Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:ZNF416-ACTN4

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: ZNF416-ACTN4
	FusionPDB ID: 102026
	FusionGDB2.0 ID: 102026
		Hgene	Tgene
	Gene symbol	ZNF416	ACTN4
	Gene ID	55659	81
	Gene name	zinc finger protein 416	actinin alpha 4
	Synonyms	-	ACTININ-4\|FSGS\|FSGS1
	Cytomap	19q13.43	19q13.2
	Type of gene	protein-coding	protein-coding
	Description	zinc finger protein 416	alpha-actinin-4focal segmental glomerulosclerosis 1non-muscle alpha-actinin 4
	Modification date	20200313	20200327
	UniProtAcc	.	O43707 Main function of 5'-partner protein: FUNCTION: F-actin cross-linking protein which is thought to anchor actin to a variety of intracellular structures. This is a bundling protein (Probable). Probably involved in vesicular trafficking via its association with the CART complex. The CART complex is necessary for efficient transferrin receptor recycling but not for EGFR degradation (PubMed:15772161). Involved in tight junction assembly in epithelial cells probably through interaction with MICALL2. Links MICALL2 to the actin cytoskeleton and recruits it to the tight junctions (By similarity). May also function as a transcriptional coactivator, stimulating transcription mediated by the nuclear hormone receptors PPARG and RARA (PubMed:22351778). {ECO:0000250\|UniProtKB:P57780, ECO:0000269\|PubMed:15772161, ECO:0000269\|PubMed:22351778, ECO:0000305\|PubMed:9508771}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000196489,	ENST00000390009, ENST00000497637, ENST00000252699, ENST00000424234,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	3 X 3 X 3=27	27 X 38 X 12=12312
	# samples	4	48
	** MAII score	log2(4/27*10)=0.567040592723894 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0	log2(48/12312*10)=-4.68088692071969 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: ZNF416 [Title/Abstract] AND ACTN4 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: ZNF416 [Title/Abstract] AND ACTN4 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	ZNF416(58089425)-ACTN4(39191240), # samples:1
Anticipated loss of major functional domain due to fusion event.	ZNF416-ACTN4 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ZNF416-ACTN4 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ZNF416-ACTN4 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. ZNF416-ACTN4 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Tgene	ACTN4	GO:0033209	tumor necrosis factor-mediated signaling pathway	25411248
Tgene	ACTN4	GO:0035357	peroxisome proliferator activated receptor signaling pathway	22351778
Tgene	ACTN4	GO:0048384	retinoic acid receptor signaling pathway	22351778
Tgene	ACTN4	GO:0051272	positive regulation of cellular component movement	9508771

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr19:58089425/chr19:39191240)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across ZNF416 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across ACTN4 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst

Tenst

Hgene

Hchr

Hbp

Hstrand

Tgene

Tchr

Tbp

Tstrand

Seq length
(transcript)

BP loci
(transcript)

Predicted start
(transcript)

Predicted stop
(transcript)

Seq length
(amino acids)

ENST00000196489

ZNF416

chr19

58089425

ENST00000252699

ACTN4

chr19

39191240

5023

298

145

2871

908

ENST00000196489

ZNF416

chr19

58089425

ENST00000424234

ACTN4

chr19

39191240

1702

298

145

1701

519

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000196489	ENST00000252699	ZNF416	chr19	58089425	-	ACTN4	chr19	39191240	+	0.008230717	0.9917693
ENST00000196489	ENST00000424234	ZNF416	chr19	58089425	-	ACTN4	chr19	39191240	+	0.006395498	0.9936045

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for ZNF416-ACTN4

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
ZNF416	chr19	58089425	ACTN4	chr19	39191240	298	50	VPVTAEAKLMGFTQTFTAWCNSHLRK

Top

Potential FusionNeoAntigen Information of ZNF416-ACTN4 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

ZNF416-ACTN4_58089425_39191240.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-B15:01	KLMGFTQTF	0.9994	0.9388	7	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-A32:13	KLMGFTQTF	0.997	0.9568	7	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-A24:17	KLMGFTQTF	0.9935	0.5285	7	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-A24:23	GFTQTFTAW	0.9932	0.5568	10	19
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-B15:25	KLMGFTQTF	0.9928	0.9439	7	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-B15:02	KLMGFTQTF	0.9909	0.9536	7	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-B15:16	KLMGFTQTF	0.9894	0.8285	7	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-B15:17	KLMGFTQTF	0.9889	0.9255	7	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-A24:17	GFTQTFTAW	0.979	0.695	10	19
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-B57:03	KLMGFTQTF	0.9768	0.9908	7	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-B58:01	KLMGFTQTF	0.9702	0.9258	7	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-B58:02	KLMGFTQTF	0.9667	0.9699	7	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-A24:10	GFTQTFTAW	0.9652	0.5319	10	19
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-B15:03	KLMGFTQTF	0.9623	0.833	7	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-A31:08	GFTQTFTAW	0.954	0.6583	10	19
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-A24:14	KLMGFTQTF	0.9258	0.6619	7	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-A02:17	KLMGFTQTF	0.9191	0.5218	7	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-A02:21	KLMGFTQTF	0.9135	0.7494	7	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-A02:04	KLMGFTQTF	0.9096	0.69	7	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-A02:11	KLMGFTQTF	0.9044	0.6658	7	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-A02:20	KLMGFTQTF	0.7347	0.6289	7	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-A74:03	KLMGFTQTF	0.721	0.6071	7	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-A74:11	KLMGFTQTF	0.721	0.6071	7	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-A74:09	KLMGFTQTF	0.721	0.6071	7	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-B47:01	KLMGFTQTF	0.3761	0.7768	7	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-B13:02	KLMGFTQTF	0.3548	0.5439	7	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-B13:01	KLMGFTQTF	0.32	0.9906	7	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-B52:01	KLMGFTQTF	0.1174	0.9632	7	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-B57:01	MGFTQTFTAW	0.9997	0.9948	9	19
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-B58:02	MGFTQTFTAW	0.9982	0.9919	9	19
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-B58:01	MGFTQTFTAW	0.9978	0.9915	9	19
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-B57:03	MGFTQTFTAW	0.9815	0.9976	9	19
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-B15:03	AKLMGFTQTF	0.9775	0.9117	6	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-B15:01	AKLMGFTQTF	0.9507	0.9626	6	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-B15:25	AKLMGFTQTF	0.9306	0.977	6	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-A32:13	AKLMGFTQTF	0.8844	0.979	6	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-A02:60	KLMGFTQTFTA	0.9959	0.5307	7	18
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-A02:67	KLMGFTQTFTA	0.9957	0.5167	7	18
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-A02:30	KLMGFTQTFTA	0.9957	0.5167	7	18
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-A02:24	KLMGFTQTFTA	0.9957	0.5167	7	18
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-A02:16	KLMGFTQTFTA	0.9932	0.5224	7	18
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-A26:02	EAKLMGFTQTF	0.9894	0.6428	5	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-A26:15	EAKLMGFTQTF	0.9541	0.6711	5	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-A26:14	EAKLMGFTQTF	0.9541	0.6711	5	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-A02:29	KLMGFTQTFTA	0.9252	0.5227	7	18
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-A02:20	KLMGFTQTFTA	0.8869	0.5263	7	18
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-B15:07	KLMGFTQTF	0.9988	0.7198	7	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-B15:04	KLMGFTQTF	0.9905	0.9463	7	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-B15:21	KLMGFTQTF	0.99	0.9641	7	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-C07:19	KLMGFTQTF	0.9646	0.8624	7	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-B15:05	KLMGFTQTF	0.9369	0.9579	7	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-C07:80	KLMGFTQTF	0.9198	0.9786	7	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-C07:67	KLMGFTQTF	0.9198	0.9786	7	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-C07:10	KLMGFTQTF	0.9176	0.9788	7	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-B15:31	KLMGFTQTF	0.9146	0.9625	7	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-C15:04	KLMGFTQTF	0.905	0.8648	7	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-C07:46	KLMGFTQTF	0.8442	0.9517	7	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-A02:05	KLMGFTQTF	0.8332	0.7289	7	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-C03:14	KLMGFTQTF	0.7893	0.9728	7	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-B15:07	AKLMGFTQTF	0.961	0.8151	6	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-B15:05	AKLMGFTQTF	0.8701	0.9654	6	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-A02:01	KLMGFTQTFTA	0.9957	0.5167	7	18
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-A26:01	EAKLMGFTQTF	0.9541	0.6711	5	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-B15:125	KLMGFTQTF	0.9994	0.9388	7	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-B15:27	KLMGFTQTF	0.9994	0.9562	7	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-B15:135	KLMGFTQTF	0.9994	0.9462	7	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-B15:34	KLMGFTQTF	0.9994	0.9388	7	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-B15:33	KLMGFTQTF	0.9994	0.9388	7	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-B15:08	KLMGFTQTF	0.9992	0.9086	7	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-B15:50	KLMGFTQTF	0.9991	0.9683	7	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-B15:35	KLMGFTQTF	0.9991	0.8968	7	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-B15:24	KLMGFTQTF	0.999	0.9479	7	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-A32:01	KLMGFTQTF	0.9988	0.9609	7	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-B15:53	KLMGFTQTF	0.9981	0.9198	7	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-B15:12	KLMGFTQTF	0.9976	0.9328	7	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-B15:39	KLMGFTQTF	0.9935	0.9024	7	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-A24:03	GFTQTFTAW	0.9932	0.5568	10	19
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-B15:54	KLMGFTQTF	0.993	0.9014	7	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-B58:06	KLMGFTQTF	0.9869	0.9343	7	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-B15:13	KLMGFTQTF	0.9853	0.6812	7	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-B15:20	KLMGFTQTF	0.9357	0.9687	7	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-B15:68	KLMGFTQTF	0.9356	0.6294	7	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-C03:67	KLMGFTQTF	0.9245	0.9811	7	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-C07:17	KLMGFTQTF	0.9227	0.9838	7	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-B35:28	KLMGFTQTF	0.921	0.9706	7	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-C07:02	KLMGFTQTF	0.9198	0.9786	7	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-A02:14	KLMGFTQTF	0.9173	0.7099	7	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-B15:73	KLMGFTQTF	0.9162	0.8298	7	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-A02:06	KLMGFTQTF	0.9135	0.7494	7	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-C15:09	KLMGFTQTF	0.905	0.8648	7	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-B35:20	KLMGFTQTF	0.9027	0.9761	7	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-B57:02	KLMGFTQTF	0.8889	0.9564	7	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-C03:02	KLMGFTQTF	0.8803	0.9743	7	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-B48:02	KLMGFTQTF	0.8381	0.969	7	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-B15:30	KLMGFTQTF	0.8352	0.9039	7	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-C12:02	KLMGFTQTF	0.8027	0.9835	7	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-C04:04	KLMGFTQTF	0.7722	0.8155	7	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-A74:01	KLMGFTQTF	0.721	0.6071	7	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-C02:02	KLMGFTQTF	0.6587	0.975	7	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-C02:10	KLMGFTQTF	0.6587	0.975	7	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-B57:10	MGFTQTFTAW	0.9997	0.9948	9	19
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-B57:04	MGFTQTFTAW	0.998	0.8454	9	19
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-B15:54	AKLMGFTQTF	0.9836	0.9404	6	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-B15:68	AKLMGFTQTF	0.9811	0.7432	6	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-B15:35	AKLMGFTQTF	0.9657	0.9357	6	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-B15:53	AKLMGFTQTF	0.9517	0.9529	6	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-B15:27	AKLMGFTQTF	0.9509	0.9706	6	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-B15:125	AKLMGFTQTF	0.9507	0.9626	6	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-B15:34	AKLMGFTQTF	0.9507	0.9626	6	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-B15:33	AKLMGFTQTF	0.9507	0.9626	6	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-B15:50	AKLMGFTQTF	0.9506	0.9778	6	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-B15:39	AKLMGFTQTF	0.942	0.948	6	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-B48:02	AKLMGFTQTF	0.9414	0.9757	6	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-A32:01	AKLMGFTQTF	0.8943	0.9781	6	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-B15:20	AKLMGFTQTF	0.8583	0.9789	6	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-A25:01	EAKLMGFTQTF	0.9829	0.9194	5	16
ZNF416-ACTN4	chr19	58089425	chr19	39191240	298	HLA-B53:02	EAKLMGFTQTF	0.9692	0.5542	5	16

Top

Potential FusionNeoAntigen Information of ZNF416-ACTN4 in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of ZNF416-ACTN4

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
320	AKLMGFTQTFTAWC	ZNF416	ACTN4	chr19	58089425	chr19	39191240	298

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of ZNF416-ACTN4

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	320	AKLMGFTQTFTAWC	-7.79586	-7.90926
HLA-B14:02	3BVN	320	AKLMGFTQTFTAWC	-6.21801	-7.25331
HLA-B52:01	3W39	320	AKLMGFTQTFTAWC	-6.72741	-6.84081
HLA-B52:01	3W39	320	AKLMGFTQTFTAWC	-4.3752	-5.4105
HLA-A11:01	4UQ2	320	AKLMGFTQTFTAWC	-6.25337	-6.36677
HLA-A24:02	5HGA	320	AKLMGFTQTFTAWC	-8.19416	-8.30756
HLA-A24:02	5HGA	320	AKLMGFTQTFTAWC	-5.08938	-6.12468
HLA-B27:05	6PYJ	320	AKLMGFTQTFTAWC	-7.6632	-7.7766
HLA-B44:05	3DX8	320	AKLMGFTQTFTAWC	-6.89178	-7.92708
HLA-B44:05	3DX8	320	AKLMGFTQTFTAWC	-5.39929	-5.51269

Top

Vaccine Design for the FusionNeoAntigens of ZNF416-ACTN4

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
ZNF416-ACTN4	chr19	58089425	chr19	39191240	10	19	GFTQTFTAW	TTTACACAGACCTTCACGGCATGGTGC
ZNF416-ACTN4	chr19	58089425	chr19	39191240	5	16	EAKLMGFTQTF	GCTAAACTTATGGGCTTTACACAGACCTTCACG
ZNF416-ACTN4	chr19	58089425	chr19	39191240	6	16	AKLMGFTQTF	AAACTTATGGGCTTTACACAGACCTTCACG
ZNF416-ACTN4	chr19	58089425	chr19	39191240	7	16	KLMGFTQTF	CTTATGGGCTTTACACAGACCTTCACG
ZNF416-ACTN4	chr19	58089425	chr19	39191240	7	18	KLMGFTQTFTA	CTTATGGGCTTTACACAGACCTTCACGGCATGG
ZNF416-ACTN4	chr19	58089425	chr19	39191240	9	19	MGFTQTFTAW	GGCTTTACACAGACCTTCACGGCATGGTGC

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of ZNF416-ACTN4

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
SARC	ZNF416-ACTN4	chr19	58089425	ENST00000196489	chr19	39191240	ENST00000252699	TCGA-3B-A9HX-01A

Top

Potential target of CAR-T therapy development for ZNF416-ACTN4

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to ZNF416-ACTN4

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to ZNF416-ACTN4

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner	Gene	Disease ID	Disease name	# pubmeds	Source
Tgene	ACTN4	C4551527	Focal segmental glomerulosclerosis 1	9	GENOMICS_ENGLAND;UNIPROT
Tgene	ACTN4	C0007097	Carcinoma	1	CTD_human
Tgene	ACTN4	C0019193	Hepatitis, Toxic	1	CTD_human
Tgene	ACTN4	C0024667	Animal Mammary Neoplasms	1	CTD_human
Tgene	ACTN4	C0024668	Mammary Neoplasms, Experimental	1	CTD_human
Tgene	ACTN4	C0205696	Anaplastic carcinoma	1	CTD_human
Tgene	ACTN4	C0205697	Carcinoma, Spindle-Cell	1	CTD_human
Tgene	ACTN4	C0205698	Undifferentiated carcinoma	1	CTD_human
Tgene	ACTN4	C0205699	Carcinomatosis	1	CTD_human
Tgene	ACTN4	C0860207	Drug-Induced Liver Disease	1	CTD_human
Tgene	ACTN4	C1257925	Mammary Carcinoma, Animal	1	CTD_human
Tgene	ACTN4	C1262760	Hepatitis, Drug-Induced	1	CTD_human
Tgene	ACTN4	C1868672	NEPHROTIC SYNDROME, STEROID-RESISTANT, AUTOSOMAL RECESSIVE	1	ORPHANET
Tgene	ACTN4	C3658290	Drug-Induced Acute Liver Injury	1	CTD_human
Tgene	ACTN4	C4277682	Chemical and Drug Induced Liver Injury	1	CTD_human
Tgene	ACTN4	C4279912	Chemically-Induced Liver Toxicity	1	CTD_human

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)