|
|||||||
|
Fusion Protein:EZH1-FOXK2 |
Fusion Gene and Fusion Protein Summary |
 Fusion gene summary |
| Fusion partner gene information | Fusion gene name: EZH1-FOXK2 | FusionPDB ID: 28092 | FusionGDB2.0 ID: 28092 | Hgene | Tgene | Gene symbol | EZH1 | FOXK2 | Gene ID | 2145 | 3607 |
| Gene name | enhancer of zeste 1 polycomb repressive complex 2 subunit | forkhead box K2 | |
| Synonyms | KMT6B | ILF|ILF-1|ILF1|nGTBP | |
| Cytomap | 17q21.2 | 17q25.3 | |
| Type of gene | protein-coding | protein-coding | |
| Description | histone-lysine N-methyltransferase EZH1ENX-2enhancer of zeste homolog 1 | forkhead box protein K2FOXK1G/T-mismatch specific binding proteincellular transcription factor ILF-1interleukin enhancer-binding factor 1 | |
| Modification date | 20200315 | 20200313 | |
| UniProtAcc | Q92800 Main function of 5'-partner protein: FUNCTION: Polycomb group (PcG) protein. Catalytic subunit of the PRC2/EED-EZH1 complex, which methylates 'Lys-27' of histone H3, leading to transcriptional repression of the affected target gene. Able to mono-, di- and trimethylate 'Lys-27' of histone H3 to form H3K27me1, H3K27me2 and H3K27me3, respectively. Required for embryonic stem cell derivation and self-renewal, suggesting that it is involved in safeguarding embryonic stem cell identity. Compared to EZH2-containing complexes, it is less abundant in embryonic stem cells, has weak methyltransferase activity and plays a less critical role in forming H3K27me3, which is required for embryonic stem cell identity and proper differentiation. {ECO:0000269|PubMed:19026781}. | Q01167 Main function of 5'-partner protein: FUNCTION: Transcriptional regulator involved in different processes such as glucose metabolism, aerobic glycolysis and autophagy (By similarity). Recognizes and binds the forkhead DNA sequence motif (5'-GTAAACA-3') and can both act as a transcription activator or repressor, depending on the context (PubMed:22083952, PubMed:25451922). Together with FOXK1, acts as a key regulator of metabolic reprogramming towards aerobic glycolysis, a process in which glucose is converted to lactate in the presence of oxygen (By similarity). Acts by promoting expression of enzymes for glycolysis (such as hexokinase-2 (HK2), phosphofructokinase, pyruvate kinase (PKLR) and lactate dehydrogenase), while suppressing further oxidation of pyruvate in the mitochondria by up-regulating pyruvate dehydrogenase kinases PDK1 and PDK4 (By similarity). Probably plays a role in gluconeogenesis during overnight fasting, when lactate from white adipose tissue and muscle is the main substrate (By similarity). Together with FOXK1, acts as a negative regulator of autophagy in skeletal muscle: in response to starvation, enters the nucleus, binds the promoters of autophagy genes and represses their expression, preventing proteolysis of skeletal muscle proteins (By similarity). In addition to the 5'-GTAAACA-3' DNA motif, also binds the 5'-TGANTCA-3' palindromic DNA motif, and co-associates with JUN/AP-1 to activate transcription (PubMed:22083952). Also able to bind to a minimal DNA heteroduplex containing a G/T-mismatch with 5'-TRT[G/T]NB-3' sequence (PubMed:20097901). Binds to NFAT-like motifs (purine-rich) in the IL2 promoter (PubMed:1339390). Positively regulates WNT/beta-catenin signaling by translocating DVL proteins into the nucleus (PubMed:25805136). Also binds to HIV-1 long terminal repeat. May be involved in both positive and negative regulation of important viral and cellular promoter elements (PubMed:1909027). {ECO:0000250|UniProtKB:Q3UCQ1, ECO:0000269|PubMed:1339390, ECO:0000269|PubMed:1909027, ECO:0000269|PubMed:20097901, ECO:0000269|PubMed:22083952, ECO:0000269|PubMed:25451922, ECO:0000269|PubMed:25805136}. | |
| Ensembl transtripts involved in fusion gene | ENST ids | ENST00000415827, ENST00000428826, ENST00000435174, ENST00000585893, ENST00000590078, ENST00000592743, ENST00000590783, | ENST00000529652, ENST00000335255, |
| Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 8 X 12 X 6=576 | 10 X 15 X 9=1350 |
| # samples | 12 | 16 | |
| ** MAII score | log2(12/576*10)=-2.26303440583379 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(16/1350*10)=-3.07681559705083 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
| Fusion gene context | PubMed: EZH1 [Title/Abstract] AND FOXK2 [Title/Abstract] AND fusion [Title/Abstract] | ||
| Fusion neoantigen context | PubMed: EZH1 [Title/Abstract] AND FOXK2 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
| Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | EZH1(40855757)-FOXK2(80543779), # samples:1 | ||
| Anticipated loss of major functional domain due to fusion event. | EZH1-FOXK2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. EZH1-FOXK2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. EZH1-FOXK2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. EZH1-FOXK2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. EZH1-FOXK2 seems lost the major protein functional domain in Hgene partner, which is a epigenetic factor due to the frame-shifted ORF. EZH1-FOXK2 seems lost the major protein functional domain in Hgene partner, which is a IUPHAR drug target due to the frame-shifted ORF. EZH1-FOXK2 seems lost the major protein functional domain in Hgene partner, which is a tumor suppressor due to the frame-shifted ORF. EZH1-FOXK2 seems lost the major protein functional domain in Tgene partner, which is a essential gene due to the frame-shifted ORF. EZH1-FOXK2 seems lost the major protein functional domain in Tgene partner, which is a transcription factor due to the frame-shifted ORF. | ||
| * DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
| Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Partner | Gene | GO ID | GO term | PubMed ID |
| Tgene | FOXK2 | GO:0045892 | negative regulation of transcription, DNA-templated | 20810654|25451922 |
| Tgene | FOXK2 | GO:0045893 | positive regulation of transcription, DNA-templated | 22083952 |
| Tgene | FOXK2 | GO:0045944 | positive regulation of transcription by RNA polymerase II | 9065434 |
| Four levels of functional features of fusion genes Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr17:40855757/chr17:80543779) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
 |
| Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here. |
| Fusion gene breakpoints across EZH1 (5'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
| Fusion gene breakpoints across FOXK2 (3'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Fusion Amino Acid Sequences |
| Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
| ENST00000435174 | EZH1 | chr17 | 40855757 | - | ENST00000335255 | FOXK2 | chr17 | 80543779 | + | 5814 | 2002 | 321 | 2705 | 794 |
| DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
| ENST00000435174 | ENST00000335255 | EZH1 | chr17 | 40855757 | - | FOXK2 | chr17 | 80543779 | + | 0.00069242 | 0.99930763 |
| Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones. |
Get the fusion protein sequences from here. |
| Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for EZH1-FOXK2 |
| +/-13 AA sequence from the breakpoints of the fusion protein sequences. |
| Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
| EZH1 | chr17 | 40855757 | FOXK2 | chr17 | 80543779 | 2002 | 560 | FANHSVNPNCYAKGSPLSSQPVLITV |
Top |
Potential FusionNeoAntigen Information of EZH1-FOXK2 in HLA I |
| Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| EZH1-FOXK2_40855757_80543779.msa |
| Potential FusionNeoAntigen Information * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
| EZH1-FOXK2 | chr17 | 40855757 | chr17 | 80543779 | 2002 | HLA-B42:02 | NPNCYAKGSPL | 0.9988 | 0.649 | 6 | 17 |
| EZH1-FOXK2 | chr17 | 40855757 | chr17 | 80543779 | 2002 | HLA-B42:01 | NPNCYAKGSPL | 0.9982 | 0.6427 | 6 | 17 |
| EZH1-FOXK2 | chr17 | 40855757 | chr17 | 80543779 | 2002 | HLA-B07:12 | KGSPLSSQPVL | 0.9634 | 0.5475 | 12 | 23 |
| EZH1-FOXK2 | chr17 | 40855757 | chr17 | 80543779 | 2002 | HLA-C14:03 | CYAKGSPL | 0.8422 | 0.958 | 9 | 17 |
| EZH1-FOXK2 | chr17 | 40855757 | chr17 | 80543779 | 2002 | HLA-C14:02 | CYAKGSPL | 0.8422 | 0.958 | 9 | 17 |
| EZH1-FOXK2 | chr17 | 40855757 | chr17 | 80543779 | 2002 | HLA-B35:13 | KGSPLSSQPVL | 0.8985 | 0.8907 | 12 | 23 |
Top |
Potential FusionNeoAntigen Information of EZH1-FOXK2 in HLA II |
| Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| Potential FusionNeoAntigen Information * We used NetMHCIIpan v4.1 (%rank<0.5). |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of EZH1-FOXK2 |
| 3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
| File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
| 6318 | NPNCYAKGSPLSSQ | EZH1 | FOXK2 | chr17 | 40855757 | chr17 | 80543779 | 2002 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of EZH1-FOXK2 |
| Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens * We used Glide to predict the interaction between HLAs and neoantigens. |
| HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
| HLA-B14:02 | 3BVN | 6318 | NPNCYAKGSPLSSQ | -6.72362 | -7.75892 |
| HLA-B14:02 | 3BVN | 6318 | NPNCYAKGSPLSSQ | -5.73712 | -5.85052 |
| HLA-B52:01 | 3W39 | 6318 | NPNCYAKGSPLSSQ | -6.71687 | -6.83027 |
| HLA-B52:01 | 3W39 | 6318 | NPNCYAKGSPLSSQ | -4.56391 | -5.59921 |
| HLA-A11:01 | 4UQ2 | 6318 | NPNCYAKGSPLSSQ | -7.37924 | -8.41454 |
| HLA-A24:02 | 5HGA | 6318 | NPNCYAKGSPLSSQ | -7.97234 | -8.08574 |
| HLA-A24:02 | 5HGA | 6318 | NPNCYAKGSPLSSQ | -5.63622 | -6.67152 |
| HLA-B44:05 | 3DX8 | 6318 | NPNCYAKGSPLSSQ | -5.58583 | -5.69923 |
| HLA-B44:05 | 3DX8 | 6318 | NPNCYAKGSPLSSQ | -4.09536 | -5.13066 |
Top |
Vaccine Design for the FusionNeoAntigens of EZH1-FOXK2 |
| mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
| EZH1-FOXK2 | chr17 | 40855757 | chr17 | 80543779 | 12 | 23 | KGSPLSSQPVL | AAGGGTCACCTCTGTCCAGTCAGCCAGTCTTAA |
| EZH1-FOXK2 | chr17 | 40855757 | chr17 | 80543779 | 6 | 17 | NPNCYAKGSPL | ATCCCAACTGTTATGCCAAAGGGTCACCTCTGT |
| EZH1-FOXK2 | chr17 | 40855757 | chr17 | 80543779 | 9 | 17 | CYAKGSPL | GTTATGCCAAAGGGTCACCTCTGT |
| mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of EZH1-FOXK2 |
| These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens. |
| Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
| ESCA | EZH1-FOXK2 | chr17 | 40855757 | ENST00000435174 | chr17 | 80543779 | ENST00000335255 | TCGA-LN-A9FO |
Top |
Potential target of CAR-T therapy development for EZH1-FOXK2 |
| Predicted 3D structure. We used RoseTTAFold. |
| Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features * Minus value of BPloci means that the break point is located before the CDS. |
| - In-frame and retained 'Transmembrane'. |
| Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
| Subcellular localization prediction of the transmembrane domain retained fusion proteins * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
| Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to EZH1-FOXK2 |
| Drugs used for this fusion-positive patient. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to EZH1-FOXK2 |
| Diseases that have this fusion gene. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Disease | Source | PMID |
| Diseases associated with fusion partners. (DisGeNet 4.0) |
| Partner | Gene | Disease ID | Disease name | # pubmeds | Source |
Copyright 2023-PresentThe University of Texas Health Science Center at Houston (UTHealth)
Web File Viewing | Emergency Information
Campus Carry|Site Policies