Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:CCNYL1-IDH1

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: CCNYL1-IDH1
	FusionPDB ID: 14220
	FusionGDB2.0 ID: 14220
		Hgene	Tgene
	Gene symbol	CCNYL1	IDH1
	Gene ID	151195	3417
	Gene name	cyclin Y like 1	isocitrate dehydrogenase (NADP(+)) 1
	Synonyms	-	HEL-216\|HEL-S-26\|IDCD\|IDH\|IDP\|IDPC\|PICD
	Cytomap	2q33.3	2q34
	Type of gene	protein-coding	protein-coding
	Description	cyclin-Y-like protein 1	isocitrate dehydrogenase [NADP] cytoplasmicNADP(+)-specific ICDHNADP-dependent isocitrate dehydrogenase, cytosolicNADP-dependent isocitrate dehydrogenase, peroxisomalepididymis luminal protein 216epididymis secretory protein Li 26epididymis secretor
	Modification date	20200313	20200313
	UniProtAcc	Q8N7R7 Main function of 5'-partner protein:	O75874 Main function of 5'-partner protein:
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000295414, ENST00000339882, ENST00000392209, ENST00000420822, ENST00000468768,	ENST00000345146, ENST00000415913, ENST00000446179,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	4 X 4 X 2=32	6 X 5 X 3=90
	# samples	4	6
	** MAII score	log2(4/32*10)=0.321928094887362 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0	log2(6/90*10)=-0.584962500721156 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: CCNYL1 [Title/Abstract] AND IDH1 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: CCNYL1 [Title/Abstract] AND IDH1 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	CCNYL1(208576841)-IDH1(209104729), # samples:1
Anticipated loss of major functional domain due to fusion event.	CCNYL1-IDH1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. CCNYL1-IDH1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Tgene	IDH1	GO:0006102	isocitrate metabolic process	10521434\|19935646\|20171178
Tgene	IDH1	GO:0006103	2-oxoglutarate metabolic process	19935646

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr2:208576841/chr2:209104729)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across CCNYL1 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across IDH1 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000392209	CCNYL1	chr2	208576841	+	ENST00000345146	IDH1	chr2	209104729	-	1572	325	153	719	188
ENST00000392209	CCNYL1	chr2	208576841	+	ENST00000446179	IDH1	chr2	209104729	-	1567	325	153	719	188
ENST00000392209	CCNYL1	chr2	208576841	+	ENST00000415913	IDH1	chr2	209104729	-	1534	325	153	719	188
ENST00000420822	CCNYL1	chr2	208576841	+	ENST00000345146	IDH1	chr2	209104729	-	1716	469	249	863	204
ENST00000420822	CCNYL1	chr2	208576841	+	ENST00000446179	IDH1	chr2	209104729	-	1711	469	249	863	204
ENST00000420822	CCNYL1	chr2	208576841	+	ENST00000415913	IDH1	chr2	209104729	-	1678	469	249	863	204
ENST00000295414	CCNYL1	chr2	208576841	+	ENST00000345146	IDH1	chr2	209104729	-	1678	431	211	825	204
ENST00000295414	CCNYL1	chr2	208576841	+	ENST00000446179	IDH1	chr2	209104729	-	1673	431	211	825	204
ENST00000295414	CCNYL1	chr2	208576841	+	ENST00000415913	IDH1	chr2	209104729	-	1640	431	211	825	204
ENST00000339882	CCNYL1	chr2	208576841	+	ENST00000345146	IDH1	chr2	209104729	-	1613	366	146	760	204
ENST00000339882	CCNYL1	chr2	208576841	+	ENST00000446179	IDH1	chr2	209104729	-	1608	366	146	760	204
ENST00000339882	CCNYL1	chr2	208576841	+	ENST00000415913	IDH1	chr2	209104729	-	1575	366	146	760	204

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000392209	ENST00000345146	CCNYL1	chr2	208576841	+	IDH1	chr2	209104729	-	0.01137603	0.988624
ENST00000392209	ENST00000446179	CCNYL1	chr2	208576841	+	IDH1	chr2	209104729	-	0.011567524	0.98843247
ENST00000392209	ENST00000415913	CCNYL1	chr2	208576841	+	IDH1	chr2	209104729	-	0.010621699	0.9893783
ENST00000420822	ENST00000345146	CCNYL1	chr2	208576841	+	IDH1	chr2	209104729	-	0.00148911	0.9985109
ENST00000420822	ENST00000446179	CCNYL1	chr2	208576841	+	IDH1	chr2	209104729	-	0.001468051	0.99853194
ENST00000420822	ENST00000415913	CCNYL1	chr2	208576841	+	IDH1	chr2	209104729	-	0.001473987	0.99852604
ENST00000295414	ENST00000345146	CCNYL1	chr2	208576841	+	IDH1	chr2	209104729	-	0.001226357	0.99877363
ENST00000295414	ENST00000446179	CCNYL1	chr2	208576841	+	IDH1	chr2	209104729	-	0.001230507	0.99876946
ENST00000295414	ENST00000415913	CCNYL1	chr2	208576841	+	IDH1	chr2	209104729	-	0.001419889	0.9985801
ENST00000339882	ENST00000345146	CCNYL1	chr2	208576841	+	IDH1	chr2	209104729	-	0.001570484	0.9984295
ENST00000339882	ENST00000446179	CCNYL1	chr2	208576841	+	IDH1	chr2	209104729	-	0.001572648	0.9984274
ENST00000339882	ENST00000415913	CCNYL1	chr2	208576841	+	IDH1	chr2	209104729	-	0.001671685	0.99832827

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for CCNYL1-IDH1

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
CCNYL1	chr2	208576841	IDH1	chr2	209104729	325	57	HHLQHISDREMPEGYGSLGMMTSVLV
CCNYL1	chr2	208576841	IDH1	chr2	209104729	366	73	HHLQHISDREMPEGYGSLGMMTSVLV
CCNYL1	chr2	208576841	IDH1	chr2	209104729	431	73	HHLQHISDREMPEGYGSLGMMTSVLV
CCNYL1	chr2	208576841	IDH1	chr2	209104729	469	73	HHLQHISDREMPEGYGSLGMMTSVLV

Top

Potential FusionNeoAntigen Information of CCNYL1-IDH1 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

CCNYL1-IDH1_208576841_209104729.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
CCNYL1-IDH1	chr2	208576841	chr2	209104729	431	HLA-B07:05	MPEGYGSL	0.9915	0.5281	10	18
CCNYL1-IDH1	chr2	208576841	chr2	209104729	431	HLA-B35:03	MPEGYGSL	0.941	0.9829	10	18
CCNYL1-IDH1	chr2	208576841	chr2	209104729	431	HLA-B35:02	MPEGYGSL	0.8499	0.9924	10	18
CCNYL1-IDH1	chr2	208576841	chr2	209104729	431	HLA-B35:04	MPEGYGSL	0.8499	0.9924	10	18
CCNYL1-IDH1	chr2	208576841	chr2	209104729	431	HLA-B45:01	REMPEGYGS	0.9433	0.9814	8	17
CCNYL1-IDH1	chr2	208576841	chr2	209104729	431	HLA-B50:02	REMPEGYGS	0.8499	0.7376	8	17
CCNYL1-IDH1	chr2	208576841	chr2	209104729	431	HLA-B41:01	REMPEGYGS	0.3261	0.9961	8	17
CCNYL1-IDH1	chr2	208576841	chr2	209104729	431	HLA-B50:01	REMPEGYGS	0.0595	0.909	8	17
CCNYL1-IDH1	chr2	208576841	chr2	209104729	431	HLA-B48:01	REMPEGYGSL	0.9985	0.7409	8	18
CCNYL1-IDH1	chr2	208576841	chr2	209104729	431	HLA-B40:01	REMPEGYGSL	0.9971	0.6694	8	18
CCNYL1-IDH1	chr2	208576841	chr2	209104729	431	HLA-B47:01	REMPEGYGSL	0.9929	0.6537	8	18
CCNYL1-IDH1	chr2	208576841	chr2	209104729	431	HLA-B13:01	REMPEGYGSL	0.991	0.9878	8	18
CCNYL1-IDH1	chr2	208576841	chr2	209104729	431	HLA-B35:01	MPEGYGSLGM	0.9888	0.8538	10	20
CCNYL1-IDH1	chr2	208576841	chr2	209104729	431	HLA-B35:08	MPEGYGSLGM	0.9877	0.8066	10	20
CCNYL1-IDH1	chr2	208576841	chr2	209104729	431	HLA-B39:13	REMPEGYGSL	0.9786	0.9945	8	18
CCNYL1-IDH1	chr2	208576841	chr2	209104729	431	HLA-B35:03	MPEGYGSLGM	0.9648	0.8929	10	20
CCNYL1-IDH1	chr2	208576841	chr2	209104729	431	HLA-B44:05	REMPEGYGSL	0.9637	0.595	8	18
CCNYL1-IDH1	chr2	208576841	chr2	209104729	431	HLA-B44:03	REMPEGYGSL	0.9622	0.9722	8	18
CCNYL1-IDH1	chr2	208576841	chr2	209104729	431	HLA-B50:01	REMPEGYGSL	0.8873	0.8144	8	18
CCNYL1-IDH1	chr2	208576841	chr2	209104729	431	HLA-B41:01	REMPEGYGSL	0.8445	0.9948	8	18
CCNYL1-IDH1	chr2	208576841	chr2	209104729	431	HLA-B35:02	MPEGYGSLGM	0.8397	0.979	10	20
CCNYL1-IDH1	chr2	208576841	chr2	209104729	431	HLA-B35:04	MPEGYGSLGM	0.8397	0.979	10	20
CCNYL1-IDH1	chr2	208576841	chr2	209104729	431	HLA-B82:01	MPEGYGSLGM	0.3946	0.7894	10	20
CCNYL1-IDH1	chr2	208576841	chr2	209104729	431	HLA-B35:03	MPEGYGSLGMM	0.9902	0.8981	10	21
CCNYL1-IDH1	chr2	208576841	chr2	209104729	431	HLA-C01:30	MPEGYGSL	0.9952	0.9861	10	18
CCNYL1-IDH1	chr2	208576841	chr2	209104729	431	HLA-B07:12	MPEGYGSL	0.9646	0.7917	10	18
CCNYL1-IDH1	chr2	208576841	chr2	209104729	431	HLA-B35:12	MPEGYGSL	0.8499	0.9924	10	18
CCNYL1-IDH1	chr2	208576841	chr2	209104729	431	HLA-B39:10	MPEGYGSL	0.7586	0.9925	10	18
CCNYL1-IDH1	chr2	208576841	chr2	209104729	431	HLA-B40:06	REMPEGYGS	0.9794	0.794	8	17
CCNYL1-IDH1	chr2	208576841	chr2	209104729	431	HLA-C01:17	EMPEGYGSL	0.763	0.9759	9	18
CCNYL1-IDH1	chr2	208576841	chr2	209104729	431	HLA-C01:30	EMPEGYGSL	0.7449	0.9783	9	18
CCNYL1-IDH1	chr2	208576841	chr2	209104729	431	HLA-B40:06	REMPEGYGSL	0.9994	0.7913	8	18
CCNYL1-IDH1	chr2	208576841	chr2	209104729	431	HLA-C01:17	REMPEGYGSL	0.9975	0.9878	8	18
CCNYL1-IDH1	chr2	208576841	chr2	209104729	431	HLA-B48:03	REMPEGYGSL	0.9974	0.7385	8	18
CCNYL1-IDH1	chr2	208576841	chr2	209104729	431	HLA-B39:08	REMPEGYGSL	0.989	0.9777	8	18
CCNYL1-IDH1	chr2	208576841	chr2	209104729	431	HLA-C01:30	REMPEGYGSL	0.9862	0.9865	8	18
CCNYL1-IDH1	chr2	208576841	chr2	209104729	431	HLA-B44:10	REMPEGYGSL	0.9765	0.6814	8	18
CCNYL1-IDH1	chr2	208576841	chr2	209104729	431	HLA-B07:12	MPEGYGSLGM	0.9682	0.5328	10	20
CCNYL1-IDH1	chr2	208576841	chr2	209104729	431	HLA-B44:09	REMPEGYGSL	0.9631	0.6449	8	18
CCNYL1-IDH1	chr2	208576841	chr2	209104729	431	HLA-B44:08	REMPEGYGSL	0.9393	0.5273	8	18
CCNYL1-IDH1	chr2	208576841	chr2	209104729	431	HLA-B56:04	MPEGYGSLGM	0.909	0.771	10	20
CCNYL1-IDH1	chr2	208576841	chr2	209104729	431	HLA-B35:12	MPEGYGSLGM	0.8397	0.979	10	20
CCNYL1-IDH1	chr2	208576841	chr2	209104729	431	HLA-B35:22	MPEGYGSL	0.8898	0.5814	10	18
CCNYL1-IDH1	chr2	208576841	chr2	209104729	431	HLA-B35:09	MPEGYGSL	0.8499	0.9924	10	18
CCNYL1-IDH1	chr2	208576841	chr2	209104729	431	HLA-B67:01	MPEGYGSL	0.7918	0.9597	10	18
CCNYL1-IDH1	chr2	208576841	chr2	209104729	431	HLA-C01:03	EMPEGYGSL	0.872	0.9738	9	18
CCNYL1-IDH1	chr2	208576841	chr2	209104729	431	HLA-C01:02	EMPEGYGSL	0.8134	0.9741	9	18
CCNYL1-IDH1	chr2	208576841	chr2	209104729	431	HLA-B50:05	REMPEGYGS	0.0595	0.909	8	17
CCNYL1-IDH1	chr2	208576841	chr2	209104729	431	HLA-B50:04	REMPEGYGS	0.0595	0.909	8	17
CCNYL1-IDH1	chr2	208576841	chr2	209104729	431	HLA-B40:04	REMPEGYGSL	0.9983	0.883	8	18
CCNYL1-IDH1	chr2	208576841	chr2	209104729	431	HLA-C01:03	REMPEGYGSL	0.9981	0.9819	8	18
CCNYL1-IDH1	chr2	208576841	chr2	209104729	431	HLA-C01:02	REMPEGYGSL	0.9976	0.9874	8	18
CCNYL1-IDH1	chr2	208576841	chr2	209104729	431	HLA-B40:12	REMPEGYGSL	0.9974	0.7385	8	18
CCNYL1-IDH1	chr2	208576841	chr2	209104729	431	HLA-B40:36	REMPEGYGSL	0.997	0.6636	8	18
CCNYL1-IDH1	chr2	208576841	chr2	209104729	431	HLA-B40:49	REMPEGYGSL	0.9964	0.697	8	18
CCNYL1-IDH1	chr2	208576841	chr2	209104729	431	HLA-B40:21	REMPEGYGSL	0.9924	0.743	8	18
CCNYL1-IDH1	chr2	208576841	chr2	209104729	431	HLA-B35:77	MPEGYGSLGM	0.9888	0.8538	10	20
CCNYL1-IDH1	chr2	208576841	chr2	209104729	431	HLA-B15:53	REMPEGYGSL	0.9885	0.9831	8	18
CCNYL1-IDH1	chr2	208576841	chr2	209104729	431	HLA-B39:02	REMPEGYGSL	0.9748	0.9943	8	18
CCNYL1-IDH1	chr2	208576841	chr2	209104729	431	HLA-B44:13	REMPEGYGSL	0.9622	0.9722	8	18
CCNYL1-IDH1	chr2	208576841	chr2	209104729	431	HLA-B44:26	REMPEGYGSL	0.9622	0.9722	8	18
CCNYL1-IDH1	chr2	208576841	chr2	209104729	431	HLA-B44:07	REMPEGYGSL	0.9622	0.9722	8	18
CCNYL1-IDH1	chr2	208576841	chr2	209104729	431	HLA-B48:05	REMPEGYGSL	0.9478	0.5062	8	18
CCNYL1-IDH1	chr2	208576841	chr2	209104729	431	HLA-B48:02	REMPEGYGSL	0.9167	0.983	8	18
CCNYL1-IDH1	chr2	208576841	chr2	209104729	431	HLA-B56:02	MPEGYGSLGM	0.909	0.771	10	20
CCNYL1-IDH1	chr2	208576841	chr2	209104729	431	HLA-B50:04	REMPEGYGSL	0.8873	0.8144	8	18
CCNYL1-IDH1	chr2	208576841	chr2	209104729	431	HLA-B50:05	REMPEGYGSL	0.8873	0.8144	8	18
CCNYL1-IDH1	chr2	208576841	chr2	209104729	431	HLA-B41:03	REMPEGYGSL	0.8622	0.9655	8	18
CCNYL1-IDH1	chr2	208576841	chr2	209104729	431	HLA-B35:22	MPEGYGSLGM	0.8413	0.6712	10	20
CCNYL1-IDH1	chr2	208576841	chr2	209104729	431	HLA-B35:09	MPEGYGSLGM	0.8397	0.979	10	20
CCNYL1-IDH1	chr2	208576841	chr2	209104729	431	HLA-B67:01	MPEGYGSLGM	0.7274	0.9758	10	20
CCNYL1-IDH1	chr2	208576841	chr2	209104729	431	HLA-B82:02	MPEGYGSLGM	0.3946	0.7894	10	20

Top

Potential FusionNeoAntigen Information of CCNYL1-IDH1 in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of CCNYL1-IDH1

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
8480	SDREMPEGYGSLGM	CCNYL1	IDH1	chr2	208576841	chr2	209104729	431

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of CCNYL1-IDH1

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	8480	SDREMPEGYGSLGM	-7.15543	-7.26883
HLA-B14:02	3BVN	8480	SDREMPEGYGSLGM	-4.77435	-5.80965
HLA-B52:01	3W39	8480	SDREMPEGYGSLGM	-6.80875	-6.92215
HLA-B52:01	3W39	8480	SDREMPEGYGSLGM	-4.20386	-5.23916
HLA-A11:01	4UQ2	8480	SDREMPEGYGSLGM	-7.5194	-8.5547
HLA-A11:01	4UQ2	8480	SDREMPEGYGSLGM	-6.9601	-7.0735
HLA-A24:02	5HGA	8480	SDREMPEGYGSLGM	-7.52403	-7.63743
HLA-A24:02	5HGA	8480	SDREMPEGYGSLGM	-5.82433	-6.85963
HLA-B27:05	6PYJ	8480	SDREMPEGYGSLGM	-3.28285	-4.31815
HLA-B44:05	3DX8	8480	SDREMPEGYGSLGM	-5.91172	-6.94702
HLA-B44:05	3DX8	8480	SDREMPEGYGSLGM	-4.24346	-4.35686

Top

Vaccine Design for the FusionNeoAntigens of CCNYL1-IDH1

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
CCNYL1-IDH1	chr2	208576841	chr2	209104729	10	18	MPEGYGSL	TGCCCGAAGGGTATGGCTCTCTCG
CCNYL1-IDH1	chr2	208576841	chr2	209104729	10	20	MPEGYGSLGM	TGCCCGAAGGGTATGGCTCTCTCGGCATGA
CCNYL1-IDH1	chr2	208576841	chr2	209104729	10	21	MPEGYGSLGMM	TGCCCGAAGGGTATGGCTCTCTCGGCATGATGA
CCNYL1-IDH1	chr2	208576841	chr2	209104729	8	17	REMPEGYGS	GCGAGATGCCCGAAGGGTATGGCTCTC
CCNYL1-IDH1	chr2	208576841	chr2	209104729	8	18	REMPEGYGSL	GCGAGATGCCCGAAGGGTATGGCTCTCTCG
CCNYL1-IDH1	chr2	208576841	chr2	209104729	9	18	EMPEGYGSL	AGATGCCCGAAGGGTATGGCTCTCTCG

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of CCNYL1-IDH1

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
N/A	CCNYL1-IDH1	chr2	208576841	ENST00000295414	chr2	209104729	ENST00000345146	BC065703

Top

Potential target of CAR-T therapy development for CCNYL1-IDH1

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to CCNYL1-IDH1

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to CCNYL1-IDH1

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)