Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:CTNNBL1-TSHZ2

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: CTNNBL1-TSHZ2
	FusionPDB ID: 20353
	FusionGDB2.0 ID: 20353
		Hgene	Tgene
	Gene symbol	CTNNBL1	TSHZ2
	Gene ID	56259	128553
	Gene name	catenin beta like 1	teashirt zinc finger homeobox 2
	Synonyms	C20orf33\|NAP\|P14L\|PP8304\|dJ633O20.1	C20orf17\|OVC10-2\|TSH2\|ZABC2\|ZNF218
	Cytomap	20q11.23	20q13.2
	Type of gene	protein-coding	protein-coding
	Description	beta-catenin-like protein 1nuclear associated proteintestis development protein NYD-SP19	teashirt homolog 2cell growth-inhibiting protein 7ovarian cancer-related protein 10-2serologically defined colon cancer antigen 33 liketeashirt family zinc finger 2zinc finger protein 218
	Modification date	20200327	20200313
	UniProtAcc	Q8WYA6 Main function of 5'-partner protein: FUNCTION: Component of the PRP19-CDC5L complex that forms an integral part of the spliceosome and is required for activating pre-mRNA splicing. Participates in AID/AICDA-mediated Ig class switching recombination (CSR). May induce apoptosis.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000473857, ENST00000361383, ENST00000373469, ENST00000373473, ENST00000405275,	ENST00000329613, ENST00000371497, ENST00000603338,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	7 X 5 X 5=175	40 X 23 X 9=8280
	# samples	7	50
	** MAII score	log2(7/175*10)=-1.32192809488736 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(50/8280*10)=-4.0496307677246 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: CTNNBL1 [Title/Abstract] AND TSHZ2 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: CTNNBL1 [Title/Abstract] AND TSHZ2 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	CTNNBL1(36431450)-TSHZ2(51870038), # samples:1
Anticipated loss of major functional domain due to fusion event.	CTNNBL1-TSHZ2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. CTNNBL1-TSHZ2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. CTNNBL1-TSHZ2 seems lost the major protein functional domain in Hgene partner, which is a essential gene due to the frame-shifted ORF. CTNNBL1-TSHZ2 seems lost the major protein functional domain in Tgene partner, which is a essential gene due to the frame-shifted ORF. CTNNBL1-TSHZ2 seems lost the major protein functional domain in Tgene partner, which is a transcription factor due to the frame-shifted ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	CTNNBL1	GO:0043065	positive regulation of apoptotic process	12659813

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr20:36431450/chr20:51870038)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across CTNNBL1 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across TSHZ2 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000361383	CTNNBL1	chr20	36431450	+	ENST00000371497	TSHZ2	chr20	51870038	+	12590	1330	117	4394	1425
ENST00000361383	CTNNBL1	chr20	36431450	+	ENST00000603338	TSHZ2	chr20	51870038	+	4739	1330	117	4394	1425
ENST00000405275	CTNNBL1	chr20	36431450	+	ENST00000371497	TSHZ2	chr20	51870038	+	12635	1375	243	4439	1398
ENST00000405275	CTNNBL1	chr20	36431450	+	ENST00000603338	TSHZ2	chr20	51870038	+	4784	1375	243	4439	1398
ENST00000373473	CTNNBL1	chr20	36431450	+	ENST00000371497	TSHZ2	chr20	51870038	+	12158	898	246	3962	1238
ENST00000373473	CTNNBL1	chr20	36431450	+	ENST00000603338	TSHZ2	chr20	51870038	+	4307	898	246	3962	1238
ENST00000373469	CTNNBL1	chr20	36431450	+	ENST00000371497	TSHZ2	chr20	51870038	+	11795	535	78	3599	1173
ENST00000373469	CTNNBL1	chr20	36431450	+	ENST00000603338	TSHZ2	chr20	51870038	+	3944	535	78	3599	1173

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000361383	ENST00000371497	CTNNBL1	chr20	36431450	+	TSHZ2	chr20	51870038	+	0.000177349	0.9998227
ENST00000361383	ENST00000603338	CTNNBL1	chr20	36431450	+	TSHZ2	chr20	51870038	+	0.001265458	0.99873453
ENST00000405275	ENST00000371497	CTNNBL1	chr20	36431450	+	TSHZ2	chr20	51870038	+	0.00020166	0.99979836
ENST00000405275	ENST00000603338	CTNNBL1	chr20	36431450	+	TSHZ2	chr20	51870038	+	0.001342058	0.99865794
ENST00000373473	ENST00000371497	CTNNBL1	chr20	36431450	+	TSHZ2	chr20	51870038	+	0.000185812	0.9998142
ENST00000373473	ENST00000603338	CTNNBL1	chr20	36431450	+	TSHZ2	chr20	51870038	+	0.001427853	0.9985721
ENST00000373469	ENST00000371497	CTNNBL1	chr20	36431450	+	TSHZ2	chr20	51870038	+	0.000143671	0.99985635
ENST00000373469	ENST00000603338	CTNNBL1	chr20	36431450	+	TSHZ2	chr20	51870038	+	0.001297197	0.99870276

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for CTNNBL1-TSHZ2

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
CTNNBL1	chr20	36431450	TSHZ2	chr20	51870038	1330	404	KIKKVGTTEKEHEGYAQEEQLKEEEE
CTNNBL1	chr20	36431450	TSHZ2	chr20	51870038	1375	377	KIKKVGTTEKEHEGYAQEEQLKEEEE
CTNNBL1	chr20	36431450	TSHZ2	chr20	51870038	535	152	KIKKVGTTEKEHEGYAQEEQLKEEEE
CTNNBL1	chr20	36431450	TSHZ2	chr20	51870038	898	217	KIKKVGTTEKEHEGYAQEEQLKEEEE

Top

Potential FusionNeoAntigen Information of CTNNBL1-TSHZ2 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

CTNNBL1-TSHZ2_36431450_51870038.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
CTNNBL1-TSHZ2	chr20	36431450	chr20	51870038	1330	HLA-B18:01	TEKEHEGY	0.9958	0.9491	7	15
CTNNBL1-TSHZ2	chr20	36431450	chr20	51870038	1330	HLA-B45:01	TEKEHEGYA	0.9335	0.8312	7	16
CTNNBL1-TSHZ2	chr20	36431450	chr20	51870038	1330	HLA-B50:02	TEKEHEGYA	0.8842	0.57	7	16
CTNNBL1-TSHZ2	chr20	36431450	chr20	51870038	1330	HLA-B41:01	TEKEHEGYA	0.2564	0.8522	7	16
CTNNBL1-TSHZ2	chr20	36431450	chr20	51870038	1330	HLA-B50:01	TEKEHEGYA	0.0425	0.6353	7	16
CTNNBL1-TSHZ2	chr20	36431450	chr20	51870038	1330	HLA-B40:01	HEGYAQEEQL	0.9564	0.611	11	21
CTNNBL1-TSHZ2	chr20	36431450	chr20	51870038	1330	HLA-B41:02	HEGYAQEEQL	0.8459	0.5215	11	21
CTNNBL1-TSHZ2	chr20	36431450	chr20	51870038	1330	HLA-B39:13	HEGYAQEEQL	0.6453	0.9861	11	21
CTNNBL1-TSHZ2	chr20	36431450	chr20	51870038	1330	HLA-B39:01	EHEGYAQEEQL	0.9977	0.9149	10	21
CTNNBL1-TSHZ2	chr20	36431450	chr20	51870038	1330	HLA-B38:01	EHEGYAQEEQL	0.9965	0.9461	10	21
CTNNBL1-TSHZ2	chr20	36431450	chr20	51870038	1330	HLA-B39:24	EHEGYAQEEQL	0.9962	0.709	10	21
CTNNBL1-TSHZ2	chr20	36431450	chr20	51870038	1330	HLA-B38:02	EHEGYAQEEQL	0.9952	0.9466	10	21
CTNNBL1-TSHZ2	chr20	36431450	chr20	51870038	1330	HLA-B40:06	TEKEHEGYA	0.9524	0.6297	7	16
CTNNBL1-TSHZ2	chr20	36431450	chr20	51870038	1330	HLA-B48:03	HEGYAQEEQL	0.8804	0.6897	11	21
CTNNBL1-TSHZ2	chr20	36431450	chr20	51870038	1330	HLA-B39:09	EHEGYAQEEQL	0.9972	0.8428	10	21
CTNNBL1-TSHZ2	chr20	36431450	chr20	51870038	1330	HLA-B39:05	EHEGYAQEEQL	0.9961	0.9065	10	21
CTNNBL1-TSHZ2	chr20	36431450	chr20	51870038	1330	HLA-B18:08	TEKEHEGY	0.9964	0.7893	7	15
CTNNBL1-TSHZ2	chr20	36431450	chr20	51870038	1330	HLA-B18:04	TEKEHEGY	0.996	0.9517	7	15
CTNNBL1-TSHZ2	chr20	36431450	chr20	51870038	1330	HLA-B18:05	TEKEHEGY	0.9958	0.9491	7	15
CTNNBL1-TSHZ2	chr20	36431450	chr20	51870038	1330	HLA-B18:06	TEKEHEGY	0.9948	0.9513	7	15
CTNNBL1-TSHZ2	chr20	36431450	chr20	51870038	1330	HLA-B18:03	TEKEHEGY	0.9942	0.9442	7	15
CTNNBL1-TSHZ2	chr20	36431450	chr20	51870038	1330	HLA-B18:11	TEKEHEGY	0.9909	0.9157	7	15
CTNNBL1-TSHZ2	chr20	36431450	chr20	51870038	1330	HLA-B50:04	TEKEHEGYA	0.0425	0.6353	7	16
CTNNBL1-TSHZ2	chr20	36431450	chr20	51870038	1330	HLA-B50:05	TEKEHEGYA	0.0425	0.6353	7	16
CTNNBL1-TSHZ2	chr20	36431450	chr20	51870038	1330	HLA-B40:04	HEGYAQEEQL	0.9739	0.8808	11	21
CTNNBL1-TSHZ2	chr20	36431450	chr20	51870038	1330	HLA-B40:36	HEGYAQEEQL	0.9597	0.6127	11	21
CTNNBL1-TSHZ2	chr20	36431450	chr20	51870038	1330	HLA-B40:49	HEGYAQEEQL	0.9486	0.6307	11	21
CTNNBL1-TSHZ2	chr20	36431450	chr20	51870038	1330	HLA-B40:12	HEGYAQEEQL	0.8804	0.6897	11	21
CTNNBL1-TSHZ2	chr20	36431450	chr20	51870038	1330	HLA-B41:03	HEGYAQEEQL	0.6413	0.9287	11	21
CTNNBL1-TSHZ2	chr20	36431450	chr20	51870038	1330	HLA-B39:31	EHEGYAQEEQL	0.9982	0.9138	10	21
CTNNBL1-TSHZ2	chr20	36431450	chr20	51870038	1330	HLA-B38:05	EHEGYAQEEQL	0.9965	0.9461	10	21
CTNNBL1-TSHZ2	chr20	36431450	chr20	51870038	1330	HLA-B39:11	EHEGYAQEEQL	0.9945	0.7896	10	21
CTNNBL1-TSHZ2	chr20	36431450	chr20	51870038	1330	HLA-B15:09	EHEGYAQEEQL	0.974	0.7896	10	21

Top

Potential FusionNeoAntigen Information of CTNNBL1-TSHZ2 in HLA II

CTNNBL1-TSHZ2_36431450_51870038.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
CTNNBL1-TSHZ2	chr20	36431450	chr20	51870038	1330	DRB1-0840	HEGYAQEEQLKEEEE	11	26
CTNNBL1-TSHZ2	chr20	36431450	chr20	51870038	1330	DRB1-0840	EHEGYAQEEQLKEEE	10	25
CTNNBL1-TSHZ2	chr20	36431450	chr20	51870038	1330	DRB1-13101	HEGYAQEEQLKEEEE	11	26
CTNNBL1-TSHZ2	chr20	36431450	chr20	51870038	1330	DRB1-13101	EHEGYAQEEQLKEEE	10	25
CTNNBL1-TSHZ2	chr20	36431450	chr20	51870038	1330	DRB1-1310	HEGYAQEEQLKEEEE	11	26
CTNNBL1-TSHZ2	chr20	36431450	chr20	51870038	1330	DRB1-1310	EHEGYAQEEQLKEEE	10	25
CTNNBL1-TSHZ2	chr20	36431450	chr20	51870038	1330	DRB1-1388	HEGYAQEEQLKEEEE	11	26

Top

Fusion breakpoint peptide structures of CTNNBL1-TSHZ2

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
9685	TTEKEHEGYAQEEQ	CTNNBL1	TSHZ2	chr20	36431450	chr20	51870038	1330

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of CTNNBL1-TSHZ2

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	9685	TTEKEHEGYAQEEQ	-7.9962	-8.1096
HLA-B14:02	3BVN	9685	TTEKEHEGYAQEEQ	-5.70842	-6.74372
HLA-B52:01	3W39	9685	TTEKEHEGYAQEEQ	-6.83737	-6.95077
HLA-B52:01	3W39	9685	TTEKEHEGYAQEEQ	-4.4836	-5.5189
HLA-A11:01	4UQ2	9685	TTEKEHEGYAQEEQ	-10.0067	-10.1201
HLA-A11:01	4UQ2	9685	TTEKEHEGYAQEEQ	-9.03915	-10.0745
HLA-A24:02	5HGA	9685	TTEKEHEGYAQEEQ	-6.56204	-6.67544
HLA-A24:02	5HGA	9685	TTEKEHEGYAQEEQ	-5.42271	-6.45801
HLA-B44:05	3DX8	9685	TTEKEHEGYAQEEQ	-7.85648	-8.89178
HLA-B44:05	3DX8	9685	TTEKEHEGYAQEEQ	-5.3978	-5.5112
HLA-A02:01	6TDR	9685	TTEKEHEGYAQEEQ	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of CTNNBL1-TSHZ2

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
CTNNBL1-TSHZ2	chr20	36431450	chr20	51870038	10	21	EHEGYAQEEQL	AACATGAAGGCTACGCCCAGGAGGAACAGCTGA
CTNNBL1-TSHZ2	chr20	36431450	chr20	51870038	11	21	HEGYAQEEQL	ATGAAGGCTACGCCCAGGAGGAACAGCTGA
CTNNBL1-TSHZ2	chr20	36431450	chr20	51870038	7	15	TEKEHEGY	CTGAGAAGGAACATGAAGGCTACG
CTNNBL1-TSHZ2	chr20	36431450	chr20	51870038	7	16	TEKEHEGYA	CTGAGAAGGAACATGAAGGCTACGCCC

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
CTNNBL1-TSHZ2	chr20	36431450	chr20	51870038	10	25	EHEGYAQEEQLKEEE	AACATGAAGGCTACGCCCAGGAGGAACAGCTGAAAGAAGAGGAGG
CTNNBL1-TSHZ2	chr20	36431450	chr20	51870038	11	26	HEGYAQEEQLKEEEE	ATGAAGGCTACGCCCAGGAGGAACAGCTGAAAGAAGAGGAGGAAA

Top

Information of the samples that have these potential fusion neoantigens of CTNNBL1-TSHZ2

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
BRCA	CTNNBL1-TSHZ2	chr20	36431450	ENST00000361383	chr20	51870038	ENST00000371497	TCGA-AO-A03M-01B

Top

Potential target of CAR-T therapy development for CTNNBL1-TSHZ2

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to CTNNBL1-TSHZ2

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to CTNNBL1-TSHZ2

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)