![]() |
|||||||
|
Fusion Protein:ADAMTS9-CHL1 |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: ADAMTS9-CHL1 | FusionPDB ID: 2112 | FusionGDB2.0 ID: 2112 | Hgene | Tgene | Gene symbol | ADAMTS9 | CHL1 | Gene ID | 56999 | 10752 |
Gene name | ADAM metallopeptidase with thrombospondin type 1 motif 9 | cell adhesion molecule L1 like | |
Synonyms | - | CALL|L1CAM2 | |
Cytomap | 3p14.1 | 3p26.3 | |
Type of gene | protein-coding | protein-coding | |
Description | A disintegrin and metalloproteinase with thrombospondin motifs 9a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 9 | neural cell adhesion molecule L1-like proteinL1 cell adhesion molecule 2cell adhesion molecule with homology to L1CAM (close homolog of L1)cell adhesion molecule with homology to L1CAM (close homologue of L1)close homolog of L1 | |
Modification date | 20200313 | 20200313 | |
UniProtAcc | Q9P2N4 Main function of 5'-partner protein: FUNCTION: Cleaves the large aggregating proteoglycans, aggrecan (at the '1838-Glu-|-Ala-1839' site) and versican (at the '1428-Glu-|-Ala-1429' site). Has a protease-independent function in promoting the transport from the endoplasmic reticulum to the Golgi apparatus of a variety of secretory cargos. {ECO:0000269|PubMed:12514189, ECO:0000269|PubMed:22419820}. | O00533 Main function of 5'-partner protein: FUNCTION: Extracellular matrix and cell adhesion protein that plays a role in nervous system development and in synaptic plasticity. Both soluble and membranous forms promote neurite outgrowth of cerebellar and hippocampal neurons and suppress neuronal cell death. Plays a role in neuronal positioning of pyramidal neurons and in regulation of both the number of interneurons and the efficacy of GABAergic synapses. May play a role in regulating cell migration in nerve regeneration and cortical development. Potentiates integrin-dependent cell migration towards extracellular matrix proteins. Recruits ANK3 to the plasma membrane (By similarity). {ECO:0000250}. | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000295903, ENST00000498707, ENST00000459780, ENST00000467257, | ENST00000489224, ENST00000256509, ENST00000397491, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 7 X 7 X 5=245 | 5 X 7 X 4=140 |
# samples | 7 | 6 | |
** MAII score | log2(7/245*10)=-1.8073549220576 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(6/140*10)=-1.22239242133645 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
Fusion gene context | PubMed: ADAMTS9 [Title/Abstract] AND CHL1 [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: ADAMTS9 [Title/Abstract] AND CHL1 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | ADAMTS9(64619374)-CHL1(447178), # samples:1 | ||
Anticipated loss of major functional domain due to fusion event. | ADAMTS9-CHL1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ADAMTS9-CHL1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ADAMTS9-CHL1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. ADAMTS9-CHL1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. ADAMTS9-CHL1 seems lost the major protein functional domain in Hgene partner, which is a essential gene due to the frame-shifted ORF. ADAMTS9-CHL1 seems lost the major protein functional domain in Hgene partner, which is a IUPHAR drug target due to the frame-shifted ORF. ADAMTS9-CHL1 seems lost the major protein functional domain in Hgene partner, which is a tumor suppressor due to the frame-shifted ORF. ADAMTS9-CHL1 seems lost the major protein functional domain in Tgene partner, which is a essential gene due to the frame-shifted ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
Hgene | ADAMTS9 | GO:0006508 | proteolysis | 12514189 |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr3:64619374/chr3:447178) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000295903 | ADAMTS9 | chr3 | 64619374 | - | ENST00000397491 | CHL1 | chr3 | 447178 | + | 3334 | 1976 | 22 | 2058 | 678 |
ENST00000498707 | ADAMTS9 | chr3 | 64619374 | - | ENST00000397491 | CHL1 | chr3 | 447178 | + | 3739 | 2381 | 343 | 2463 | 706 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000295903 | ENST00000397491 | ADAMTS9 | chr3 | 64619374 | - | CHL1 | chr3 | 447178 | + | 0.001506127 | 0.9984939 |
ENST00000498707 | ENST00000397491 | ADAMTS9 | chr3 | 64619374 | - | CHL1 | chr3 | 447178 | + | 0.001506383 | 0.99849355 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for ADAMTS9-CHL1 |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
ADAMTS9 | chr3 | 64619374 | CHL1 | chr3 | 447178 | 1976 | 652 | LPNVRWVPKYSGMTVMKSLSKEAFGP |
ADAMTS9 | chr3 | 64619374 | CHL1 | chr3 | 447178 | 2381 | 680 | LPNVRWVPKYSGMTVMKSLSKEAFGP |
Top |
Potential FusionNeoAntigen Information of ADAMTS9-CHL1 in HLA I |
![]() |
ADAMTS9-CHL1_64619374_447178.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
ADAMTS9-CHL1 | chr3 | 64619374 | chr3 | 447178 | 1976 | HLA-B08:09 | VPKYSGMTV | 0.9011 | 0.5186 | 6 | 15 |
ADAMTS9-CHL1 | chr3 | 64619374 | chr3 | 447178 | 1976 | HLA-B35:01 | VPKYSGMTVM | 0.8683 | 0.7436 | 6 | 16 |
ADAMTS9-CHL1 | chr3 | 64619374 | chr3 | 447178 | 1976 | HLA-B35:03 | VPKYSGMTVM | 0.8182 | 0.747 | 6 | 16 |
ADAMTS9-CHL1 | chr3 | 64619374 | chr3 | 447178 | 1976 | HLA-B35:04 | VPKYSGMTVM | 0.5452 | 0.8351 | 6 | 16 |
ADAMTS9-CHL1 | chr3 | 64619374 | chr3 | 447178 | 1976 | HLA-B35:02 | VPKYSGMTVM | 0.5452 | 0.8351 | 6 | 16 |
ADAMTS9-CHL1 | chr3 | 64619374 | chr3 | 447178 | 1976 | HLA-B51:07 | VPKYSGMTV | 0.9353 | 0.567 | 6 | 15 |
ADAMTS9-CHL1 | chr3 | 64619374 | chr3 | 447178 | 1976 | HLA-B39:10 | VPKYSGMTV | 0.1228 | 0.8279 | 6 | 15 |
ADAMTS9-CHL1 | chr3 | 64619374 | chr3 | 447178 | 1976 | HLA-B39:10 | VPKYSGMTVM | 0.6192 | 0.8419 | 6 | 16 |
ADAMTS9-CHL1 | chr3 | 64619374 | chr3 | 447178 | 1976 | HLA-B35:12 | VPKYSGMTVM | 0.5452 | 0.8351 | 6 | 16 |
ADAMTS9-CHL1 | chr3 | 64619374 | chr3 | 447178 | 1976 | HLA-B42:01 | RWVPKYSGMTV | 0.9619 | 0.6243 | 4 | 15 |
ADAMTS9-CHL1 | chr3 | 64619374 | chr3 | 447178 | 1976 | HLA-C14:02 | KYSGMTVM | 0.8595 | 0.9128 | 8 | 16 |
ADAMTS9-CHL1 | chr3 | 64619374 | chr3 | 447178 | 1976 | HLA-C14:03 | KYSGMTVM | 0.8595 | 0.9128 | 8 | 16 |
ADAMTS9-CHL1 | chr3 | 64619374 | chr3 | 447178 | 1976 | HLA-C03:05 | SGMTVMKSL | 0.9963 | 0.8037 | 10 | 19 |
ADAMTS9-CHL1 | chr3 | 64619374 | chr3 | 447178 | 1976 | HLA-A30:01 | MTVMKSLSK | 0.995 | 0.6729 | 12 | 21 |
ADAMTS9-CHL1 | chr3 | 64619374 | chr3 | 447178 | 1976 | HLA-A30:01 | KYSGMTVMK | 0.9285 | 0.6662 | 8 | 17 |
ADAMTS9-CHL1 | chr3 | 64619374 | chr3 | 447178 | 1976 | HLA-B07:13 | SGMTVMKSL | 0.4646 | 0.6843 | 10 | 19 |
ADAMTS9-CHL1 | chr3 | 64619374 | chr3 | 447178 | 1976 | HLA-B67:01 | VPKYSGMTV | 0.2076 | 0.7124 | 6 | 15 |
ADAMTS9-CHL1 | chr3 | 64619374 | chr3 | 447178 | 1976 | HLA-B15:11 | VPKYSGMTVM | 0.9261 | 0.7327 | 6 | 16 |
ADAMTS9-CHL1 | chr3 | 64619374 | chr3 | 447178 | 1976 | HLA-B15:08 | VPKYSGMTVM | 0.926 | 0.726 | 6 | 16 |
ADAMTS9-CHL1 | chr3 | 64619374 | chr3 | 447178 | 1976 | HLA-B35:43 | VPKYSGMTVM | 0.9256 | 0.7219 | 6 | 16 |
ADAMTS9-CHL1 | chr3 | 64619374 | chr3 | 447178 | 1976 | HLA-B35:23 | VPKYSGMTVM | 0.8717 | 0.6973 | 6 | 16 |
ADAMTS9-CHL1 | chr3 | 64619374 | chr3 | 447178 | 1976 | HLA-B35:77 | VPKYSGMTVM | 0.8683 | 0.7436 | 6 | 16 |
ADAMTS9-CHL1 | chr3 | 64619374 | chr3 | 447178 | 1976 | HLA-B35:30 | VPKYSGMTVM | 0.813 | 0.5294 | 6 | 16 |
ADAMTS9-CHL1 | chr3 | 64619374 | chr3 | 447178 | 1976 | HLA-B35:17 | VPKYSGMTVM | 0.813 | 0.5294 | 6 | 16 |
ADAMTS9-CHL1 | chr3 | 64619374 | chr3 | 447178 | 1976 | HLA-B35:11 | VPKYSGMTVM | 0.7986 | 0.7672 | 6 | 16 |
ADAMTS9-CHL1 | chr3 | 64619374 | chr3 | 447178 | 1976 | HLA-B35:13 | VPKYSGMTVM | 0.7901 | 0.7552 | 6 | 16 |
ADAMTS9-CHL1 | chr3 | 64619374 | chr3 | 447178 | 1976 | HLA-B67:01 | VPKYSGMTVM | 0.598 | 0.7106 | 6 | 16 |
ADAMTS9-CHL1 | chr3 | 64619374 | chr3 | 447178 | 1976 | HLA-B35:09 | VPKYSGMTVM | 0.5452 | 0.8351 | 6 | 16 |
ADAMTS9-CHL1 | chr3 | 64619374 | chr3 | 447178 | 1976 | HLA-B78:02 | VPKYSGMTVM | 0.5192 | 0.5403 | 6 | 16 |
ADAMTS9-CHL1 | chr3 | 64619374 | chr3 | 447178 | 1976 | HLA-B07:09 | RWVPKYSGMTV | 0.9268 | 0.5101 | 4 | 15 |
Top |
Potential FusionNeoAntigen Information of ADAMTS9-CHL1 in HLA II |
![]() |
ADAMTS9-CHL1_64619374_447178.msa |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
ADAMTS9-CHL1 | chr3 | 64619374 | chr3 | 447178 | 1976 | DRB1-0431 | VPKYSGMTVMKSLSK | 6 | 21 |
ADAMTS9-CHL1 | chr3 | 64619374 | chr3 | 447178 | 1976 | DRB1-0443 | VPKYSGMTVMKSLSK | 6 | 21 |
ADAMTS9-CHL1 | chr3 | 64619374 | chr3 | 447178 | 1976 | DRB1-0447 | VPKYSGMTVMKSLSK | 6 | 21 |
ADAMTS9-CHL1 | chr3 | 64619374 | chr3 | 447178 | 1976 | DRB1-0454 | VPKYSGMTVMKSLSK | 6 | 21 |
ADAMTS9-CHL1 | chr3 | 64619374 | chr3 | 447178 | 1976 | DRB1-1001 | VPKYSGMTVMKSLSK | 6 | 21 |
ADAMTS9-CHL1 | chr3 | 64619374 | chr3 | 447178 | 1976 | DRB1-1003 | VPKYSGMTVMKSLSK | 6 | 21 |
ADAMTS9-CHL1 | chr3 | 64619374 | chr3 | 447178 | 1976 | DRB1-1106 | LPNVRWVPKYSGMTV | 0 | 15 |
ADAMTS9-CHL1 | chr3 | 64619374 | chr3 | 447178 | 1976 | DRB1-1147 | LPNVRWVPKYSGMTV | 0 | 15 |
ADAMTS9-CHL1 | chr3 | 64619374 | chr3 | 447178 | 1976 | DRB1-1201 | GMTVMKSLSKEAFGP | 11 | 26 |
ADAMTS9-CHL1 | chr3 | 64619374 | chr3 | 447178 | 1976 | DRB1-1203 | GMTVMKSLSKEAFGP | 11 | 26 |
ADAMTS9-CHL1 | chr3 | 64619374 | chr3 | 447178 | 1976 | DRB1-1205 | GMTVMKSLSKEAFGP | 11 | 26 |
ADAMTS9-CHL1 | chr3 | 64619374 | chr3 | 447178 | 1976 | DRB1-1206 | GMTVMKSLSKEAFGP | 11 | 26 |
ADAMTS9-CHL1 | chr3 | 64619374 | chr3 | 447178 | 1976 | DRB1-1207 | GMTVMKSLSKEAFGP | 11 | 26 |
ADAMTS9-CHL1 | chr3 | 64619374 | chr3 | 447178 | 1976 | DRB1-1208 | GMTVMKSLSKEAFGP | 11 | 26 |
ADAMTS9-CHL1 | chr3 | 64619374 | chr3 | 447178 | 1976 | DRB1-1210 | GMTVMKSLSKEAFGP | 11 | 26 |
ADAMTS9-CHL1 | chr3 | 64619374 | chr3 | 447178 | 1976 | DRB1-1211 | GMTVMKSLSKEAFGP | 11 | 26 |
ADAMTS9-CHL1 | chr3 | 64619374 | chr3 | 447178 | 1976 | DRB1-1212 | GMTVMKSLSKEAFGP | 11 | 26 |
ADAMTS9-CHL1 | chr3 | 64619374 | chr3 | 447178 | 1976 | DRB1-1214 | GMTVMKSLSKEAFGP | 11 | 26 |
ADAMTS9-CHL1 | chr3 | 64619374 | chr3 | 447178 | 1976 | DRB1-1217 | GMTVMKSLSKEAFGP | 11 | 26 |
ADAMTS9-CHL1 | chr3 | 64619374 | chr3 | 447178 | 1976 | DRB1-1220 | GMTVMKSLSKEAFGP | 11 | 26 |
Top |
Fusion breakpoint peptide structures of ADAMTS9-CHL1 |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
10171 | VPKYSGMTVMKSLS | ADAMTS9 | CHL1 | chr3 | 64619374 | chr3 | 447178 | 1976 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of ADAMTS9-CHL1 |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 10171 | VPKYSGMTVMKSLS | -7.9962 | -8.1096 |
HLA-B14:02 | 3BVN | 10171 | VPKYSGMTVMKSLS | -5.70842 | -6.74372 |
HLA-B52:01 | 3W39 | 10171 | VPKYSGMTVMKSLS | -6.83737 | -6.95077 |
HLA-B52:01 | 3W39 | 10171 | VPKYSGMTVMKSLS | -4.4836 | -5.5189 |
HLA-A11:01 | 4UQ2 | 10171 | VPKYSGMTVMKSLS | -10.0067 | -10.1201 |
HLA-A11:01 | 4UQ2 | 10171 | VPKYSGMTVMKSLS | -9.03915 | -10.0745 |
HLA-A24:02 | 5HGA | 10171 | VPKYSGMTVMKSLS | -6.56204 | -6.67544 |
HLA-A24:02 | 5HGA | 10171 | VPKYSGMTVMKSLS | -5.42271 | -6.45801 |
HLA-B44:05 | 3DX8 | 10171 | VPKYSGMTVMKSLS | -7.85648 | -8.89178 |
HLA-B44:05 | 3DX8 | 10171 | VPKYSGMTVMKSLS | -5.3978 | -5.5112 |
HLA-B35:01 | 1A1N | 10171 | VPKYSGMTVMKSLS | -6.27422 | -6.38762 |
HLA-B35:01 | 1A1N | 10171 | VPKYSGMTVMKSLS | -5.27424 | -6.30954 |
HLA-A02:01 | 6TDR | 10171 | VPKYSGMTVMKSLS | -3.37154 | -4.40684 |
Top |
Vaccine Design for the FusionNeoAntigens of ADAMTS9-CHL1 |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
ADAMTS9-CHL1 | chr3 | 64619374 | chr3 | 447178 | 10 | 19 | SGMTVMKSL | ACAGTGGAATGACAGTGATGAAAAGCC |
ADAMTS9-CHL1 | chr3 | 64619374 | chr3 | 447178 | 12 | 21 | MTVMKSLSK | GAATGACAGTGATGAAAAGCCTCTCAA |
ADAMTS9-CHL1 | chr3 | 64619374 | chr3 | 447178 | 4 | 15 | RWVPKYSGMTV | TGCGCTGGGTCCCTAAATACAGTGGAATGACAG |
ADAMTS9-CHL1 | chr3 | 64619374 | chr3 | 447178 | 6 | 15 | VPKYSGMTV | GGGTCCCTAAATACAGTGGAATGACAG |
ADAMTS9-CHL1 | chr3 | 64619374 | chr3 | 447178 | 6 | 16 | VPKYSGMTVM | GGGTCCCTAAATACAGTGGAATGACAGTGA |
ADAMTS9-CHL1 | chr3 | 64619374 | chr3 | 447178 | 8 | 16 | KYSGMTVM | CTAAATACAGTGGAATGACAGTGA |
ADAMTS9-CHL1 | chr3 | 64619374 | chr3 | 447178 | 8 | 17 | KYSGMTVMK | CTAAATACAGTGGAATGACAGTGATGA |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
ADAMTS9-CHL1 | chr3 | 64619374 | chr3 | 447178 | 0 | 15 | LPNVRWVPKYSGMTV | TGCTTCCCAATGTGCGCTGGGTCCCTAAATACAGTGGAATGACAG |
ADAMTS9-CHL1 | chr3 | 64619374 | chr3 | 447178 | 11 | 26 | GMTVMKSLSKEAFGP | GTGGAATGACAGTGATGAAAAGCCTCTCAAAGGAAGCCTTCGGTC |
ADAMTS9-CHL1 | chr3 | 64619374 | chr3 | 447178 | 6 | 21 | VPKYSGMTVMKSLSK | GGGTCCCTAAATACAGTGGAATGACAGTGATGAAAAGCCTCTCAA |
Top |
Information of the samples that have these potential fusion neoantigens of ADAMTS9-CHL1 |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
LUAD | ADAMTS9-CHL1 | chr3 | 64619374 | ENST00000295903 | chr3 | 447178 | ENST00000397491 | TCGA-62-8395-01A |
Top |
Potential target of CAR-T therapy development for ADAMTS9-CHL1 |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to ADAMTS9-CHL1 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to ADAMTS9-CHL1 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |