![]() |
|||||||
|
Fusion Protein:EZH1-FOXK2 |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: EZH1-FOXK2 | FusionPDB ID: 28092 | FusionGDB2.0 ID: 28092 | Hgene | Tgene | Gene symbol | EZH1 | FOXK2 | Gene ID | 2145 | 3607 |
Gene name | enhancer of zeste 1 polycomb repressive complex 2 subunit | forkhead box K2 | |
Synonyms | KMT6B | ILF|ILF-1|ILF1|nGTBP | |
Cytomap | 17q21.2 | 17q25.3 | |
Type of gene | protein-coding | protein-coding | |
Description | histone-lysine N-methyltransferase EZH1ENX-2enhancer of zeste homolog 1 | forkhead box protein K2FOXK1G/T-mismatch specific binding proteincellular transcription factor ILF-1interleukin enhancer-binding factor 1 | |
Modification date | 20200315 | 20200313 | |
UniProtAcc | Q92800 Main function of 5'-partner protein: FUNCTION: Polycomb group (PcG) protein. Catalytic subunit of the PRC2/EED-EZH1 complex, which methylates 'Lys-27' of histone H3, leading to transcriptional repression of the affected target gene. Able to mono-, di- and trimethylate 'Lys-27' of histone H3 to form H3K27me1, H3K27me2 and H3K27me3, respectively. Required for embryonic stem cell derivation and self-renewal, suggesting that it is involved in safeguarding embryonic stem cell identity. Compared to EZH2-containing complexes, it is less abundant in embryonic stem cells, has weak methyltransferase activity and plays a less critical role in forming H3K27me3, which is required for embryonic stem cell identity and proper differentiation. {ECO:0000269|PubMed:19026781}. | Q01167 Main function of 5'-partner protein: FUNCTION: Transcriptional regulator involved in different processes such as glucose metabolism, aerobic glycolysis and autophagy (By similarity). Recognizes and binds the forkhead DNA sequence motif (5'-GTAAACA-3') and can both act as a transcription activator or repressor, depending on the context (PubMed:22083952, PubMed:25451922). Together with FOXK1, acts as a key regulator of metabolic reprogramming towards aerobic glycolysis, a process in which glucose is converted to lactate in the presence of oxygen (By similarity). Acts by promoting expression of enzymes for glycolysis (such as hexokinase-2 (HK2), phosphofructokinase, pyruvate kinase (PKLR) and lactate dehydrogenase), while suppressing further oxidation of pyruvate in the mitochondria by up-regulating pyruvate dehydrogenase kinases PDK1 and PDK4 (By similarity). Probably plays a role in gluconeogenesis during overnight fasting, when lactate from white adipose tissue and muscle is the main substrate (By similarity). Together with FOXK1, acts as a negative regulator of autophagy in skeletal muscle: in response to starvation, enters the nucleus, binds the promoters of autophagy genes and represses their expression, preventing proteolysis of skeletal muscle proteins (By similarity). In addition to the 5'-GTAAACA-3' DNA motif, also binds the 5'-TGANTCA-3' palindromic DNA motif, and co-associates with JUN/AP-1 to activate transcription (PubMed:22083952). Also able to bind to a minimal DNA heteroduplex containing a G/T-mismatch with 5'-TRT[G/T]NB-3' sequence (PubMed:20097901). Binds to NFAT-like motifs (purine-rich) in the IL2 promoter (PubMed:1339390). Positively regulates WNT/beta-catenin signaling by translocating DVL proteins into the nucleus (PubMed:25805136). Also binds to HIV-1 long terminal repeat. May be involved in both positive and negative regulation of important viral and cellular promoter elements (PubMed:1909027). {ECO:0000250|UniProtKB:Q3UCQ1, ECO:0000269|PubMed:1339390, ECO:0000269|PubMed:1909027, ECO:0000269|PubMed:20097901, ECO:0000269|PubMed:22083952, ECO:0000269|PubMed:25451922, ECO:0000269|PubMed:25805136}. | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000415827, ENST00000428826, ENST00000435174, ENST00000585893, ENST00000590078, ENST00000592743, ENST00000590783, | ENST00000529652, ENST00000335255, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 8 X 12 X 6=576 | 10 X 15 X 9=1350 |
# samples | 12 | 16 | |
** MAII score | log2(12/576*10)=-2.26303440583379 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(16/1350*10)=-3.07681559705083 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
Fusion gene context | PubMed: EZH1 [Title/Abstract] AND FOXK2 [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: EZH1 [Title/Abstract] AND FOXK2 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | EZH1(40855757)-FOXK2(80543779), # samples:1 | ||
Anticipated loss of major functional domain due to fusion event. | EZH1-FOXK2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. EZH1-FOXK2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. EZH1-FOXK2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. EZH1-FOXK2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. EZH1-FOXK2 seems lost the major protein functional domain in Hgene partner, which is a epigenetic factor due to the frame-shifted ORF. EZH1-FOXK2 seems lost the major protein functional domain in Hgene partner, which is a IUPHAR drug target due to the frame-shifted ORF. EZH1-FOXK2 seems lost the major protein functional domain in Hgene partner, which is a tumor suppressor due to the frame-shifted ORF. EZH1-FOXK2 seems lost the major protein functional domain in Tgene partner, which is a essential gene due to the frame-shifted ORF. EZH1-FOXK2 seems lost the major protein functional domain in Tgene partner, which is a transcription factor due to the frame-shifted ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
Tgene | FOXK2 | GO:0045892 | negative regulation of transcription, DNA-templated | 20810654|25451922 |
Tgene | FOXK2 | GO:0045893 | positive regulation of transcription, DNA-templated | 22083952 |
Tgene | FOXK2 | GO:0045944 | positive regulation of transcription by RNA polymerase II | 9065434 |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr17:40855757/chr17:80543779) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000435174 | EZH1 | chr17 | 40855757 | - | ENST00000335255 | FOXK2 | chr17 | 80543779 | + | 5814 | 2002 | 321 | 2705 | 794 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000435174 | ENST00000335255 | EZH1 | chr17 | 40855757 | - | FOXK2 | chr17 | 80543779 | + | 0.00069242 | 0.99930763 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for EZH1-FOXK2 |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
EZH1 | chr17 | 40855757 | FOXK2 | chr17 | 80543779 | 2002 | 560 | FANHSVNPNCYAKGSPLSSQPVLITV |
Top |
Potential FusionNeoAntigen Information of EZH1-FOXK2 in HLA I |
![]() |
EZH1-FOXK2_40855757_80543779.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
EZH1-FOXK2 | chr17 | 40855757 | chr17 | 80543779 | 2002 | HLA-B42:02 | NPNCYAKGSPL | 0.9988 | 0.649 | 6 | 17 |
EZH1-FOXK2 | chr17 | 40855757 | chr17 | 80543779 | 2002 | HLA-B42:01 | NPNCYAKGSPL | 0.9982 | 0.6427 | 6 | 17 |
EZH1-FOXK2 | chr17 | 40855757 | chr17 | 80543779 | 2002 | HLA-B07:12 | KGSPLSSQPVL | 0.9634 | 0.5475 | 12 | 23 |
EZH1-FOXK2 | chr17 | 40855757 | chr17 | 80543779 | 2002 | HLA-C14:03 | CYAKGSPL | 0.8422 | 0.958 | 9 | 17 |
EZH1-FOXK2 | chr17 | 40855757 | chr17 | 80543779 | 2002 | HLA-C14:02 | CYAKGSPL | 0.8422 | 0.958 | 9 | 17 |
EZH1-FOXK2 | chr17 | 40855757 | chr17 | 80543779 | 2002 | HLA-B35:13 | KGSPLSSQPVL | 0.8985 | 0.8907 | 12 | 23 |
Top |
Potential FusionNeoAntigen Information of EZH1-FOXK2 in HLA II |
![]() |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of EZH1-FOXK2 |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
6318 | NPNCYAKGSPLSSQ | EZH1 | FOXK2 | chr17 | 40855757 | chr17 | 80543779 | 2002 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of EZH1-FOXK2 |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 6318 | NPNCYAKGSPLSSQ | -6.72362 | -7.75892 |
HLA-B14:02 | 3BVN | 6318 | NPNCYAKGSPLSSQ | -5.73712 | -5.85052 |
HLA-B52:01 | 3W39 | 6318 | NPNCYAKGSPLSSQ | -6.71687 | -6.83027 |
HLA-B52:01 | 3W39 | 6318 | NPNCYAKGSPLSSQ | -4.56391 | -5.59921 |
HLA-A11:01 | 4UQ2 | 6318 | NPNCYAKGSPLSSQ | -7.37924 | -8.41454 |
HLA-A24:02 | 5HGA | 6318 | NPNCYAKGSPLSSQ | -7.97234 | -8.08574 |
HLA-A24:02 | 5HGA | 6318 | NPNCYAKGSPLSSQ | -5.63622 | -6.67152 |
HLA-B44:05 | 3DX8 | 6318 | NPNCYAKGSPLSSQ | -5.58583 | -5.69923 |
HLA-B44:05 | 3DX8 | 6318 | NPNCYAKGSPLSSQ | -4.09536 | -5.13066 |
Top |
Vaccine Design for the FusionNeoAntigens of EZH1-FOXK2 |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
EZH1-FOXK2 | chr17 | 40855757 | chr17 | 80543779 | 12 | 23 | KGSPLSSQPVL | AAGGGTCACCTCTGTCCAGTCAGCCAGTCTTAA |
EZH1-FOXK2 | chr17 | 40855757 | chr17 | 80543779 | 6 | 17 | NPNCYAKGSPL | ATCCCAACTGTTATGCCAAAGGGTCACCTCTGT |
EZH1-FOXK2 | chr17 | 40855757 | chr17 | 80543779 | 9 | 17 | CYAKGSPL | GTTATGCCAAAGGGTCACCTCTGT |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of EZH1-FOXK2 |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
ESCA | EZH1-FOXK2 | chr17 | 40855757 | ENST00000435174 | chr17 | 80543779 | ENST00000335255 | TCGA-LN-A9FO |
Top |
Potential target of CAR-T therapy development for EZH1-FOXK2 |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to EZH1-FOXK2 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to EZH1-FOXK2 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |