Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:DENND1B-ATP6V1G3

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: DENND1B-ATP6V1G3
	FusionPDB ID: 22209
	FusionGDB2.0 ID: 22209
		Hgene	Tgene
	Gene symbol	DENND1B	ATP6V1G3
	Gene ID	163486	127124
	Gene name	DENN domain containing 1B	ATPase H+ transporting V1 subunit G3
	Synonyms	C1ORF18\|C1orf218\|FAM31B	ATP6G3\|Vma10
	Cytomap	1q31.3	1q31.3
	Type of gene	protein-coding	protein-coding
	Description	DENN domain-containing protein 1BDENN/MADD domain containing 1Bconnecdenn 2family with sequence similarity 31, member B	V-type proton ATPase subunit G 3ATPase, H+ transporting, lysosomal (vacuolar proton pump) subunit G3ATPase, H+ transporting, lysosomal 13kDa, V1 subunit G3V-ATPase 13 kDa subunit 3V-ATPase G subunit 3V-ATPase G3 subunitV-ATPase subunit G 3vacuolar
	Modification date	20200320	20200313
	UniProtAcc	Q6P3S1 Main function of 5'-partner protein: FUNCTION: Guanine nucleotide exchange factor (GEF) for RAB35 that acts as a regulator of T-cell receptor (TCR) internalization in TH2 cells (PubMed:20154091, PubMed:20937701, PubMed:24520163, PubMed:26774822). Acts by promoting the exchange of GDP to GTP, converting inactive GDP-bound RAB35 into its active GTP-bound form (PubMed:20154091, PubMed:20937701). Plays a role in clathrin-mediated endocytosis (PubMed:20154091). Controls cytokine production in TH2 lymphocytes by controlling the rate of TCR internalization and routing to endosomes: acts by mediating clathrin-mediated endocytosis of TCR via its interaction with the adapter protein complex 2 (AP-2) and GEF activity (PubMed:26774822). Dysregulation leads to impaired TCR down-modulation and recycling, affecting cytokine production in TH2 cells (PubMed:26774822). {ECO:0000269\|PubMed:20154091, ECO:0000269\|PubMed:20937701, ECO:0000269\|PubMed:24520163, ECO:0000269\|PubMed:26774822}.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000235453, ENST00000367396, ENST00000400967, ENST00000477581,	ENST00000281087, ENST00000309309, ENST00000367381, ENST00000367382, ENST00000489986,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	13 X 7 X 7=637	2 X 2 X 2=8
	# samples	16	3
	** MAII score	log2(16/637*10)=-1.99322146736894 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(3/8*10)=1.90689059560852
Fusion gene context	PubMed: DENND1B [Title/Abstract] AND ATP6V1G3 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: DENND1B [Title/Abstract] AND ATP6V1G3 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	DENND1B(197684161)-ATP6V1G3(198498311), # samples:2
Anticipated loss of major functional domain due to fusion event.	DENND1B-ATP6V1G3 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. DENND1B-ATP6V1G3 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. DENND1B-ATP6V1G3 seems lost the major protein functional domain in Tgene partner, which is a IUPHAR drug target due to the frame-shifted ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner

Gene

GO ID

GO term

PubMed ID

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr1:197684161/chr1:198498311)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across DENND1B (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across ATP6V1G3 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000400967	DENND1B	chr1	197684161	-	ENST00000309309	ATP6V1G3	chr1	198498311	-	540	96	29	370	113
ENST00000367396	DENND1B	chr1	197684161	-	ENST00000309309	ATP6V1G3	chr1	198498311	-	740	296	334	2	111
ENST00000400967	DENND1B	chr1	197684160	-	ENST00000309309	ATP6V1G3	chr1	198498311	-	540	96	29	370	113
ENST00000367396	DENND1B	chr1	197684160	-	ENST00000309309	ATP6V1G3	chr1	198498311	-	740	296	334	2	111

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000400967	ENST00000309309	DENND1B	chr1	197684161	-	ATP6V1G3	chr1	198498311	-	0.060818814	0.9391812
ENST00000367396	ENST00000309309	DENND1B	chr1	197684161	-	ATP6V1G3	chr1	198498311	-	0.088180184	0.9118198
ENST00000400967	ENST00000309309	DENND1B	chr1	197684160	-	ATP6V1G3	chr1	198498311	-	0.060818814	0.9391812
ENST00000367396	ENST00000309309	DENND1B	chr1	197684160	-	ATP6V1G3	chr1	198498311	-	0.088180184	0.9118198

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for DENND1B-ATP6V1G3

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
DENND1B	chr1	197684160	ATP6V1G3	chr1	198498311	96	22	CGIVEIPRGLWRPGKGKRLKQAKEEA
DENND1B	chr1	197684161	ATP6V1G3	chr1	198498311	96	22	CGIVEIPRGLWRPGKGKRLKQAKEEA

Top

Potential FusionNeoAntigen Information of DENND1B-ATP6V1G3 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

DENND1B-ATP6V1G3_197684160_198498311.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
DENND1B-ATP6V1G3	chr1	197684160	chr1	198498311	96	HLA-A03:25	GLWRPGKGK	0.9945	0.5447	8	17
DENND1B-ATP6V1G3	chr1	197684160	chr1	198498311	96	HLA-A03:12	GLWRPGKGK	0.9941	0.573	8	17
DENND1B-ATP6V1G3	chr1	197684160	chr1	198498311	96	HLA-A03:12	RGLWRPGKGK	0.8793	0.5541	7	17
DENND1B-ATP6V1G3	chr1	197684160	chr1	198498311	96	HLA-A03:25	RGLWRPGKGK	0.8781	0.5184	7	17
DENND1B-ATP6V1G3	chr1	197684160	chr1	198498311	96	HLA-A74:03	RGLWRPGKGK	0.5705	0.5939	7	17
DENND1B-ATP6V1G3	chr1	197684160	chr1	198498311	96	HLA-A74:11	RGLWRPGKGK	0.5705	0.5939	7	17
DENND1B-ATP6V1G3	chr1	197684160	chr1	198498311	96	HLA-A74:09	RGLWRPGKGK	0.5705	0.5939	7	17
DENND1B-ATP6V1G3	chr1	197684160	chr1	198498311	96	HLA-A03:01	GLWRPGKGK	0.9945	0.5447	8	17
DENND1B-ATP6V1G3	chr1	197684160	chr1	198498311	96	HLA-C07:05	WRPGKGKRL	0.7878	0.9673	10	19
DENND1B-ATP6V1G3	chr1	197684160	chr1	198498311	96	HLA-C07:95	WRPGKGKRL	0.734	0.7098	10	19
DENND1B-ATP6V1G3	chr1	197684160	chr1	198498311	96	HLA-C07:27	WRPGKGKRL	0.6817	0.9698	10	19
DENND1B-ATP6V1G3	chr1	197684160	chr1	198498311	96	HLA-C07:19	WRPGKGKRL	0.6102	0.8064	10	19
DENND1B-ATP6V1G3	chr1	197684160	chr1	198498311	96	HLA-C07:67	WRPGKGKRL	0.5944	0.9644	10	19
DENND1B-ATP6V1G3	chr1	197684160	chr1	198498311	96	HLA-C07:80	WRPGKGKRL	0.5944	0.9644	10	19
DENND1B-ATP6V1G3	chr1	197684160	chr1	198498311	96	HLA-C07:10	WRPGKGKRL	0.5551	0.9626	10	19
DENND1B-ATP6V1G3	chr1	197684160	chr1	198498311	96	HLA-C07:29	WRPGKGKRL	0.5435	0.9563	10	19
DENND1B-ATP6V1G3	chr1	197684160	chr1	198498311	96	HLA-C07:13	WRPGKGKRL	0.5034	0.9719	10	19
DENND1B-ATP6V1G3	chr1	197684160	chr1	198498311	96	HLA-C07:46	WRPGKGKRL	0.5017	0.9235	10	19
DENND1B-ATP6V1G3	chr1	197684160	chr1	198498311	96	HLA-C12:16	WRPGKGKRL	0.0024	0.9752	10	19
DENND1B-ATP6V1G3	chr1	197684160	chr1	198498311	96	HLA-A03:01	RGLWRPGKGK	0.8781	0.5184	7	17
DENND1B-ATP6V1G3	chr1	197684160	chr1	198498311	96	HLA-C07:01	WRPGKGKRL	0.8042	0.7319	10	19
DENND1B-ATP6V1G3	chr1	197684160	chr1	198498311	96	HLA-C07:02	WRPGKGKRL	0.5944	0.9644	10	19
DENND1B-ATP6V1G3	chr1	197684160	chr1	198498311	96	HLA-C07:22	WRPGKGKRL	0.5508	0.7867	10	19
DENND1B-ATP6V1G3	chr1	197684160	chr1	198498311	96	HLA-C06:08	WRPGKGKRL	0.4914	0.9931	10	19
DENND1B-ATP6V1G3	chr1	197684160	chr1	198498311	96	HLA-C07:04	WRPGKGKRL	0.2957	0.9636	10	19
DENND1B-ATP6V1G3	chr1	197684160	chr1	198498311	96	HLA-C06:06	WRPGKGKRL	0.1726	0.9948	10	19
DENND1B-ATP6V1G3	chr1	197684160	chr1	198498311	96	HLA-C06:17	WRPGKGKRL	0.0034	0.9955	10	19
DENND1B-ATP6V1G3	chr1	197684160	chr1	198498311	96	HLA-C06:02	WRPGKGKRL	0.0034	0.9955	10	19
DENND1B-ATP6V1G3	chr1	197684160	chr1	198498311	96	HLA-A74:01	RGLWRPGKGK	0.5705	0.5939	7	17

Top

Potential FusionNeoAntigen Information of DENND1B-ATP6V1G3 in HLA II

DENND1B-ATP6V1G3_197684160_198498311.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
DENND1B-ATP6V1G3	chr1	197684160	chr1	198498311	96	DRB1-0103	RGLWRPGKGKRLKQA	7	22
DENND1B-ATP6V1G3	chr1	197684160	chr1	198498311	96	DRB1-0103	PRGLWRPGKGKRLKQ	6	21
DENND1B-ATP6V1G3	chr1	197684160	chr1	198498311	96	DRB1-0109	RGLWRPGKGKRLKQA	7	22

Top

Fusion breakpoint peptide structures of DENND1B-ATP6V1G3

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
6944	PRGLWRPGKGKRLK	DENND1B	ATP6V1G3	chr1	197684160	chr1	198498311	96

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of DENND1B-ATP6V1G3

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	6944	PRGLWRPGKGKRLK	-7.15543	-7.26883
HLA-B14:02	3BVN	6944	PRGLWRPGKGKRLK	-4.77435	-5.80965
HLA-B52:01	3W39	6944	PRGLWRPGKGKRLK	-6.80875	-6.92215
HLA-B52:01	3W39	6944	PRGLWRPGKGKRLK	-4.20386	-5.23916
HLA-A11:01	4UQ2	6944	PRGLWRPGKGKRLK	-7.5194	-8.5547
HLA-A11:01	4UQ2	6944	PRGLWRPGKGKRLK	-6.9601	-7.0735
HLA-A24:02	5HGA	6944	PRGLWRPGKGKRLK	-7.52403	-7.63743
HLA-A24:02	5HGA	6944	PRGLWRPGKGKRLK	-5.82433	-6.85963
HLA-B27:05	6PYJ	6944	PRGLWRPGKGKRLK	-3.28285	-4.31815
HLA-B44:05	3DX8	6944	PRGLWRPGKGKRLK	-5.91172	-6.94702
HLA-B44:05	3DX8	6944	PRGLWRPGKGKRLK	-4.24346	-4.35686

Top

Vaccine Design for the FusionNeoAntigens of DENND1B-ATP6V1G3

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
DENND1B-ATP6V1G3	chr1	197684160	chr1	198498311	10	19	WRPGKGKRL	GGAGACCAGGAAAAGGAAAGCGATTGA
DENND1B-ATP6V1G3	chr1	197684160	chr1	198498311	7	17	RGLWRPGKGK	GAGGACTTTGGAGACCAGGAAAAGGAAAGC
DENND1B-ATP6V1G3	chr1	197684160	chr1	198498311	8	17	GLWRPGKGK	GACTTTGGAGACCAGGAAAAGGAAAGC

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
DENND1B-ATP6V1G3	chr1	197684160	chr1	198498311	6	21	PRGLWRPGKGKRLKQ	CCAGAGGACTTTGGAGACCAGGAAAAGGAAAGCGATTGAAGCAAG
DENND1B-ATP6V1G3	chr1	197684160	chr1	198498311	7	22	RGLWRPGKGKRLKQA	GAGGACTTTGGAGACCAGGAAAAGGAAAGCGATTGAAGCAAGCCA

Top

Information of the samples that have these potential fusion neoantigens of DENND1B-ATP6V1G3

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
STAD	DENND1B-ATP6V1G3	chr1	197684160	ENST00000400967	chr1	198498311	ENST00000309309	TCGA-VQ-A92D

Top

Potential target of CAR-T therapy development for DENND1B-ATP6V1G3

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to DENND1B-ATP6V1G3

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to DENND1B-ATP6V1G3

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)