss of major functional domain due to fusion event.	YAP1-TMEM123 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. YAP1-TMEM123 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. YAP1-TMEM123 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. YAP1-TMEM123 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. TMEM123-YAP1 seems lost the major protein functional domain in Tgene partner, which is a cell metabolism gene due to the frame-shifted ORF. TMEM123-YAP1 seems lost the major protein functional domain in Tgene partner, which is a tumor suppressor due to the frame-shifted ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	YAP1	GO:0006974	cellular response to DNA damage stimulus	18280240
Hgene	YAP1	GO:0008283	cell proliferation	17974916
Hgene	YAP1	GO:0032570	response to progesterone	16772533
Hgene	YAP1	GO:0033148	positive regulation of intracellular estrogen receptor signaling pathway	16772533
Hgene	YAP1	GO:0045893	positive regulation of transcription, DNA-templated	20368466
Hgene	YAP1	GO:0045944	positive regulation of transcription by RNA polymerase II	25796446
Hgene	YAP1	GO:0050767	regulation of neurogenesis	25433207
Hgene	YAP1	GO:0050847	progesterone receptor signaling pathway	16772533
Hgene	YAP1	GO:0060242	contact inhibition	17974916
Hgene	YAP1	GO:0065003	protein-containing complex assembly	20368466
Hgene	YAP1	GO:0071480	cellular response to gamma radiation	18280240
Hgene	YAP1	GO:0072091	regulation of stem cell proliferation	25433207
Tgene	TMEM123	GO:0070267	oncosis	9600958\|11481458

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr11:102323254/chr11:102033186)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across YAP1 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across TMEM123 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000526343	YAP1	chr11	102033302	+	ENST00000361236	TMEM123	chr11	102272937	-	4081	1076	388	1545	385
ENST00000526343	YAP1	chr11	102033302	+	ENST00000398136	TMEM123	chr11	102272937	-	4077	1076	388	1545	385
ENST00000282441	YAP1	chr11	102033302	+	ENST00000361236	TMEM123	chr11	102272937	-	4081	1076	388	1545	385
ENST00000282441	YAP1	chr11	102033302	+	ENST00000398136	TMEM123	chr11	102272937	-	4077	1076	388	1545	385
ENST00000537274	YAP1	chr11	102033302	+	ENST00000361236	TMEM123	chr11	102272937	-	4063	1058	370	1527	385
ENST00000537274	YAP1	chr11	102033302	+	ENST00000398136	TMEM123	chr11	102272937	-	4059	1058	370	1527	385
ENST00000345877	YAP1	chr11	102033302	+	ENST00000361236	TMEM123	chr11	102272937	-	4063	1058	370	1527	385
ENST00000345877	YAP1	chr11	102033302	+	ENST00000398136	TMEM123	chr11	102272937	-	4059	1058	370	1527	385
ENST00000531439	YAP1	chr11	102033302	+	ENST00000361236	TMEM123	chr11	102272937	-	3693	688	0	1157	385
ENST00000531439	YAP1	chr11	102033302	+	ENST00000398136	TMEM123	chr11	102272937	-	3689	688	0	1157	385
ENST00000524575	YAP1	chr11	102033302	+	ENST00000361236	TMEM123	chr11	102272937	-	3604	599	262	1068	268
ENST00000524575	YAP1	chr11	102033302	+	ENST00000398136	TMEM123	chr11	102272937	-	3600	599	262	1068	268

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000526343	ENST00000361236	YAP1	chr11	102033302	+	TMEM123	chr11	102272937	-	0.000875459	0.9991246
ENST00000526343	ENST00000398136	YAP1	chr11	102033302	+	TMEM123	chr11	102272937	-	0.00088552	0.99911445
ENST00000282441	ENST00000361236	YAP1	chr11	102033302	+	TMEM123	chr11	102272937	-	0.000875459	0.9991246
ENST00000282441	ENST00000398136	YAP1	chr11	102033302	+	TMEM123	chr11	102272937	-	0.00088552	0.99911445
ENST00000537274	ENST00000361236	YAP1	chr11	102033302	+	TMEM123	chr11	102272937	-	0.000864387	0.9991357
ENST00000537274	ENST00000398136	YAP1	chr11	102033302	+	TMEM123	chr11	102272937	-	0.000870556	0.9991295
ENST00000345877	ENST00000361236	YAP1	chr11	102033302	+	TMEM123	chr11	102272937	-	0.000864387	0.9991357
ENST00000345877	ENST00000398136	YAP1	chr11	102033302	+	TMEM123	chr11	102272937	-	0.000870556	0.9991295
ENST00000531439	ENST00000361236	YAP1	chr11	102033302	+	TMEM123	chr11	102272937	-	0.000678543	0.99932146
ENST00000531439	ENST00000398136	YAP1	chr11	102033302	+	TMEM123	chr11	102272937	-	0.000685404	0.99931455
ENST00000524575	ENST00000361236	YAP1	chr11	102033302	+	TMEM123	chr11	102272937	-	0.003338868	0.9966612
ENST00000524575	ENST00000398136	YAP1	chr11	102033302	+	TMEM123	chr11	102272937	-	0.003714523	0.99628544

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for YAP1-TMEM123

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
YAP1	chr11	102033302	TMEM123	chr11	102272937	1058	229	SPPVQQNMMNSASETLQHVPSDHTNE
YAP1	chr11	102033302	TMEM123	chr11	102272937	1076	229	SPPVQQNMMNSASETLQHVPSDHTNE
YAP1	chr11	102033302	TMEM123	chr11	102272937	599	112	SPPVQQNMMNSASETLQHVPSDHTNE
YAP1	chr11	102033302	TMEM123	chr11	102272937	688	229	SPPVQQNMMNSASETLQHVPSDHTNE

Top

Potential FusionNeoAntigen Information of YAP1-TMEM123 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

YAP1-TMEM123_102033302_102272937.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-B50:02	SETLQHVP	0.9998	0.7445	12	20
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-B45:01	SETLQHVP	0.9997	0.8803	12	20
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-B41:01	SETLQHVP	0.9941	0.868	12	20
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-B52:01	SASETLQHV	0.9965	0.9881	10	19
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-A02:22	MMNSASETL	0.9884	0.6068	7	16
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-A02:38	SASETLQHV	0.9837	0.6151	10	19
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-A02:13	MMNSASETL	0.9723	0.7532	7	16
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-A02:30	MMNSASETL	0.971	0.5459	7	16
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-A02:67	MMNSASETL	0.971	0.5459	7	16
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-A02:24	MMNSASETL	0.971	0.5459	7	16
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-A02:11	MMNSASETL	0.9703	0.5893	7	16
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-A02:60	MMNSASETL	0.9696	0.5334	7	16
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-A02:27	MMNSASETL	0.9683	0.6882	7	16
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-A02:38	MMNSASETL	0.9663	0.7535	7	16
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-A02:21	SASETLQHV	0.966	0.8053	10	19
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-A02:22	SASETLQHV	0.958	0.5082	10	19
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-A02:35	MMNSASETL	0.9483	0.5836	7	16
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-A02:04	MMNSASETL	0.9478	0.555	7	16
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-A02:29	MMNSASETL	0.9349	0.5515	7	16
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-B15:02	MMNSASETL	0.9107	0.9483	7	16
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-A02:13	SASETLQHV	0.9042	0.7146	10	19
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-A02:27	SASETLQHV	0.9006	0.6197	10	19
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-B15:10	MMNSASETL	0.8587	0.6269	7	16
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-A02:19	MMNSASETL	0.8453	0.5456	7	16
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-B35:03	MMNSASETL	0.832	0.9385	7	16
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-A02:19	SASETLQHV	0.6286	0.5083	10	19
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-B39:01	MMNSASETL	0.6061	0.939	7	16
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-B13:01	MMNSASETL	0.1134	0.9617	7	16
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-C05:09	SASETLQHV	0.9998	0.8961	10	19
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-C04:06	SASETLQHV	0.9998	0.9071	10	19
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-C15:06	SASETLQHV	0.9998	0.9218	10	19
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-C03:07	SASETLQHV	0.9997	0.9774	10	19
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-C15:04	SASETLQHV	0.9996	0.9062	10	19
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-C03:19	SASETLQHV	0.9989	0.9919	10	19
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-B51:07	SASETLQHV	0.9969	0.9715	10	19
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-C03:19	MMNSASETL	0.9962	0.9877	7	16
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-C03:08	SASETLQHV	0.9957	0.9573	10	19
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-C08:04	SASETLQHV	0.9956	0.9482	10	19
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-C08:13	SASETLQHV	0.9956	0.9482	10	19
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-C12:04	SASETLQHV	0.9954	0.9897	10	19
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-C06:03	SASETLQHV	0.9945	0.9879	10	19
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-A02:05	MMNSASETL	0.9851	0.5895	7	16
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-C12:12	SASETLQHV	0.9844	0.9094	10	19
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-B15:04	MMNSASETL	0.9767	0.9378	7	16
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-A02:01	MMNSASETL	0.971	0.5459	7	16
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-C02:06	SASETLQHV	0.9413	0.9282	10	19
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-C08:03	SASETLQHV	0.9401	0.9751	10	19
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-B15:21	MMNSASETL	0.9123	0.9401	7	16
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-C01:17	MMNSASETL	0.8832	0.9552	7	16
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-B39:08	MMNSASETL	0.7751	0.819	7	16
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-B39:09	MMNSASETL	0.7646	0.6988	7	16
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-C01:30	MMNSASETL	0.7411	0.9681	7	16
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-B15:31	MMNSASETL	0.7345	0.9355	7	16
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-B15:05	MMNSASETL	0.6866	0.9337	7	16
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-C15:02	SASETLQHV	0.9999	0.7442	10	19
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-C04:03	SASETLQHV	0.9998	0.8566	10	19
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-C05:01	SASETLQHV	0.9998	0.8961	10	19
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-C15:05	SASETLQHV	0.9998	0.7974	10	19
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-C15:09	SASETLQHV	0.9996	0.9062	10	19
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-C06:06	SASETLQHV	0.9993	0.9859	10	19
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-C03:05	SASETLQHV	0.9988	0.8708	10	19
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-C03:17	SASETLQHV	0.9985	0.9729	10	19
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-C03:06	SASETLQHV	0.998	0.9936	10	19
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-B78:02	SASETLQHV	0.9978	0.8843	10	19
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-C16:04	SASETLQHV	0.9969	0.9733	10	19
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-A68:02	SASETLQHV	0.9968	0.5824	10	19
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-C03:04	MMNSASETL	0.9965	0.9879	7	16
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-C03:03	MMNSASETL	0.9965	0.9879	7	16
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-C03:04	SASETLQHV	0.9959	0.9931	10	19
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-C03:03	SASETLQHV	0.9959	0.9931	10	19
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-A69:01	SASETLQHV	0.9928	0.8989	10	19
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-C16:02	SASETLQHV	0.9896	0.9894	10	19
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-C06:17	SASETLQHV	0.9888	0.9875	10	19
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-C06:02	SASETLQHV	0.9888	0.9875	10	19
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-A02:03	MMNSASETL	0.988	0.7529	7	16
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-C03:06	MMNSASETL	0.9805	0.9893	7	16
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-B51:09	SASETLQHV	0.9804	0.5298	10	19
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-C12:03	SASETLQHV	0.9776	0.9707	10	19
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-A02:14	SASETLQHV	0.9673	0.701	10	19
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-A02:03	SASETLQHV	0.9664	0.7378	10	19
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-A02:06	SASETLQHV	0.966	0.8053	10	19
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-B15:73	MMNSASETL	0.9602	0.805	7	16
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-C16:01	SASETLQHV	0.9508	0.9757	10	19
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-C17:01	SASETLQHV	0.95	0.9475	10	19
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-C08:01	SASETLQHV	0.9401	0.9751	10	19
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-C12:02	SASETLQHV	0.9299	0.9399	10	19
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-B15:30	MMNSASETL	0.9107	0.8177	7	16
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-C01:03	MMNSASETL	0.909	0.9541	7	16
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-C01:02	MMNSASETL	0.8934	0.9541	7	16
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-C06:08	SASETLQHV	0.8734	0.9803	10	19
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-C02:10	SASETLQHV	0.8558	0.9597	10	19
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-C02:02	SASETLQHV	0.8558	0.9597	10	19
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-B35:13	MMNSASETL	0.8293	0.9415	7	16
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-C07:04	SASETLQHV	0.7646	0.9712	10	19
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-B39:11	MMNSASETL	0.715	0.8693	7	16
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-B15:20	MMNSASETL	0.6972	0.9539	7	16
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-B39:02	MMNSASETL	0.6917	0.9259	7	16
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-B15:09	MMNSASETL	0.552	0.7873	7	16
YAP1-TMEM123	chr11	102033302	chr11	102272937	1076	HLA-B07:13	SASETLQHV	0.5186	0.7095	10	19

Top

Potential FusionNeoAntigen Information of YAP1-TMEM123 in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of YAP1-TMEM123

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
6270	NMMNSASETLQHVP	YAP1	TMEM123	chr11	102033302	chr11	102272937	1076

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of YAP1-TMEM123

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	6270	NMMNSASETLQHVP	-7.15543	-7.26883
HLA-B14:02	3BVN	6270	NMMNSASETLQHVP	-4.77435	-5.80965
HLA-B52:01	3W39	6270	NMMNSASETLQHVP	-6.80875	-6.92215
HLA-B52:01	3W39	6270	NMMNSASETLQHVP	-4.20386	-5.23916
HLA-A11:01	4UQ2	6270	NMMNSASETLQHVP	-7.5194	-8.5547
HLA-A11:01	4UQ2	6270	NMMNSASETLQHVP	-6.9601	-7.0735
HLA-A24:02	5HGA	6270	NMMNSASETLQHVP	-7.52403	-7.63743
HLA-A24:02	5HGA	6270	NMMNSASETLQHVP	-5.82433	-6.85963
HLA-B27:05	6PYJ	6270	NMMNSASETLQHVP	-3.28285	-4.31815
HLA-B44:05	3DX8	6270	NMMNSASETLQHVP	-5.91172	-6.94702
HLA-B44:05	3DX8	6270	NMMNSASETLQHVP	-4.24346	-4.35686

Top

Vaccine Design for the FusionNeoAntigens of YAP1-TMEM123

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
YAP1-TMEM123	chr11	102033302	chr11	102272937	10	19	SASETLQHV	CGGCTTCAGAGACTCTCCAACATGTGC
YAP1-TMEM123	chr11	102033302	chr11	102272937	12	20	SETLQHVP	CAGAGACTCTCCAACATGTGCCTT
YAP1-TMEM123	chr11	102033302	chr11	102272937	7	16	MMNSASETL	TGATGAACTCGGCTTCAGAGACTCTCC

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of YAP1-TMEM123

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
CESC	YAP1-TMEM123	chr11	102033302	ENST00000282441	chr11	102272937	ENST00000361236	TCGA-MY-A913-01A

Top

Potential target of CAR-T therapy development for YAP1-TMEM123

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Tgene

TMEM123

chr11:102033302

chr11:102272937

ENST00000361236

167_187

190.0

Transmembrane

Helical

Tgene

TMEM123

chr11:102033302

chr11:102272937

ENST00000398136

167_187

209.0

Transmembrane

Helical

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to YAP1-TMEM123

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to YAP1-TMEM123

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)