FusionNeoAntigen Logo

Home

Download

Statistics

Examples

Help

Contact

Terms of Use

Center for Computational Systems Medicine
leaf

Fusion Gene and Fusion Protein Summary

leaf

Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)

leaf

Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)

leaf

Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)

leaf

Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)

leaf

Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)

leaf

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)

leaf

Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)

leaf

Potential target of CAR-T therapy development

leaf

Information on the samples that have these potential fusion neoantigens

leaf

Fusion Protein Targeting Drugs - (Manual Curation)

leaf

Fusion Protein Related diseases - (Manual Curation)

Fusion Protein:PRKCE-GPR126

Fusion Gene and Fusion Protein Summary

check button Fusion gene summary
Fusion partner gene informationFusion gene name: PRKCE-GPR126
FusionPDB ID: 68751
FusionGDB2.0 ID: 68751
HgeneTgene
Gene symbol

PRKCE

GPR126

Gene ID

5581

57211

Gene nameprotein kinase C epsilonadhesion G protein-coupled receptor G6
SynonymsPKCE|nPKC-epsilonAPG1|DREG|GPR126|LCCS9|PR126|PS1TP2|VIGR
Cytomap

2p21

6q24.2

Type of geneprotein-codingprotein-coding
Descriptionprotein kinase C epsilon typeadhesion G-protein coupled receptor G6G-protein coupled receptor 126HBV PreS1-transactivated protein 2developmentally regulated G-protein-coupled receptorvascular-inducible G protein-coupled receptor
Modification date2020032720200313
UniProtAcc

Q02156

Main function of 5'-partner protein: FUNCTION: Calcium-independent, phospholipid- and diacylglycerol (DAG)-dependent serine/threonine-protein kinase that plays essential roles in the regulation of multiple cellular processes linked to cytoskeletal proteins, such as cell adhesion, motility, migration and cell cycle, functions in neuron growth and ion channel regulation, and is involved in immune response, cancer cell invasion and regulation of apoptosis. Mediates cell adhesion to the extracellular matrix via integrin-dependent signaling, by mediating angiotensin-2-induced activation of integrin beta-1 (ITGB1) in cardiac fibroblasts. Phosphorylates MARCKS, which phosphorylates and activates PTK2/FAK, leading to the spread of cardiomyocytes. Involved in the control of the directional transport of ITGB1 in mesenchymal cells by phosphorylating vimentin (VIM), an intermediate filament (IF) protein. In epithelial cells, associates with and phosphorylates keratin-8 (KRT8), which induces targeting of desmoplakin at desmosomes and regulates cell-cell contact. Phosphorylates IQGAP1, which binds to CDC42, mediating epithelial cell-cell detachment prior to migration. In HeLa cells, contributes to hepatocyte growth factor (HGF)-induced cell migration, and in human corneal epithelial cells, plays a critical role in wound healing after activation by HGF. During cytokinesis, forms a complex with YWHAB, which is crucial for daughter cell separation, and facilitates abscission by a mechanism which may implicate the regulation of RHOA. In cardiac myocytes, regulates myofilament function and excitation coupling at the Z-lines, where it is indirectly associated with F-actin via interaction with COPB1. During endothelin-induced cardiomyocyte hypertrophy, mediates activation of PTK2/FAK, which is critical for cardiomyocyte survival and regulation of sarcomere length. Plays a role in the pathogenesis of dilated cardiomyopathy via persistent phosphorylation of troponin I (TNNI3). Involved in nerve growth factor (NFG)-induced neurite outgrowth and neuron morphological change independently of its kinase activity, by inhibition of RHOA pathway, activation of CDC42 and cytoskeletal rearrangement. May be involved in presynaptic facilitation by mediating phorbol ester-induced synaptic potentiation. Phosphorylates gamma-aminobutyric acid receptor subunit gamma-2 (GABRG2), which reduces the response of GABA receptors to ethanol and benzodiazepines and may mediate acute tolerance to the intoxicating effects of ethanol. Upon PMA treatment, phosphorylates the capsaicin- and heat-activated cation channel TRPV1, which is required for bradykinin-induced sensitization of the heat response in nociceptive neurons. Is able to form a complex with PDLIM5 and N-type calcium channel, and may enhance channel activities and potentiates fast synaptic transmission by phosphorylating the pore-forming alpha subunit CACNA1B (CaV2.2). In prostate cancer cells, interacts with and phosphorylates STAT3, which increases DNA-binding and transcriptional activity of STAT3 and seems to be essential for prostate cancer cell invasion. Downstream of TLR4, plays an important role in the lipopolysaccharide (LPS)-induced immune response by phosphorylating and activating TICAM2/TRAM, which in turn activates the transcription factor IRF3 and subsequent cytokines production. In differentiating erythroid progenitors, is regulated by EPO and controls the protection against the TNFSF10/TRAIL-mediated apoptosis, via BCL2. May be involved in the regulation of the insulin-induced phosphorylation and activation of AKT1. Phosphorylates NLRP5/MATER and may thereby modulate AKT pathway activation in cumulus cells (PubMed:19542546). {ECO:0000269|PubMed:11884385, ECO:0000269|PubMed:1374067, ECO:0000269|PubMed:15355962, ECO:0000269|PubMed:16757566, ECO:0000269|PubMed:17603037, ECO:0000269|PubMed:17875639, ECO:0000269|PubMed:17875724, ECO:0000269|PubMed:19542546}.
.
Ensembl transtripts involved in fusion geneENST idsENST00000467135, ENST00000306156, 
ENST00000394874, 
ENST00000230173, 
ENST00000296932, ENST00000367608, 
ENST00000367609, ENST00000545477, 
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)* DoF score8 X 8 X 5=3203 X 3 X 3=27
# samples 93
** MAII scorelog2(9/320*10)=-1.83007499855769
possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs).
DoF>8 and MAII<0
log2(3/27*10)=0.15200309344505
effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs).
DoF>8 and MAII>0
Fusion gene context

PubMed: PRKCE [Title/Abstract] AND GPR126 [Title/Abstract] AND fusion [Title/Abstract]

Fusion neoantigen context

PubMed: PRKCE [Title/Abstract] AND GPR126 [Title/Abstract] AND neoantigen [Title/Abstract]

Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)PRKCE(46070202)-GPR126(142758571), # samples:2
Anticipated loss of major functional domain due to fusion event.PRKCE-GPR126 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF.
PRKCE-GPR126 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF.
PRKCE-GPR126 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.
PRKCE-GPR126 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

check button Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez
PartnerGeneGO IDGO termPubMed ID
HgenePRKCE

GO:0006468

protein phosphorylation

18556656

HgenePRKCE

GO:0018105

peptidyl-serine phosphorylation

15695813



check button Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr2:46070202/chr6:142758571)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.
FGviewer

check buttonRetention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

check buttonFusion gene breakpoints across PRKCE (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

check buttonFusion gene breakpoints across GPR126 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.


Top

Fusion Amino Acid Sequences


check buttonFusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.
HenstTenstHgeneHchrHbpHstrandTgeneTchrTbpTstrandSeq length
(transcript)
BP loci
(transcript)
Predicted start
(transcript)
Predicted stop
(transcript)
Seq length
(amino acids)
ENST00000306156PRKCEchr246070202+ENST00000230173GPR126chr6142758571+39707393271085252
ENST00000306156PRKCEchr246070202+ENST00000367608GPR126chr6142758571+39127393271172281
ENST00000306156PRKCEchr246070202+ENST00000296932GPR126chr6142758571+39527393271085252
ENST00000306156PRKCEchr246070202+ENST00000367609GPR126chr6142758571+39067393271172281

check buttonDeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.
HenstTenstHgeneHchrHbpHstrandTgeneTchrTbpTstrandNo-coding scoreCoding score
ENST00000306156ENST00000230173PRKCEchr246070202+GPR126chr6142758571+0.0010555450.99894446
ENST00000306156ENST00000367608PRKCEchr246070202+GPR126chr6142758571+0.0005144540.9994855
ENST00000306156ENST00000296932PRKCEchr246070202+GPR126chr6142758571+0.0010078880.99899215
ENST00000306156ENST00000367609PRKCEchr246070202+GPR126chr6142758571+0.0005263470.99947363

check button Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for PRKCE-GPR126

check button +/-13 AA sequence from the breakpoints of the fusion protein sequences.
HgeneHchrHbpTgeneTchrTbpLength(fusion protein)BP in fusion proteinPeptide
PRKCEchr246070202GPR126chr6142758571739137VYVIIDLSGSSGEGLFIFIFHCAMKE

Top

Potential FusionNeoAntigen Information of PRKCE-GPR126 in HLA I

check button Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.
PRKCE-GPR126_46070202_142758571.msa

check button Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)
Fusion geneHchrHbpTgeneTchrTbpHLA IFusionNeoAntigen peptideBinding scoreImmunogenic scoreNeoantigen start (at BP 13)Neoantigen end (at BP 13)
PRKCE-GPR126chr246070202chr6142758571739HLA-B44:03GEGLFIFIF0.98870.94821120
PRKCE-GPR126chr246070202chr6142758571739HLA-B15:17SSGEGLFIF0.97970.9761918
PRKCE-GPR126chr246070202chr6142758571739HLA-B15:16SSGEGLFIF0.96980.8115918
PRKCE-GPR126chr246070202chr6142758571739HLA-B58:01SSGEGLFIF0.95410.9798918
PRKCE-GPR126chr246070202chr6142758571739HLA-B58:02SSGEGLFIF0.88730.9839918
PRKCE-GPR126chr246070202chr6142758571739HLA-B47:01GEGLFIFIF0.86680.5781120
PRKCE-GPR126chr246070202chr6142758571739HLA-B57:03SSGEGLFIF0.83640.994918
PRKCE-GPR126chr246070202chr6142758571739HLA-B44:26GEGLFIFIF0.98870.94821120
PRKCE-GPR126chr246070202chr6142758571739HLA-B44:07GEGLFIFIF0.98870.94821120
PRKCE-GPR126chr246070202chr6142758571739HLA-B44:13GEGLFIFIF0.98870.94821120
PRKCE-GPR126chr246070202chr6142758571739HLA-B57:04SSGEGLFIF0.97420.7494918
PRKCE-GPR126chr246070202chr6142758571739HLA-B57:02SSGEGLFIF0.9070.9454918

Top

Potential FusionNeoAntigen Information of PRKCE-GPR126 in HLA II

check button Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

check button Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).
Fusion geneHchrHbpTgeneTchrTbpHLA IIFusionNeoAntigen peptideNeoantigen start (at BP 13)Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of PRKCE-GPR126

check button3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.
File nameBPseqHgeneTgeneHchrHbpTchrTbpAAlen
5627LSGSSGEGLFIFIFPRKCEGPR126chr246070202chr6142758571739

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of PRKCE-GPR126

check buttonVirtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.
HLA allelePDB IDFile nameBPseqDocking scoreGlide score
HLA-B14:023BVN5627LSGSSGEGLFIFIF-6.47228-6.58568
HLA-B14:023BVN5627LSGSSGEGLFIFIF-5.17277-6.20807
HLA-B52:013W395627LSGSSGEGLFIFIF-5.78127-6.81657
HLA-B52:013W395627LSGSSGEGLFIFIF-5.54909-5.66249
HLA-A11:014UQ25627LSGSSGEGLFIFIF-6.10996-7.14526
HLA-A24:025HGA5627LSGSSGEGLFIFIF-6.56315-6.67655
HLA-A24:025HGA5627LSGSSGEGLFIFIF-4.43018-5.46548
HLA-B27:056PYJ5627LSGSSGEGLFIFIF-6.44184-7.47714
HLA-B27:056PYJ5627LSGSSGEGLFIFIF-5.32442-5.43782
HLA-B44:053DX85627LSGSSGEGLFIFIF-6.86074-6.97414
HLA-B44:053DX85627LSGSSGEGLFIFIF-6.38877-7.42407

Top

Vaccine Design for the FusionNeoAntigens of PRKCE-GPR126

check button mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.
Fusion geneHchrHbpTchrTbpStart in +/-13AAEnd in +/-13AAFusionNeoAntigen peptide sequenceFusionNeoAntigen RNA sequence
PRKCE-GPR126chr246070202chr61427585711120GEGLFIFIFGTGAAGGCTTATTTATATTCATCTTCC
PRKCE-GPR126chr246070202chr6142758571918SSGEGLFIFCGTCGGGTGAAGGCTTATTTATATTCA

check button mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.
Fusion geneHchrHbpTchrTbpStart in +/-13AAEnd in +/-13AAFusionNeoAntigen peptideFusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of PRKCE-GPR126

check button These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.
Cancer typeFusion geneHchrHbpHenstTchrTbpTenstSample
SKCMPRKCE-GPR126chr246070202ENST00000306156chr6142758571ENST00000230173TCGA-EB-A6L9-06A

Top

Potential target of CAR-T therapy development for PRKCE-GPR126

check button Predicted 3D structure. We used RoseTTAFold.

check buttonRetention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features


* Minus value of BPloci means that the break point is located before the CDS.
- In-frame and retained 'Transmembrane'.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note
TgeneGPR126chr2:46070202chr6:142758571ENST0000029693220251093_111301194.0TransmembraneHelical%3B Name%3D7
TgeneGPR126chr2:46070202chr6:142758571ENST0000036760820241093_111301223.0TransmembraneHelical%3B Name%3D7

check button Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.
HgeneHchrHbpHenstTgeneTchrTbpTenstDeepLoc result

Top

Related Drugs to PRKCE-GPR126

check button Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)
HgeneTgeneDrugSourcePMID

Top

Related Diseases to PRKCE-GPR126

check button Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)
HgeneTgeneDiseaseSourcePMID

check button Diseases associated with fusion partners.
(DisGeNet 4.0)
PartnerGeneDisease IDDisease name# pubmedsSource
HgenePRKCEC0020429Hyperalgesia3CTD_human
HgenePRKCEC0458247Allodynia3CTD_human
HgenePRKCEC0751211Hyperalgesia, Primary3CTD_human
HgenePRKCEC0751212Hyperalgesia, Secondary3CTD_human
HgenePRKCEC0751213Tactile Allodynia3CTD_human
HgenePRKCEC0751214Hyperalgesia, Thermal3CTD_human
HgenePRKCEC2936719Mechanical Allodynia3CTD_human
HgenePRKCEC0002152Alloxan Diabetes1CTD_human
HgenePRKCEC0009402Colorectal Carcinoma1CTD_human;UNIPROT
HgenePRKCEC0009404Colorectal Neoplasms1CTD_human
HgenePRKCEC0011853Diabetes Mellitus, Experimental1CTD_human
HgenePRKCEC0011881Diabetic Nephropathy1CTD_human
HgenePRKCEC0013146Drug abuse1CTD_human
HgenePRKCEC0013170Drug habituation1CTD_human
HgenePRKCEC0013222Drug Use Disorders1CTD_human
HgenePRKCEC0017667Nodular glomerulosclerosis1CTD_human
HgenePRKCEC0023903Liver neoplasms1CTD_human
HgenePRKCEC0027051Myocardial Infarction1CTD_human
HgenePRKCEC0029231Organic Mental Disorders, Substance-Induced1CTD_human
HgenePRKCEC0033141Cardiomyopathies, Primary1CTD_human
HgenePRKCEC0036529Myocardial Diseases, Secondary1CTD_human
HgenePRKCEC0038433Streptozotocin Diabetes1CTD_human
HgenePRKCEC0038580Substance Dependence1CTD_human
HgenePRKCEC0038586Substance Use Disorders1CTD_human
HgenePRKCEC0151744Myocardial Ischemia1CTD_human
HgenePRKCEC0236969Substance-Related Disorders1CTD_human
HgenePRKCEC0242231Coronary Stenosis1CTD_human
HgenePRKCEC0345904Malignant neoplasm of liver1CTD_human
HgenePRKCEC0400966Non-alcoholic Fatty Liver Disease1CTD_human
HgenePRKCEC0740858Substance abuse problem1CTD_human
HgenePRKCEC0878544Cardiomyopathies1CTD_human
HgenePRKCEC1510472Drug Dependence1CTD_human
HgenePRKCEC3241937Nonalcoholic Steatohepatitis1CTD_human
HgenePRKCEC4316881Prescription Drug Abuse1CTD_human
HgenePRKCEC4721453Peripheral Nervous System Diseases1CTD_human