![]() |
|||||||
|
Fusion Protein:CSPG4-SON |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: CSPG4-SON | FusionPDB ID: 19903 | FusionGDB2.0 ID: 19903 | Hgene | Tgene | Gene symbol | CSPG4 | SON | Gene ID | 1464 | 6651 |
Gene name | chondroitin sulfate proteoglycan 4 | SON DNA and RNA binding protein | |
Synonyms | HMW-MAA|MCSP|MCSPG|MEL-CSPG|MSK16|NG2 | BASS1|C21orf50|DBP-5|NREBP|SON3|TOKIMS | |
Cytomap | 15q24.2 | 21q22.11 | |
Type of gene | protein-coding | protein-coding | |
Description | chondroitin sulfate proteoglycan 4chondroitin sulfate proteoglycan 4 (melanoma-associated)chondroitin sulfate proteoglycan NG2melanoma chondroitin sulfate proteoglycanmelanoma-associated chondroitin sulfate proteoglycan | protein SONBax antagonist selected in Saccharomyces 1NRE-binding proteinSON DNA binding proteinnegative regulatory element-binding protein | |
Modification date | 20200313 | 20200313 | |
UniProtAcc | Q6UVK1 Main function of 5'-partner protein: FUNCTION: Proteoglycan playing a role in cell proliferation and migration which stimulates endothelial cells motility during microvascular morphogenesis. May also inhibit neurite outgrowth and growth cone collapse during axon regeneration. Cell surface receptor for collagen alpha 2(VI) which may confer cells ability to migrate on that substrate. Binds through its extracellular N-terminus growth factors, extracellular matrix proteases modulating their activity. May regulate MPP16-dependent degradation and invasion of type I collagen participating in melanoma cells invasion properties. May modulate the plasminogen system by enhancing plasminogen activation and inhibiting angiostatin. Functions also as a signal transducing protein by binding through its cytoplasmic C-terminus scaffolding and signaling proteins. May promote retraction fiber formation and cell polarization through Rho GTPase activation. May stimulate alpha-4, beta-1 integrin-mediated adhesion and spreading by recruiting and activating a signaling cascade through CDC42, ACK1 and BCAR1. May activate FAK and ERK1/ERK2 signaling cascades. {ECO:0000269|PubMed:10587647, ECO:0000269|PubMed:11278606, ECO:0000269|PubMed:15210734}. | SHH Main function of 5'-partner protein: 462 | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000308508, | ENST00000470533, ENST00000300278, ENST00000381679, ENST00000290239, ENST00000356577, ENST00000381692, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 5 X 4 X 3=60 | 16 X 15 X 5=1200 |
# samples | 5 | 16 | |
** MAII score | log2(5/60*10)=-0.263034405833794 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(16/1200*10)=-2.90689059560852 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
Fusion gene context | PubMed: CSPG4 [Title/Abstract] AND SON [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: CSPG4 [Title/Abstract] AND SON [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | CSPG4(75977076)-SON(34945612), # samples:1 | ||
Anticipated loss of major functional domain due to fusion event. | CSPG4-SON seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. CSPG4-SON seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. CSPG4-SON seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. CSPG4-SON seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
Hgene | CSPG4 | GO:0035556 | intracellular signal transduction | 10587647 |
Hgene | CSPG4 | GO:0050731 | positive regulation of peptidyl-tyrosine phosphorylation | 10587647 |
Tgene | SON | GO:0006397 | mRNA processing | 21504830 |
Tgene | SON | GO:0043066 | negative regulation of apoptotic process | 10509013 |
Tgene | SON | GO:0048024 | regulation of mRNA splicing, via spliceosome | 21504830 |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr15:75977076/chr21:34945612) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000308508 | CSPG4 | chr15 | 75977076 | - | ENST00000356577 | SON | chr21 | 34945612 | + | 5995 | 4542 | 93 | 4937 | 1614 |
ENST00000308508 | CSPG4 | chr15 | 75977076 | - | ENST00000290239 | SON | chr21 | 34945612 | + | 6020 | 4542 | 93 | 4937 | 1614 |
ENST00000308508 | CSPG4 | chr15 | 75977076 | - | ENST00000381692 | SON | chr21 | 34945612 | + | 5995 | 4542 | 93 | 4937 | 1614 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000308508 | ENST00000356577 | CSPG4 | chr15 | 75977076 | - | SON | chr21 | 34945612 | + | 0.00126061 | 0.9987394 |
ENST00000308508 | ENST00000290239 | CSPG4 | chr15 | 75977076 | - | SON | chr21 | 34945612 | + | 0.001214538 | 0.99878544 |
ENST00000308508 | ENST00000381692 | CSPG4 | chr15 | 75977076 | - | SON | chr21 | 34945612 | + | 0.00126061 | 0.9987394 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for CSPG4-SON |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
CSPG4 | chr15 | 75977076 | SON | chr21 | 34945612 | 4542 | 1483 | DQPPILTTNTGLQDQFLRAAPVTGGM |
Top |
Potential FusionNeoAntigen Information of CSPG4-SON in HLA I |
![]() |
CSPG4-SON_75977076_34945612.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 4542 | HLA-A02:22 | GLQDQFLRA | 0.9912 | 0.7095 | 10 | 19 |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 4542 | HLA-A02:60 | GLQDQFLRA | 0.9903 | 0.6654 | 10 | 19 |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 4542 | HLA-A02:30 | GLQDQFLRA | 0.9901 | 0.6556 | 10 | 19 |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 4542 | HLA-A02:24 | GLQDQFLRA | 0.9901 | 0.6556 | 10 | 19 |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 4542 | HLA-A02:67 | GLQDQFLRA | 0.9901 | 0.6556 | 10 | 19 |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 4542 | HLA-A02:11 | GLQDQFLRA | 0.9899 | 0.6572 | 10 | 19 |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 4542 | HLA-A02:27 | GLQDQFLRA | 0.9883 | 0.7084 | 10 | 19 |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 4542 | HLA-A02:13 | GLQDQFLRA | 0.9856 | 0.7922 | 10 | 19 |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 4542 | HLA-A02:21 | GLQDQFLRA | 0.9828 | 0.7369 | 10 | 19 |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 4542 | HLA-A02:38 | GLQDQFLRA | 0.9813 | 0.7549 | 10 | 19 |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 4542 | HLA-A02:19 | GLQDQFLRA | 0.8776 | 0.6744 | 10 | 19 |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 4542 | HLA-A02:29 | GLQDQFLRA | 0.8254 | 0.6624 | 10 | 19 |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 4542 | HLA-A02:20 | GLQDQFLRA | 0.8101 | 0.6612 | 10 | 19 |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 4542 | HLA-A02:35 | GLQDQFLRA | 0.7806 | 0.6702 | 10 | 19 |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 4542 | HLA-A02:02 | GLQDQFLRA | 0.9911 | 0.6902 | 10 | 19 |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 4542 | HLA-A02:01 | GLQDQFLRA | 0.9901 | 0.6556 | 10 | 19 |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 4542 | HLA-A02:03 | GLQDQFLRA | 0.99 | 0.8014 | 10 | 19 |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 4542 | HLA-A02:06 | GLQDQFLRA | 0.9828 | 0.7369 | 10 | 19 |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 4542 | HLA-B57:02 | TTNTGLQDQF | 0.9958 | 0.9587 | 6 | 16 |
Top |
Potential FusionNeoAntigen Information of CSPG4-SON in HLA II |
![]() |
CSPG4-SON_75977076_34945612.msa |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 4542 | DRB1-0403 | QPPILTTNTGLQDQF | 1 | 16 |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 4542 | DRB1-0403 | DQPPILTTNTGLQDQ | 0 | 15 |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 4542 | DRB1-0413 | QPPILTTNTGLQDQF | 1 | 16 |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 4542 | DRB1-0413 | DQPPILTTNTGLQDQ | 0 | 15 |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 4542 | DRB1-0415 | DQPPILTTNTGLQDQ | 0 | 15 |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 4542 | DRB1-0415 | QPPILTTNTGLQDQF | 1 | 16 |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 4542 | DRB1-0427 | QPPILTTNTGLQDQF | 1 | 16 |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 4542 | DRB1-0427 | DQPPILTTNTGLQDQ | 0 | 15 |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 4542 | DRB1-0436 | DQPPILTTNTGLQDQ | 0 | 15 |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 4542 | DRB1-0436 | QPPILTTNTGLQDQF | 1 | 16 |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 4542 | DRB1-0439 | QPPILTTNTGLQDQF | 1 | 16 |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 4542 | DRB1-0439 | DQPPILTTNTGLQDQ | 0 | 15 |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 4542 | DRB1-0440 | QPPILTTNTGLQDQF | 1 | 16 |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 4542 | DRB1-0440 | DQPPILTTNTGLQDQ | 0 | 15 |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 4542 | DRB1-0441 | QPPILTTNTGLQDQF | 1 | 16 |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 4542 | DRB1-0441 | DQPPILTTNTGLQDQ | 0 | 15 |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 4542 | DRB1-0442 | QPPILTTNTGLQDQF | 1 | 16 |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 4542 | DRB1-0442 | DQPPILTTNTGLQDQ | 0 | 15 |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 4542 | DRB1-0446 | QPPILTTNTGLQDQF | 1 | 16 |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 4542 | DRB1-0446 | DQPPILTTNTGLQDQ | 0 | 15 |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 4542 | DRB1-0449 | QPPILTTNTGLQDQF | 1 | 16 |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 4542 | DRB1-0449 | DQPPILTTNTGLQDQ | 0 | 15 |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 4542 | DRB1-0450 | QPPILTTNTGLQDQF | 1 | 16 |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 4542 | DRB1-0450 | DQPPILTTNTGLQDQ | 0 | 15 |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 4542 | DRB1-0451 | DQPPILTTNTGLQDQ | 0 | 15 |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 4542 | DRB1-0451 | QPPILTTNTGLQDQF | 1 | 16 |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 4542 | DRB1-0452 | QPPILTTNTGLQDQF | 1 | 16 |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 4542 | DRB1-0452 | DQPPILTTNTGLQDQ | 0 | 15 |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 4542 | DRB1-0453 | QPPILTTNTGLQDQF | 1 | 16 |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 4542 | DRB1-0453 | DQPPILTTNTGLQDQ | 0 | 15 |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 4542 | DRB1-0455 | QPPILTTNTGLQDQF | 1 | 16 |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 4542 | DRB1-0455 | DQPPILTTNTGLQDQ | 0 | 15 |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 4542 | DRB1-0456 | QPPILTTNTGLQDQF | 1 | 16 |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 4542 | DRB1-0456 | DQPPILTTNTGLQDQ | 0 | 15 |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 4542 | DRB1-0458 | QPPILTTNTGLQDQF | 1 | 16 |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 4542 | DRB1-0458 | DQPPILTTNTGLQDQ | 0 | 15 |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 4542 | DRB1-0459 | QPPILTTNTGLQDQF | 1 | 16 |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 4542 | DRB1-0459 | DQPPILTTNTGLQDQ | 0 | 15 |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 4542 | DRB1-0460 | QPPILTTNTGLQDQF | 1 | 16 |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 4542 | DRB1-0460 | DQPPILTTNTGLQDQ | 0 | 15 |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 4542 | DRB1-0465 | QPPILTTNTGLQDQF | 1 | 16 |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 4542 | DRB1-0465 | DQPPILTTNTGLQDQ | 0 | 15 |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 4542 | DRB1-0467 | DQPPILTTNTGLQDQ | 0 | 15 |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 4542 | DRB1-0468 | QPPILTTNTGLQDQF | 1 | 16 |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 4542 | DRB1-0468 | DQPPILTTNTGLQDQ | 0 | 15 |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 4542 | DRB1-0470 | QPPILTTNTGLQDQF | 1 | 16 |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 4542 | DRB1-0471 | QPPILTTNTGLQDQF | 1 | 16 |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 4542 | DRB1-0471 | DQPPILTTNTGLQDQ | 0 | 15 |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 4542 | DRB1-0478 | QPPILTTNTGLQDQF | 1 | 16 |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 4542 | DRB1-0478 | DQPPILTTNTGLQDQ | 0 | 15 |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 4542 | DRB1-0485 | QPPILTTNTGLQDQF | 1 | 16 |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 4542 | DRB1-0485 | DQPPILTTNTGLQDQ | 0 | 15 |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 4542 | DRB1-0488 | QPPILTTNTGLQDQF | 1 | 16 |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 4542 | DRB1-0488 | DQPPILTTNTGLQDQ | 0 | 15 |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 4542 | DRB1-0902 | LQDQFLRAAPVTGGM | 11 | 26 |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 4542 | DRB1-0902 | GLQDQFLRAAPVTGG | 10 | 25 |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 4542 | DRB1-1001 | LQDQFLRAAPVTGGM | 11 | 26 |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 4542 | DRB1-1003 | LQDQFLRAAPVTGGM | 11 | 26 |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 4542 | DRB1-1410 | DQPPILTTNTGLQDQ | 0 | 15 |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 4542 | DRB1-1410 | QPPILTTNTGLQDQF | 1 | 16 |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 4542 | DRB3-0204 | QPPILTTNTGLQDQF | 1 | 16 |
Top |
Fusion breakpoint peptide structures of CSPG4-SON |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
9701 | TTNTGLQDQFLRAA | CSPG4 | SON | chr15 | 75977076 | chr21 | 34945612 | 4542 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of CSPG4-SON |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
Top |
Vaccine Design for the FusionNeoAntigens of CSPG4-SON |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 10 | 19 | GLQDQFLRA | GGCCTGCAGGATCAGTTCTTAAGAGCA |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 6 | 16 | TTNTGLQDQF | ACTACAAACACAGGCCTGCAGGATCAGTTC |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 0 | 15 | DQPPILTTNTGLQDQ | GACCAACCCCCCATCCTCACTACAAACACAGGCCTGCAGGATCAG |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 1 | 16 | QPPILTTNTGLQDQF | CAACCCCCCATCCTCACTACAAACACAGGCCTGCAGGATCAGTTC |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 10 | 25 | GLQDQFLRAAPVTGG | GGCCTGCAGGATCAGTTCTTAAGAGCAGCCCCGGTAACTGGAGGA |
CSPG4-SON | chr15 | 75977076 | chr21 | 34945612 | 11 | 26 | LQDQFLRAAPVTGGM | CTGCAGGATCAGTTCTTAAGAGCAGCCCCGGTAACTGGAGGAATG |
Top |
Information of the samples that have these potential fusion neoantigens of CSPG4-SON |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
N/A | CSPG4-SON | chr15 | 75977076 | ENST00000308508 | chr21 | 34945612 | ENST00000290239 | CD172355 |
Top |
Potential target of CAR-T therapy development for CSPG4-SON |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to CSPG4-SON |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to CSPG4-SON |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |