![]() |
|||||||
|
Fusion Protein:CCT3-ARHGEF11 |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: CCT3-ARHGEF11 | FusionPDB ID: 14293 | FusionGDB2.0 ID: 14293 | Hgene | Tgene | Gene symbol | CCT3 | ARHGEF11 | Gene ID | 7203 | 9826 |
Gene name | chaperonin containing TCP1 subunit 3 | Rho guanine nucleotide exchange factor 11 | |
Synonyms | CCT-gamma|CCTG|PIG48|TCP-1-gamma|TRIC5 | GTRAP48|PDZ-RHOGEF | |
Cytomap | 1q22 | 1q23.1 | |
Type of gene | protein-coding | protein-coding | |
Description | T-complex protein 1 subunit gammaT-complex protein 1, gamma subunitTCP1 (t-complex-1) ring complex, polypeptide 5chaperonin containing TCP1, subunit 3 (gamma)hTRiC5 | rho guanine nucleotide exchange factor 11Rho guanine exchange factor (GEF) 11Rho guanine nucleotide exchange factor (GEF) 11RhoA-specific guanine nucleotide exchange factorRhoGEF glutamate transport modulatorglutamate transporter EAAT4-associated pro | |
Modification date | 20200327 | 20200313 | |
UniProtAcc | P49368 Main function of 5'-partner protein: FUNCTION: Component of the chaperonin-containing T-complex (TRiC), a molecular chaperone complex that assists the folding of proteins upon ATP hydrolysis (PubMed:25467444). The TRiC complex mediates the folding of WRAP53/TCAB1, thereby regulating telomere maintenance (PubMed:25467444). As part of the TRiC complex may play a role in the assembly of BBSome, a complex involved in ciliogenesis regulating transports vesicles to the cilia (PubMed:20080638). The TRiC complex plays a role in the folding of actin and tubulin (Probable). {ECO:0000269|PubMed:20080638, ECO:0000269|PubMed:25467444, ECO:0000305}. | O15085 Main function of 5'-partner protein: FUNCTION: May play a role in the regulation of RhoA GTPase by guanine nucleotide-binding alpha-12 (GNA12) and alpha-13 (GNA13). Acts as guanine nucleotide exchange factor (GEF) for RhoA GTPase and may act as GTPase-activating protein (GAP) for GNA12 and GNA13. Involved in neurotrophin-induced neurite outgrowth. {ECO:0000269|PubMed:21670212}. | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000295688, ENST00000368261, ENST00000472765, ENST00000368256, ENST00000368259, | ENST00000315174, ENST00000361409, ENST00000487682, ENST00000368194, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 24 X 18 X 12=5184 | 6 X 6 X 5=180 |
# samples | 28 | 7 | |
** MAII score | log2(28/5184*10)=-4.21056698593966 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(7/180*10)=-1.36257007938471 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
Fusion gene context | PubMed: CCT3 [Title/Abstract] AND ARHGEF11 [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: CCT3 [Title/Abstract] AND ARHGEF11 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | CCT3(156304504)-ARHGEF11(156931567), # samples:3 | ||
Anticipated loss of major functional domain due to fusion event. | CCT3-ARHGEF11 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. CCT3-ARHGEF11 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. CCT3-ARHGEF11 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. CCT3-ARHGEF11 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. CCT3-ARHGEF11 seems lost the major protein functional domain in Hgene partner, which is a cell metabolism gene due to the frame-shifted ORF. CCT3-ARHGEF11 seems lost the major protein functional domain in Hgene partner, which is a essential gene due to the frame-shifted ORF. CCT3-ARHGEF11 seems lost the major protein functional domain in Tgene partner, which is a essential gene due to the frame-shifted ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
Tgene | ARHGEF11 | GO:0007186 | G protein-coupled receptor signaling pathway | 15755723 |
Tgene | ARHGEF11 | GO:0007266 | Rho protein signal transduction | 10026210 |
Tgene | ARHGEF11 | GO:0045893 | positive regulation of transcription, DNA-templated | 10026210 |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr1:156304504/chr1:156931567) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000295688 | CCT3 | chr1 | 156304504 | - | ENST00000368194 | ARHGEF11 | chr1 | 156931567 | - | 5197 | 488 | 206 | 4036 | 1276 |
ENST00000472765 | CCT3 | chr1 | 156304504 | - | ENST00000368194 | ARHGEF11 | chr1 | 156931567 | - | 5102 | 393 | 306 | 3941 | 1211 |
ENST00000295688 | CCT3 | chr1 | 156304503 | - | ENST00000368194 | ARHGEF11 | chr1 | 156931567 | - | 5197 | 488 | 206 | 4036 | 1276 |
ENST00000472765 | CCT3 | chr1 | 156304503 | - | ENST00000368194 | ARHGEF11 | chr1 | 156931567 | - | 5102 | 393 | 306 | 3941 | 1211 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000295688 | ENST00000368194 | CCT3 | chr1 | 156304504 | - | ARHGEF11 | chr1 | 156931567 | - | 0.002028809 | 0.99797124 |
ENST00000472765 | ENST00000368194 | CCT3 | chr1 | 156304504 | - | ARHGEF11 | chr1 | 156931567 | - | 0.002176061 | 0.99782395 |
ENST00000295688 | ENST00000368194 | CCT3 | chr1 | 156304503 | - | ARHGEF11 | chr1 | 156931567 | - | 0.002028809 | 0.99797124 |
ENST00000472765 | ENST00000368194 | CCT3 | chr1 | 156304503 | - | ARHGEF11 | chr1 | 156931567 | - | 0.002176061 | 0.99782395 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for CCT3-ARHGEF11 |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
CCT3 | chr1 | 156304503 | ARHGEF11 | chr1 | 156931567 | 393 | 29 | IVMTNDGNAILRELFYLCAEVYQQAS |
CCT3 | chr1 | 156304503 | ARHGEF11 | chr1 | 156931567 | 488 | 94 | IVMTNDGNAILRELFYLCAEVYQQAS |
CCT3 | chr1 | 156304504 | ARHGEF11 | chr1 | 156931567 | 393 | 29 | IVMTNDGNAILRELFYLCAEVYQQAS |
CCT3 | chr1 | 156304504 | ARHGEF11 | chr1 | 156931567 | 488 | 94 | IVMTNDGNAILRELFYLCAEVYQQAS |
Top |
Potential FusionNeoAntigen Information of CCT3-ARHGEF11 in HLA I |
![]() |
CCT3-ARHGEF11_156304503_156931567.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
CCT3-ARHGEF11 | chr1 | 156304503 | chr1 | 156931567 | 488 | HLA-B35:08 | NAILRELFY | 0.999 | 0.7579 | 7 | 16 |
CCT3-ARHGEF11 | chr1 | 156304503 | chr1 | 156931567 | 488 | HLA-B15:02 | NAILRELFY | 0.9989 | 0.887 | 7 | 16 |
CCT3-ARHGEF11 | chr1 | 156304503 | chr1 | 156931567 | 488 | HLA-B35:01 | NAILRELFY | 0.9983 | 0.836 | 7 | 16 |
CCT3-ARHGEF11 | chr1 | 156304503 | chr1 | 156931567 | 488 | HLA-A02:11 | AILRELFYL | 0.9844 | 0.5454 | 8 | 17 |
CCT3-ARHGEF11 | chr1 | 156304503 | chr1 | 156931567 | 488 | HLA-A02:21 | AILRELFYL | 0.9831 | 0.6196 | 8 | 17 |
CCT3-ARHGEF11 | chr1 | 156304503 | chr1 | 156931567 | 488 | HLA-A02:04 | AILRELFYL | 0.9801 | 0.5866 | 8 | 17 |
CCT3-ARHGEF11 | chr1 | 156304503 | chr1 | 156931567 | 488 | HLA-A02:27 | AILRELFYL | 0.9761 | 0.5812 | 8 | 17 |
CCT3-ARHGEF11 | chr1 | 156304503 | chr1 | 156931567 | 488 | HLA-A02:35 | AILRELFYL | 0.9683 | 0.539 | 8 | 17 |
CCT3-ARHGEF11 | chr1 | 156304503 | chr1 | 156931567 | 488 | HLA-B35:05 | NAILRELFY | 0.9531 | 0.5128 | 7 | 16 |
CCT3-ARHGEF11 | chr1 | 156304503 | chr1 | 156931567 | 488 | HLA-B15:21 | NAILRELFY | 0.9988 | 0.8384 | 7 | 16 |
CCT3-ARHGEF11 | chr1 | 156304503 | chr1 | 156931567 | 488 | HLA-B15:31 | NAILRELFY | 0.9984 | 0.82 | 7 | 16 |
CCT3-ARHGEF11 | chr1 | 156304503 | chr1 | 156931567 | 488 | HLA-A02:07 | AILRELFYL | 0.9857 | 0.5005 | 8 | 17 |
CCT3-ARHGEF11 | chr1 | 156304503 | chr1 | 156931567 | 488 | HLA-C15:04 | NAILRELFY | 0.9079 | 0.8216 | 7 | 16 |
CCT3-ARHGEF11 | chr1 | 156304503 | chr1 | 156931567 | 488 | HLA-C03:14 | NAILRELFY | 0.6555 | 0.9548 | 7 | 16 |
CCT3-ARHGEF11 | chr1 | 156304503 | chr1 | 156931567 | 488 | HLA-C12:12 | NAILRELFY | 0.2135 | 0.9371 | 7 | 16 |
CCT3-ARHGEF11 | chr1 | 156304503 | chr1 | 156931567 | 488 | HLA-C12:04 | NAILRELFY | 0.1447 | 0.9912 | 7 | 16 |
CCT3-ARHGEF11 | chr1 | 156304503 | chr1 | 156931567 | 488 | HLA-C06:03 | NAILRELFY | 0.1418 | 0.9924 | 7 | 16 |
CCT3-ARHGEF11 | chr1 | 156304503 | chr1 | 156931567 | 488 | HLA-B35:11 | NAILRELFY | 0.9988 | 0.8189 | 7 | 16 |
CCT3-ARHGEF11 | chr1 | 156304503 | chr1 | 156931567 | 488 | HLA-B35:77 | NAILRELFY | 0.9983 | 0.836 | 7 | 16 |
CCT3-ARHGEF11 | chr1 | 156304503 | chr1 | 156931567 | 488 | HLA-B35:23 | NAILRELFY | 0.9982 | 0.796 | 7 | 16 |
CCT3-ARHGEF11 | chr1 | 156304503 | chr1 | 156931567 | 488 | HLA-B35:20 | NAILRELFY | 0.9982 | 0.8862 | 7 | 16 |
CCT3-ARHGEF11 | chr1 | 156304503 | chr1 | 156931567 | 488 | HLA-B35:30 | NAILRELFY | 0.9942 | 0.7197 | 7 | 16 |
CCT3-ARHGEF11 | chr1 | 156304503 | chr1 | 156931567 | 488 | HLA-B35:17 | NAILRELFY | 0.9942 | 0.7197 | 7 | 16 |
CCT3-ARHGEF11 | chr1 | 156304503 | chr1 | 156931567 | 488 | HLA-B35:24 | NAILRELFY | 0.9918 | 0.908 | 7 | 16 |
CCT3-ARHGEF11 | chr1 | 156304503 | chr1 | 156931567 | 488 | HLA-A02:14 | AILRELFYL | 0.9835 | 0.5301 | 8 | 17 |
CCT3-ARHGEF11 | chr1 | 156304503 | chr1 | 156931567 | 488 | HLA-A02:06 | AILRELFYL | 0.9831 | 0.6196 | 8 | 17 |
CCT3-ARHGEF11 | chr1 | 156304503 | chr1 | 156931567 | 488 | HLA-C03:02 | NAILRELFY | 0.9772 | 0.9554 | 7 | 16 |
CCT3-ARHGEF11 | chr1 | 156304503 | chr1 | 156931567 | 488 | HLA-B15:11 | NAILRELFY | 0.9229 | 0.8168 | 7 | 16 |
CCT3-ARHGEF11 | chr1 | 156304503 | chr1 | 156931567 | 488 | HLA-B15:08 | NAILRELFY | 0.9135 | 0.8038 | 7 | 16 |
CCT3-ARHGEF11 | chr1 | 156304503 | chr1 | 156931567 | 488 | HLA-C15:09 | NAILRELFY | 0.9079 | 0.8216 | 7 | 16 |
CCT3-ARHGEF11 | chr1 | 156304503 | chr1 | 156931567 | 488 | HLA-B35:43 | NAILRELFY | 0.8871 | 0.8032 | 7 | 16 |
CCT3-ARHGEF11 | chr1 | 156304503 | chr1 | 156931567 | 488 | HLA-C16:04 | NAILRELFY | 0.7655 | 0.9847 | 7 | 16 |
CCT3-ARHGEF11 | chr1 | 156304503 | chr1 | 156931567 | 488 | HLA-B18:04 | NAILRELFY | 0.7419 | 0.8915 | 7 | 16 |
CCT3-ARHGEF11 | chr1 | 156304503 | chr1 | 156931567 | 488 | HLA-C12:02 | NAILRELFY | 0.4921 | 0.9622 | 7 | 16 |
CCT3-ARHGEF11 | chr1 | 156304503 | chr1 | 156931567 | 488 | HLA-B18:07 | NAILRELFY | 0.4576 | 0.8266 | 7 | 16 |
CCT3-ARHGEF11 | chr1 | 156304503 | chr1 | 156931567 | 488 | HLA-C16:01 | NAILRELFY | 0.398 | 0.9547 | 7 | 16 |
CCT3-ARHGEF11 | chr1 | 156304503 | chr1 | 156931567 | 488 | HLA-C16:02 | NAILRELFY | 0.2843 | 0.974 | 7 | 16 |
CCT3-ARHGEF11 | chr1 | 156304503 | chr1 | 156931567 | 488 | HLA-C12:03 | NAILRELFY | 0.2607 | 0.9758 | 7 | 16 |
CCT3-ARHGEF11 | chr1 | 156304503 | chr1 | 156931567 | 488 | HLA-C02:10 | NAILRELFY | 0.0392 | 0.969 | 7 | 16 |
CCT3-ARHGEF11 | chr1 | 156304503 | chr1 | 156931567 | 488 | HLA-C02:02 | NAILRELFY | 0.0392 | 0.969 | 7 | 16 |
Top |
Potential FusionNeoAntigen Information of CCT3-ARHGEF11 in HLA II |
![]() |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of CCT3-ARHGEF11 |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
2994 | GNAILRELFYLCAE | CCT3 | ARHGEF11 | chr1 | 156304503 | chr1 | 156931567 | 488 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of CCT3-ARHGEF11 |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 2994 | GNAILRELFYLCAE | -7.15543 | -7.26883 |
HLA-B14:02 | 3BVN | 2994 | GNAILRELFYLCAE | -4.77435 | -5.80965 |
HLA-B52:01 | 3W39 | 2994 | GNAILRELFYLCAE | -6.80875 | -6.92215 |
HLA-B52:01 | 3W39 | 2994 | GNAILRELFYLCAE | -4.20386 | -5.23916 |
HLA-A11:01 | 4UQ2 | 2994 | GNAILRELFYLCAE | -7.5194 | -8.5547 |
HLA-A11:01 | 4UQ2 | 2994 | GNAILRELFYLCAE | -6.9601 | -7.0735 |
HLA-A24:02 | 5HGA | 2994 | GNAILRELFYLCAE | -7.52403 | -7.63743 |
HLA-A24:02 | 5HGA | 2994 | GNAILRELFYLCAE | -5.82433 | -6.85963 |
HLA-B27:05 | 6PYJ | 2994 | GNAILRELFYLCAE | -3.28285 | -4.31815 |
HLA-B44:05 | 3DX8 | 2994 | GNAILRELFYLCAE | -5.91172 | -6.94702 |
HLA-B44:05 | 3DX8 | 2994 | GNAILRELFYLCAE | -4.24346 | -4.35686 |
Top |
Vaccine Design for the FusionNeoAntigens of CCT3-ARHGEF11 |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
CCT3-ARHGEF11 | chr1 | 156304503 | chr1 | 156931567 | 7 | 16 | NAILRELFY | AATGCCATTCTTCGAGAGCTTTTTTAC |
CCT3-ARHGEF11 | chr1 | 156304503 | chr1 | 156931567 | 8 | 17 | AILRELFYL | GCCATTCTTCGAGAGCTTTTTTACCTG |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of CCT3-ARHGEF11 |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
OV | CCT3-ARHGEF11 | chr1 | 156304503 | ENST00000295688 | chr1 | 156931567 | ENST00000368194 | TCGA-13-A5FT |
Top |
Potential target of CAR-T therapy development for CCT3-ARHGEF11 |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to CCT3-ARHGEF11 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to CCT3-ARHGEF11 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |