Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:BNIP3L-XPA

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: BNIP3L-XPA
	FusionPDB ID: 9994
	FusionGDB2.0 ID: 9994
		Hgene	Tgene
	Gene symbol	BNIP3L	XPA
	Gene ID	665	7507
	Gene name	BCL2 interacting protein 3 like	XPA, DNA damage recognition and repair factor
	Synonyms	BNIP3a\|NIX	XP1\|XPAC
	Cytomap	8p21.2	9q22.33
	Type of gene	protein-coding	protein-coding
	Description	BCL2/adenovirus E1B 19 kDa protein-interacting protein 3-likeBCL2/adenovirus E1B 19 kDa protein-interacting protein 3ABCL2/adenovirus E1B 19-kd protein-interacting protein 3aBCL2/adenovirus E1B 19kDa interacting protein 3 likeNIP-3-like protein XNIP3	DNA repair protein complementing XP-A cellsxeroderma pigmentosum group A-complementing proteinxeroderma pigmentosum, complementation group A
	Modification date	20200313	20200322
	UniProtAcc	O60238 Main function of 5'-partner protein: FUNCTION: Induces apoptosis. Interacts with viral and cellular anti-apoptosis proteins. Can overcome the suppressors BCL-2 and BCL-XL, although high levels of BCL-XL expression will inhibit apoptosis. Inhibits apoptosis induced by BNIP3. Involved in mitochondrial quality control via its interaction with SPATA18/MIEAP: in response to mitochondrial damage, participates in mitochondrial protein catabolic process (also named MALM) leading to the degradation of damaged proteins inside mitochondria. The physical interaction of SPATA18/MIEAP, BNIP3 and BNIP3L/NIX at the mitochondrial outer membrane regulates the opening of a pore in the mitochondrial double membrane in order to mediate the translocation of lysosomal proteins from the cytoplasm to the mitochondrial matrix. May function as a tumor suppressor. {ECO:0000269\|PubMed:10381623, ECO:0000269\|PubMed:21264228}.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000521254, ENST00000380629, ENST00000518611, ENST00000520409, ENST00000523515,	ENST00000375128, ENST00000485042,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	7 X 7 X 2=98	5 X 5 X 2=50
	# samples	9	5
	** MAII score	log2(9/98*10)=-0.122856747785533 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(5/50*10)=0
Fusion gene context	PubMed: BNIP3L [Title/Abstract] AND XPA [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: BNIP3L [Title/Abstract] AND XPA [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	BNIP3L(26265892)-XPA(100437869), # samples:1
Anticipated loss of major functional domain due to fusion event.	BNIP3L-XPA seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. BNIP3L-XPA seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. BNIP3L-XPA seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. BNIP3L-XPA seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	BNIP3L	GO:0043065	positive regulation of apoptotic process	9973195
Hgene	BNIP3L	GO:0043066	negative regulation of apoptotic process	10381623
Hgene	BNIP3L	GO:0051607	defense response to virus	9973195
Tgene	XPA	GO:0006281	DNA repair	1601884
Tgene	XPA	GO:0009650	UV protection	1601884

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr8:26265892/chr9:100437869)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across BNIP3L (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across XPA (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000380629	BNIP3L	chr8	26265892	+	ENST00000375128	XPA	chr9	100437869	-	1523	844	71	904	277
ENST00000523515	BNIP3L	chr8	26265892	+	ENST00000375128	XPA	chr9	100437869	-	1291	612	19	672	217
ENST00000520409	BNIP3L	chr8	26265892	+	ENST00000375128	XPA	chr9	100437869	-	1272	593	12	653	213
ENST00000518611	BNIP3L	chr8	26265892	+	ENST00000375128	XPA	chr9	100437869	-	1346	667	176	727	183

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000380629	ENST00000375128	BNIP3L	chr8	26265892	+	XPA	chr9	100437869	-	0.001758601	0.9982414
ENST00000523515	ENST00000375128	BNIP3L	chr8	26265892	+	XPA	chr9	100437869	-	0.003772226	0.99622774
ENST00000520409	ENST00000375128	BNIP3L	chr8	26265892	+	XPA	chr9	100437869	-	0.004320527	0.99567956
ENST00000518611	ENST00000375128	BNIP3L	chr8	26265892	+	XPA	chr9	100437869	-	0.006152366	0.99384767

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for BNIP3L-XPA

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
BNIP3L	chr8	26265892	XPA	chr9	100437869	593	187	FLKVFIPSLFLSHVLALGLGIAASSK
BNIP3L	chr8	26265892	XPA	chr9	100437869	612	191	FLKVFIPSLFLSHVLALGLGIAASSK
BNIP3L	chr8	26265892	XPA	chr9	100437869	667	157	FLKVFIPSLFLSHVLALGLGIAASSK
BNIP3L	chr8	26265892	XPA	chr9	100437869	844	251	FLKVFIPSLFLSHVLALGLGIAASSK

Top

Potential FusionNeoAntigen Information of BNIP3L-XPA in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

BNIP3L-XPA_26265892_100437869.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
BNIP3L-XPA	chr8	26265892	chr9	100437869	844	HLA-B39:24	SHVLALGL	0.9998	0.7267	11	19
BNIP3L-XPA	chr8	26265892	chr9	100437869	844	HLA-B39:01	SHVLALGL	0.9997	0.9489	11	19
BNIP3L-XPA	chr8	26265892	chr9	100437869	844	HLA-B38:01	SHVLALGL	0.9995	0.9861	11	19
BNIP3L-XPA	chr8	26265892	chr9	100437869	844	HLA-B38:02	SHVLALGL	0.9995	0.9868	11	19
BNIP3L-XPA	chr8	26265892	chr9	100437869	844	HLA-B15:10	SHVLALGL	0.9993	0.7854	11	19
BNIP3L-XPA	chr8	26265892	chr9	100437869	844	HLA-B08:01	FLSHVLAL	0.998	0.6784	9	17
BNIP3L-XPA	chr8	26265892	chr9	100437869	844	HLA-B15:37	SHVLALGL	0.9945	0.873	11	19
BNIP3L-XPA	chr8	26265892	chr9	100437869	844	HLA-A02:04	FLSHVLAL	0.9945	0.7508	9	17
BNIP3L-XPA	chr8	26265892	chr9	100437869	844	HLA-A02:17	FLSHVLAL	0.9939	0.6398	9	17
BNIP3L-XPA	chr8	26265892	chr9	100437869	844	HLA-A02:13	FLSHVLAL	0.9937	0.7522	9	17
BNIP3L-XPA	chr8	26265892	chr9	100437869	844	HLA-A02:38	FLSHVLAL	0.992	0.7085	9	17
BNIP3L-XPA	chr8	26265892	chr9	100437869	844	HLA-B08:01	LFLSHVLAL	0.8949	0.8197	8	17
BNIP3L-XPA	chr8	26265892	chr9	100437869	844	HLA-A02:22	SLFLSHVLAL	0.995	0.6458	7	17
BNIP3L-XPA	chr8	26265892	chr9	100437869	844	HLA-A02:13	SLFLSHVLAL	0.9899	0.741	7	17
BNIP3L-XPA	chr8	26265892	chr9	100437869	844	HLA-A02:11	SLFLSHVLAL	0.9896	0.5832	7	17
BNIP3L-XPA	chr8	26265892	chr9	100437869	844	HLA-A02:24	SLFLSHVLAL	0.9894	0.5774	7	17
BNIP3L-XPA	chr8	26265892	chr9	100437869	844	HLA-A02:60	SLFLSHVLAL	0.9894	0.5485	7	17
BNIP3L-XPA	chr8	26265892	chr9	100437869	844	HLA-A02:67	SLFLSHVLAL	0.9894	0.5774	7	17
BNIP3L-XPA	chr8	26265892	chr9	100437869	844	HLA-A02:30	SLFLSHVLAL	0.9894	0.5774	7	17
BNIP3L-XPA	chr8	26265892	chr9	100437869	844	HLA-A02:27	SLFLSHVLAL	0.989	0.7095	7	17
BNIP3L-XPA	chr8	26265892	chr9	100437869	844	HLA-A02:04	SLFLSHVLAL	0.9838	0.6784	7	17
BNIP3L-XPA	chr8	26265892	chr9	100437869	844	HLA-B35:03	IPSLFLSHVL	0.9811	0.7813	5	15
BNIP3L-XPA	chr8	26265892	chr9	100437869	844	HLA-A02:17	SLFLSHVLAL	0.9811	0.5173	7	17
BNIP3L-XPA	chr8	26265892	chr9	100437869	844	HLA-A02:38	SLFLSHVLAL	0.9625	0.8391	7	17
BNIP3L-XPA	chr8	26265892	chr9	100437869	844	HLA-A02:35	SLFLSHVLAL	0.9582	0.6047	7	17
BNIP3L-XPA	chr8	26265892	chr9	100437869	844	HLA-A02:29	SLFLSHVLAL	0.9575	0.5837	7	17
BNIP3L-XPA	chr8	26265892	chr9	100437869	844	HLA-A02:20	SLFLSHVLAL	0.9522	0.5815	7	17
BNIP3L-XPA	chr8	26265892	chr9	100437869	844	HLA-B35:02	IPSLFLSHVL	0.9134	0.7783	5	15
BNIP3L-XPA	chr8	26265892	chr9	100437869	844	HLA-B35:04	IPSLFLSHVL	0.9134	0.7783	5	15
BNIP3L-XPA	chr8	26265892	chr9	100437869	844	HLA-B39:09	SHVLALGL	0.9998	0.8092	11	19
BNIP3L-XPA	chr8	26265892	chr9	100437869	844	HLA-B39:05	SHVLALGL	0.9994	0.9412	11	19
BNIP3L-XPA	chr8	26265892	chr9	100437869	844	HLA-C07:05	LFLSHVLAL	0.5757	0.9692	8	17
BNIP3L-XPA	chr8	26265892	chr9	100437869	844	HLA-C07:13	LFLSHVLAL	0.5725	0.8776	8	17
BNIP3L-XPA	chr8	26265892	chr9	100437869	844	HLA-C07:29	LFLSHVLAL	0.5599	0.9163	8	17
BNIP3L-XPA	chr8	26265892	chr9	100437869	844	HLA-C07:80	LFLSHVLAL	0.5466	0.9115	8	17
BNIP3L-XPA	chr8	26265892	chr9	100437869	844	HLA-C07:67	LFLSHVLAL	0.5466	0.9115	8	17
BNIP3L-XPA	chr8	26265892	chr9	100437869	844	HLA-C07:10	LFLSHVLAL	0.5347	0.9537	8	17
BNIP3L-XPA	chr8	26265892	chr9	100437869	844	HLA-B39:10	IPSLFLSHV	0.4839	0.8712	5	14
BNIP3L-XPA	chr8	26265892	chr9	100437869	844	HLA-C04:14	LFLSHVLAL	0.4068	0.904	8	17
BNIP3L-XPA	chr8	26265892	chr9	100437869	844	HLA-A02:02	SLFLSHVLAL	0.9953	0.5463	7	17
BNIP3L-XPA	chr8	26265892	chr9	100437869	844	HLA-A02:01	SLFLSHVLAL	0.9894	0.5774	7	17
BNIP3L-XPA	chr8	26265892	chr9	100437869	844	HLA-B35:12	IPSLFLSHVL	0.9134	0.7783	5	15
BNIP3L-XPA	chr8	26265892	chr9	100437869	844	HLA-B39:10	IPSLFLSHVL	0.878	0.8524	5	15
BNIP3L-XPA	chr8	26265892	chr9	100437869	844	HLA-C01:17	FIPSLFLSHVL	0.9487	0.9379	4	15
BNIP3L-XPA	chr8	26265892	chr9	100437869	844	HLA-C01:30	FIPSLFLSHVL	0.7519	0.9632	4	15
BNIP3L-XPA	chr8	26265892	chr9	100437869	844	HLA-B39:31	SHVLALGL	0.9997	0.9518	11	19
BNIP3L-XPA	chr8	26265892	chr9	100437869	844	HLA-B38:05	SHVLALGL	0.9995	0.9861	11	19
BNIP3L-XPA	chr8	26265892	chr9	100437869	844	HLA-B08:18	FLSHVLAL	0.998	0.6784	9	17
BNIP3L-XPA	chr8	26265892	chr9	100437869	844	HLA-B15:09	SHVLALGL	0.9978	0.8539	11	19
BNIP3L-XPA	chr8	26265892	chr9	100437869	844	HLA-B08:12	FLSHVLAL	0.9759	0.8115	9	17
BNIP3L-XPA	chr8	26265892	chr9	100437869	844	HLA-B39:11	SHVLALGL	0.971	0.8877	11	19
BNIP3L-XPA	chr8	26265892	chr9	100437869	844	HLA-B08:18	LFLSHVLAL	0.8949	0.8197	8	17
BNIP3L-XPA	chr8	26265892	chr9	100437869	844	HLA-C03:67	LFLSHVLAL	0.8213	0.9717	8	17
BNIP3L-XPA	chr8	26265892	chr9	100437869	844	HLA-B67:01	IPSLFLSHV	0.6907	0.6163	5	14
BNIP3L-XPA	chr8	26265892	chr9	100437869	844	HLA-B08:12	LFLSHVLAL	0.6903	0.8962	8	17
BNIP3L-XPA	chr8	26265892	chr9	100437869	844	HLA-C07:04	LFLSHVLAL	0.6304	0.9513	8	17
BNIP3L-XPA	chr8	26265892	chr9	100437869	844	HLA-C07:17	LFLSHVLAL	0.5594	0.9499	8	17
BNIP3L-XPA	chr8	26265892	chr9	100437869	844	HLA-C07:02	LFLSHVLAL	0.5466	0.9115	8	17
BNIP3L-XPA	chr8	26265892	chr9	100437869	844	HLA-C04:04	LFLSHVLAL	0.3362	0.9001	8	17
BNIP3L-XPA	chr8	26265892	chr9	100437869	844	HLA-C06:06	LFLSHVLAL	0.3283	0.9666	8	17
BNIP3L-XPA	chr8	26265892	chr9	100437869	844	HLA-C14:02	LFLSHVLAL	0.2227	0.9508	8	17
BNIP3L-XPA	chr8	26265892	chr9	100437869	844	HLA-C14:03	LFLSHVLAL	0.2227	0.9508	8	17
BNIP3L-XPA	chr8	26265892	chr9	100437869	844	HLA-A02:03	SLFLSHVLAL	0.9951	0.725	7	17
BNIP3L-XPA	chr8	26265892	chr9	100437869	844	HLA-B35:09	IPSLFLSHVL	0.9134	0.7783	5	15
BNIP3L-XPA	chr8	26265892	chr9	100437869	844	HLA-B67:01	IPSLFLSHVL	0.8841	0.6545	5	15
BNIP3L-XPA	chr8	26265892	chr9	100437869	844	HLA-C01:02	FIPSLFLSHVL	0.955	0.933	4	15

Top

Potential FusionNeoAntigen Information of BNIP3L-XPA in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of BNIP3L-XPA

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
6993	PSLFLSHVLALGLG	BNIP3L	XPA	chr8	26265892	chr9	100437869	844

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of BNIP3L-XPA

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	6993	PSLFLSHVLALGLG	-7.15543	-7.26883
HLA-B14:02	3BVN	6993	PSLFLSHVLALGLG	-4.77435	-5.80965
HLA-B52:01	3W39	6993	PSLFLSHVLALGLG	-6.80875	-6.92215
HLA-B52:01	3W39	6993	PSLFLSHVLALGLG	-4.20386	-5.23916
HLA-A11:01	4UQ2	6993	PSLFLSHVLALGLG	-7.5194	-8.5547
HLA-A11:01	4UQ2	6993	PSLFLSHVLALGLG	-6.9601	-7.0735
HLA-A24:02	5HGA	6993	PSLFLSHVLALGLG	-7.52403	-7.63743
HLA-A24:02	5HGA	6993	PSLFLSHVLALGLG	-5.82433	-6.85963
HLA-B27:05	6PYJ	6993	PSLFLSHVLALGLG	-3.28285	-4.31815
HLA-B44:05	3DX8	6993	PSLFLSHVLALGLG	-5.91172	-6.94702
HLA-B44:05	3DX8	6993	PSLFLSHVLALGLG	-4.24346	-4.35686

Top

Vaccine Design for the FusionNeoAntigens of BNIP3L-XPA

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
BNIP3L-XPA	chr8	26265892	chr9	100437869	11	19	SHVLALGL	GCTAGGAATTGCGGCGAGCAGTAA
BNIP3L-XPA	chr8	26265892	chr9	100437869	4	15	FIPSLFLSHVL	TTCTCATGTTTTGGCTTTGGGGCTAGGAATTGC
BNIP3L-XPA	chr8	26265892	chr9	100437869	5	14	IPSLFLSHV	TCATGTTTTGGCTTTGGGGCTAGGAAT
BNIP3L-XPA	chr8	26265892	chr9	100437869	5	15	IPSLFLSHVL	TCATGTTTTGGCTTTGGGGCTAGGAATTGC
BNIP3L-XPA	chr8	26265892	chr9	100437869	7	17	SLFLSHVLAL	TTTGGCTTTGGGGCTAGGAATTGCGGCGAG
BNIP3L-XPA	chr8	26265892	chr9	100437869	8	17	LFLSHVLAL	GGCTTTGGGGCTAGGAATTGCGGCGAG
BNIP3L-XPA	chr8	26265892	chr9	100437869	9	17	FLSHVLAL	TTTGGGGCTAGGAATTGCGGCGAG

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of BNIP3L-XPA

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
KIRC	BNIP3L-XPA	chr8	26265892	ENST00000380629	chr9	100437869	ENST00000375128	TCGA-BP-4344-01A

Top

Potential target of CAR-T therapy development for BNIP3L-XPA

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to BNIP3L-XPA

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to BNIP3L-XPA

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)