Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:CLIP4-BRE

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: CLIP4-BRE
	FusionPDB ID: 17186
	FusionGDB2.0 ID: 17186
		Hgene	Tgene
	Gene symbol	CLIP4	BRE
	Gene ID	79745	9577
	Gene name	CAP-Gly domain containing linker protein family member 4	BRISC and BRCA1 A complex member 2
	Synonyms	RSNL2	BRCC4\|BRCC45\|BRE
	Cytomap	2p23.2	2p23.2
	Type of gene	protein-coding	protein-coding
	Description	CAP-Gly domain-containing linker protein 4CAP-GLY domain containing linker protein family, member 4restin-like protein 2	BRISC and BRCA1-A complex member 2BRCA1-A complex subunit BREBRCA1/BRCA2-containing complex subunit 45BRCA1/BRCA2-containing complex, subunit 4brain and reproductive organ-expressed (TNFRSF1A modulator)brain and reproductive organ-expressed protein
	Modification date	20200313	20200313
	UniProtAcc	Q8N3C7 Main function of 5'-partner protein:	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000320081, ENST00000401605, ENST00000404424, ENST00000401617, ENST00000481628,	ENST00000603461, ENST00000342045, ENST00000344773, ENST00000361704, ENST00000379624, ENST00000379632,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	6 X 5 X 5=150	20 X 20 X 12=4800
	# samples	6	30
	** MAII score	log2(6/150*10)=-1.32192809488736 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(30/4800*10)=-4 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: CLIP4 [Title/Abstract] AND BRE [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: CLIP4 [Title/Abstract] AND BRE [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	CLIP4(29344387)-BRE(28521205), # samples:2
Anticipated loss of major functional domain due to fusion event.	CLIP4-BRE seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. CLIP4-BRE seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Tgene	BRE	GO:0043066	negative regulation of apoptotic process	15465831

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr2:29344387/chr2:28521205)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across CLIP4 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across BRE (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000401605	CLIP4	chr2	29344387	+	ENST00000344773	BRE	chr2	28521205	+	1171	391	307	798	163
ENST00000401605	CLIP4	chr2	29344387	+	ENST00000379624	BRE	chr2	28521205	+	997	391	258	608	116
ENST00000401605	CLIP4	chr2	29344387	+	ENST00000342045	BRE	chr2	28521205	+	997	391	258	608	116
ENST00000401605	CLIP4	chr2	29344387	+	ENST00000379632	BRE	chr2	28521205	+	1069	391	307	696	129
ENST00000401605	CLIP4	chr2	29344387	+	ENST00000361704	BRE	chr2	28521205	+	1069	391	307	696	129
ENST00000404424	CLIP4	chr2	29344387	+	ENST00000344773	BRE	chr2	28521205	+	1245	465	381	872	163
ENST00000404424	CLIP4	chr2	29344387	+	ENST00000379624	BRE	chr2	28521205	+	1071	465	332	682	116
ENST00000404424	CLIP4	chr2	29344387	+	ENST00000342045	BRE	chr2	28521205	+	1071	465	332	682	116
ENST00000404424	CLIP4	chr2	29344387	+	ENST00000379632	BRE	chr2	28521205	+	1143	465	381	770	129
ENST00000404424	CLIP4	chr2	29344387	+	ENST00000361704	BRE	chr2	28521205	+	1143	465	381	770	129
ENST00000320081	CLIP4	chr2	29344387	+	ENST00000344773	BRE	chr2	28521205	+	1168	388	304	795	163
ENST00000320081	CLIP4	chr2	29344387	+	ENST00000379624	BRE	chr2	28521205	+	994	388	255	605	116
ENST00000320081	CLIP4	chr2	29344387	+	ENST00000342045	BRE	chr2	28521205	+	994	388	255	605	116
ENST00000320081	CLIP4	chr2	29344387	+	ENST00000379632	BRE	chr2	28521205	+	1066	388	304	693	129
ENST00000320081	CLIP4	chr2	29344387	+	ENST00000361704	BRE	chr2	28521205	+	1066	388	304	693	129

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000401605	ENST00000344773	CLIP4	chr2	29344387	+	BRE	chr2	28521205	+	0.5205059	0.4794941
ENST00000401605	ENST00000379624	CLIP4	chr2	29344387	+	BRE	chr2	28521205	+	0.041939203	0.9580608
ENST00000401605	ENST00000342045	CLIP4	chr2	29344387	+	BRE	chr2	28521205	+	0.041939203	0.9580608
ENST00000401605	ENST00000379632	CLIP4	chr2	29344387	+	BRE	chr2	28521205	+	0.038071312	0.9619287
ENST00000401605	ENST00000361704	CLIP4	chr2	29344387	+	BRE	chr2	28521205	+	0.038071312	0.9619287
ENST00000404424	ENST00000344773	CLIP4	chr2	29344387	+	BRE	chr2	28521205	+	0.3531651	0.6468349
ENST00000404424	ENST00000379624	CLIP4	chr2	29344387	+	BRE	chr2	28521205	+	0.043318428	0.9566816
ENST00000404424	ENST00000342045	CLIP4	chr2	29344387	+	BRE	chr2	28521205	+	0.043318428	0.9566816
ENST00000404424	ENST00000379632	CLIP4	chr2	29344387	+	BRE	chr2	28521205	+	0.0494461	0.95055395
ENST00000404424	ENST00000361704	CLIP4	chr2	29344387	+	BRE	chr2	28521205	+	0.0494461	0.95055395
ENST00000320081	ENST00000344773	CLIP4	chr2	29344387	+	BRE	chr2	28521205	+	0.68823427	0.31176573
ENST00000320081	ENST00000379624	CLIP4	chr2	29344387	+	BRE	chr2	28521205	+	0.09178085	0.90821916
ENST00000320081	ENST00000342045	CLIP4	chr2	29344387	+	BRE	chr2	28521205	+	0.09178085	0.90821916
ENST00000320081	ENST00000379632	CLIP4	chr2	29344387	+	BRE	chr2	28521205	+	0.07215786	0.92784214
ENST00000320081	ENST00000361704	CLIP4	chr2	29344387	+	BRE	chr2	28521205	+	0.07215786	0.92784214

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for CLIP4-BRE

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
CLIP4	chr2	29344387	BRE	chr2	28521205	388	28	SFPFLQHQCLQTVLTCLCFSLETSQL
CLIP4	chr2	29344387	BRE	chr2	28521205	388	44	IFSISAAPMPSDCVDLPLFFPRDQPT
CLIP4	chr2	29344387	BRE	chr2	28521205	391	28	SFPFLQHQCLQTVLTCLCFSLETSQL
CLIP4	chr2	29344387	BRE	chr2	28521205	391	44	IFSISAAPMPSDCVDLPLFFPRDQPT
CLIP4	chr2	29344387	BRE	chr2	28521205	465	28	SFPFLQHQCLQTVLTCLCFSLETSQL
CLIP4	chr2	29344387	BRE	chr2	28521205	465	44	IFSISAAPMPSDCVDLPLFFPRDQPT

Top

Potential FusionNeoAntigen Information of CLIP4-BRE in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

CLIP4-BRE_29344387_28521205.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
CLIP4-BRE	chr2	29344387	chr2	28521205	388	HLA-B48:01	HQCLQTVL	0.9921	0.5745	6	14
CLIP4-BRE	chr2	29344387	chr2	28521205	388	HLA-B35:03	MPSDCVDL	0.9223	0.9264	8	16
CLIP4-BRE	chr2	29344387	chr2	28521205	388	HLA-B39:01	QHQCLQTVL	0.9991	0.9523	5	14
CLIP4-BRE	chr2	29344387	chr2	28521205	388	HLA-B38:02	QHQCLQTVL	0.9987	0.9821	5	14
CLIP4-BRE	chr2	29344387	chr2	28521205	388	HLA-B39:24	QHQCLQTVL	0.9987	0.5603	5	14
CLIP4-BRE	chr2	29344387	chr2	28521205	388	HLA-B38:01	QHQCLQTVL	0.9984	0.9822	5	14
CLIP4-BRE	chr2	29344387	chr2	28521205	388	HLA-B39:06	QHQCLQTVL	0.9973	0.8734	5	14
CLIP4-BRE	chr2	29344387	chr2	28521205	388	HLA-B14:02	QHQCLQTVL	0.9874	0.8891	5	14
CLIP4-BRE	chr2	29344387	chr2	28521205	388	HLA-B14:01	QHQCLQTVL	0.9874	0.8891	5	14
CLIP4-BRE	chr2	29344387	chr2	28521205	388	HLA-B15:18	QHQCLQTVL	0.8804	0.718	5	14
CLIP4-BRE	chr2	29344387	chr2	28521205	388	HLA-B35:03	MPSDCVDLPL	0.9898	0.9103	8	18
CLIP4-BRE	chr2	29344387	chr2	28521205	388	HLA-B35:08	MPSDCVDLPL	0.9862	0.9335	8	18
CLIP4-BRE	chr2	29344387	chr2	28521205	388	HLA-B48:01	LQHQCLQTVL	0.974	0.772	4	14
CLIP4-BRE	chr2	29344387	chr2	28521205	388	HLA-B35:04	MPSDCVDLPL	0.9725	0.9674	8	18
CLIP4-BRE	chr2	29344387	chr2	28521205	388	HLA-B35:02	MPSDCVDLPL	0.9725	0.9674	8	18
CLIP4-BRE	chr2	29344387	chr2	28521205	388	HLA-B35:03	APMPSDCVDL	0.8094	0.9056	6	16
CLIP4-BRE	chr2	29344387	chr2	28521205	388	HLA-B35:02	APMPSDCVDL	0.634	0.961	6	16
CLIP4-BRE	chr2	29344387	chr2	28521205	388	HLA-B35:04	APMPSDCVDL	0.634	0.961	6	16
CLIP4-BRE	chr2	29344387	chr2	28521205	388	HLA-B82:01	APMPSDCVDL	0.4274	0.5223	6	16
CLIP4-BRE	chr2	29344387	chr2	28521205	388	HLA-B35:01	MPSDCVDLPLF	0.9991	0.9334	8	19
CLIP4-BRE	chr2	29344387	chr2	28521205	388	HLA-B35:08	MPSDCVDLPLF	0.9989	0.9499	8	19
CLIP4-BRE	chr2	29344387	chr2	28521205	388	HLA-B35:05	MPSDCVDLPLF	0.9985	0.6486	8	19
CLIP4-BRE	chr2	29344387	chr2	28521205	388	HLA-B35:03	MPSDCVDLPLF	0.9954	0.9204	8	19
CLIP4-BRE	chr2	29344387	chr2	28521205	388	HLA-B39:09	QHQCLQTVL	0.9992	0.7384	5	14
CLIP4-BRE	chr2	29344387	chr2	28521205	388	HLA-B39:12	QHQCLQTVL	0.999	0.9561	5	14
CLIP4-BRE	chr2	29344387	chr2	28521205	388	HLA-B39:05	QHQCLQTVL	0.9984	0.9495	5	14
CLIP4-BRE	chr2	29344387	chr2	28521205	388	HLA-B14:03	QHQCLQTVL	0.5608	0.8262	5	14
CLIP4-BRE	chr2	29344387	chr2	28521205	388	HLA-C01:17	AAPMPSDCV	0.0328	0.9741	5	14
CLIP4-BRE	chr2	29344387	chr2	28521205	388	HLA-B07:12	APMPSDCVDL	0.975	0.5814	6	16
CLIP4-BRE	chr2	29344387	chr2	28521205	388	HLA-B35:12	MPSDCVDLPL	0.9725	0.9674	8	18
CLIP4-BRE	chr2	29344387	chr2	28521205	388	HLA-B39:10	MPSDCVDLPL	0.9448	0.9417	8	18
CLIP4-BRE	chr2	29344387	chr2	28521205	388	HLA-B39:10	APMPSDCVDL	0.745	0.9313	6	16
CLIP4-BRE	chr2	29344387	chr2	28521205	388	HLA-B35:12	APMPSDCVDL	0.634	0.961	6	16
CLIP4-BRE	chr2	29344387	chr2	28521205	388	HLA-B42:01	APMPSDCVDL	0.5517	0.8408	6	16
CLIP4-BRE	chr2	29344387	chr2	28521205	388	HLA-B39:31	QHQCLQTVL	0.9992	0.9524	5	14
CLIP4-BRE	chr2	29344387	chr2	28521205	388	HLA-B38:05	QHQCLQTVL	0.9984	0.9822	5	14
CLIP4-BRE	chr2	29344387	chr2	28521205	388	HLA-B15:09	QHQCLQTVL	0.9941	0.8147	5	14
CLIP4-BRE	chr2	29344387	chr2	28521205	388	HLA-B39:11	QHQCLQTVL	0.8952	0.934	5	14
CLIP4-BRE	chr2	29344387	chr2	28521205	388	HLA-C01:03	AAPMPSDCV	0.0555	0.9736	5	14
CLIP4-BRE	chr2	29344387	chr2	28521205	388	HLA-C01:02	AAPMPSDCV	0.05	0.9742	5	14
CLIP4-BRE	chr2	29344387	chr2	28521205	388	HLA-B15:73	LQHQCLQTVL	0.9961	0.9724	4	14
CLIP4-BRE	chr2	29344387	chr2	28521205	388	HLA-B15:30	LQHQCLQTVL	0.9932	0.9732	4	14
CLIP4-BRE	chr2	29344387	chr2	28521205	388	HLA-B35:13	MPSDCVDLPL	0.9877	0.9133	8	18
CLIP4-BRE	chr2	29344387	chr2	28521205	388	HLA-B35:09	MPSDCVDLPL	0.9725	0.9674	8	18
CLIP4-BRE	chr2	29344387	chr2	28521205	388	HLA-B67:01	MPSDCVDLPL	0.9474	0.8796	8	18
CLIP4-BRE	chr2	29344387	chr2	28521205	388	HLA-B35:13	APMPSDCVDL	0.7666	0.9095	6	16
CLIP4-BRE	chr2	29344387	chr2	28521205	388	HLA-B67:01	APMPSDCVDL	0.7352	0.8523	6	16
CLIP4-BRE	chr2	29344387	chr2	28521205	388	HLA-B35:09	APMPSDCVDL	0.634	0.961	6	16
CLIP4-BRE	chr2	29344387	chr2	28521205	388	HLA-B82:02	APMPSDCVDL	0.4274	0.5223	6	16
CLIP4-BRE	chr2	29344387	chr2	28521205	388	HLA-B35:77	MPSDCVDLPLF	0.9991	0.9334	8	19
CLIP4-BRE	chr2	29344387	chr2	28521205	388	HLA-B35:23	MPSDCVDLPLF	0.999	0.9336	8	19
CLIP4-BRE	chr2	29344387	chr2	28521205	388	HLA-B35:17	MPSDCVDLPLF	0.9986	0.851	8	19
CLIP4-BRE	chr2	29344387	chr2	28521205	388	HLA-B35:30	MPSDCVDLPLF	0.9986	0.851	8	19
CLIP4-BRE	chr2	29344387	chr2	28521205	388	HLA-B35:24	MPSDCVDLPLF	0.9825	0.9191	8	19

Top

Potential FusionNeoAntigen Information of CLIP4-BRE in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of CLIP4-BRE

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
491	APMPSDCVDLPLFF	CLIP4	BRE	chr2	29344387	chr2	28521205	388

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
3465	HQCLQTVLTCLCFS	CLIP4	BRE	chr2	29344387	chr2	28521205	388

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of CLIP4-BRE

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	491	APMPSDCVDLPLFF	-7.9962	-8.1096
HLA-B14:02	3BVN	491	APMPSDCVDLPLFF	-5.70842	-6.74372
HLA-B52:01	3W39	491	APMPSDCVDLPLFF	-6.83737	-6.95077
HLA-B52:01	3W39	491	APMPSDCVDLPLFF	-4.4836	-5.5189
HLA-A11:01	4UQ2	491	APMPSDCVDLPLFF	-10.0067	-10.1201
HLA-A11:01	4UQ2	491	APMPSDCVDLPLFF	-9.03915	-10.0745
HLA-A24:02	5HGA	491	APMPSDCVDLPLFF	-6.56204	-6.67544
HLA-A24:02	5HGA	491	APMPSDCVDLPLFF	-5.42271	-6.45801
HLA-B44:05	3DX8	491	APMPSDCVDLPLFF	-7.85648	-8.89178
HLA-B44:05	3DX8	491	APMPSDCVDLPLFF	-5.3978	-5.5112
HLA-A02:01	6TDR	491	APMPSDCVDLPLFF	-3.37154	-4.40684
HLA-B14:02	3BVN	3465	HQCLQTVLTCLCFS	-7.9962	-8.1096
HLA-B14:02	3BVN	3465	HQCLQTVLTCLCFS	-5.70842	-6.74372
HLA-B52:01	3W39	3465	HQCLQTVLTCLCFS	-6.83737	-6.95077
HLA-B52:01	3W39	3465	HQCLQTVLTCLCFS	-4.4836	-5.5189
HLA-A11:01	4UQ2	3465	HQCLQTVLTCLCFS	-10.0067	-10.1201
HLA-A11:01	4UQ2	3465	HQCLQTVLTCLCFS	-9.03915	-10.0745
HLA-A24:02	5HGA	3465	HQCLQTVLTCLCFS	-6.56204	-6.67544
HLA-A24:02	5HGA	3465	HQCLQTVLTCLCFS	-5.42271	-6.45801
HLA-B44:05	3DX8	3465	HQCLQTVLTCLCFS	-7.85648	-8.89178
HLA-B44:05	3DX8	3465	HQCLQTVLTCLCFS	-5.3978	-5.5112
HLA-A02:01	6TDR	3465	HQCLQTVLTCLCFS	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of CLIP4-BRE

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
CLIP4-BRE	chr2	29344387	chr2	28521205	4	14	LQHQCLQTVL	CTGCAGCACCAATGCCTTCAGACTGTGTTG
CLIP4-BRE	chr2	29344387	chr2	28521205	5	14	AAPMPSDCV	CAGCACCAATGCCTTCAGACTGTGTTG
CLIP4-BRE	chr2	29344387	chr2	28521205	5	14	QHQCLQTVL	CAGCACCAATGCCTTCAGACTGTGTTG
CLIP4-BRE	chr2	29344387	chr2	28521205	6	14	HQCLQTVL	CACCAATGCCTTCAGACTGTGTTG
CLIP4-BRE	chr2	29344387	chr2	28521205	6	16	APMPSDCVDL	CACCAATGCCTTCAGACTGTGTTGACCTGC
CLIP4-BRE	chr2	29344387	chr2	28521205	8	16	MPSDCVDL	TGCCTTCAGACTGTGTTGACCTGC
CLIP4-BRE	chr2	29344387	chr2	28521205	8	18	MPSDCVDLPL	TGCCTTCAGACTGTGTTGACCTGCCTCTGT
CLIP4-BRE	chr2	29344387	chr2	28521205	8	19	MPSDCVDLPLF	TGCCTTCAGACTGTGTTGACCTGCCTCTGTTTT

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of CLIP4-BRE

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
OV	CLIP4-BRE	chr2	29344387	ENST00000320081	chr2	28521205	ENST00000342045	TCGA-25-1323-01A
OV	CLIP4-BRE	chr2	29344387	ENST00000320081	chr2	28521205	ENST00000344773	TCGA-25-1323-01A

Top

Potential target of CAR-T therapy development for CLIP4-BRE

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to CLIP4-BRE

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to CLIP4-BRE

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)