|
|||||||
|
Fusion Protein:FGD4-LRRK2 |
Fusion Gene and Fusion Protein Summary |
 Fusion gene summary |
| Fusion partner gene information | Fusion gene name: FGD4-LRRK2 | FusionPDB ID: 30168 | FusionGDB2.0 ID: 30168 | Hgene | Tgene | Gene symbol | FGD4 | LRRK2 | Gene ID | 121512 | 120892 |
| Gene name | FYVE, RhoGEF and PH domain containing 4 | leucine rich repeat kinase 2 | |
| Synonyms | CMT4H|FRABP|ZFYVE6 | AURA17|DARDARIN|PARK8|RIPK7|ROCO2 | |
| Cytomap | 12p11.21 | 12q12 | |
| Type of gene | protein-coding | protein-coding | |
| Description | FYVE, RhoGEF and PH domain-containing protein 4FGD1 family, member 4FGD1-related F-actin-binding proteinactin-filament binding protein frabinzinc finger FYVE domain-containing protein 6 | leucine-rich repeat serine/threonine-protein kinase 2augmented in rheumatoid arthritis 17 | |
| Modification date | 20200328 | 20200329 | |
| UniProtAcc | Q96M96 Main function of 5'-partner protein: FUNCTION: Activates CDC42, a member of the Ras-like family of Rho- and Rac proteins, by exchanging bound GDP for free GTP. Plays a role in regulating the actin cytoskeleton and cell shape. Activates MAPK8 (By similarity). {ECO:0000250, ECO:0000269|PubMed:15133042}. | Q5S007 Main function of 5'-partner protein: FUNCTION: Serine/threonine-protein kinase which phosphorylates a broad range of proteins involved in multiple processes such as neuronal plasticity, autophagy, and vesicle trafficking (PubMed:20949042, PubMed:22012985, PubMed:26824392, PubMed:29125462, PubMed:28720718, PubMed:29127255, PubMed:30398148, PubMed:29212815, PubMed:30635421, PubMed:21850687, PubMed:23395371, PubMed:17114044, PubMed:24687852, PubMed:26014385, PubMed:25201882). Is a key regulator of RAB GTPases by regulating the GTP/GDP exchange and interaction partners of RABs through phosphorylation (PubMed:26824392, PubMed:28720718, PubMed:29127255, PubMed:30398148, PubMed:29212815, PubMed:29125462, PubMed:30635421). Phosphorylates RAB3A, RAB3B, RAB3C, RAB3D, RAB5A, RAB5B, RAB5C, RAB8A, RAB8B, RAB10, RAB12, RAB35, and RAB43 (PubMed:26824392, PubMed:28720718, PubMed:29127255, PubMed:30398148, PubMed:29212815, PubMed:29125462, PubMed:30635421, PubMed:23395371). Regulates the RAB3IP-catalyzed GDP/GTP exchange for RAB8A through the phosphorylation of 'Thr-72' on RAB8A (PubMed:26824392). Inhibits the interaction between RAB8A and GDI1 and/or GDI2 by phosphorylating 'Thr-72' on RAB8A (PubMed:26824392). Regulates primary ciliogenesis through phosphorylation of RAB8A and RAB10, which promotes SHH signaling in the brain (PubMed:29125462, PubMed:30398148). Together with RAB29, plays a role in the retrograde trafficking pathway for recycling proteins, such as mannose-6-phosphate receptor (M6PR), between lysosomes and the Golgi apparatus in a retromer-dependent manner (PubMed:23395371). Regulates neuronal process morphology in the intact central nervous system (CNS) (PubMed:17114044). Plays a role in synaptic vesicle trafficking (PubMed:24687852). Plays an important role in recruiting SEC16A to endoplasmic reticulum exit sites (ERES) and in regulating ER to Golgi vesicle-mediated transport and ERES organization (PubMed:25201882). Positively regulates autophagy through a calcium-dependent activation of the CaMKK/AMPK signaling pathway (PubMed:22012985). The process involves activation of nicotinic acid adenine dinucleotide phosphate (NAADP) receptors, increase in lysosomal pH, and calcium release from lysosomes (PubMed:22012985). Phosphorylates PRDX3 (PubMed:21850687). By phosphorylating APP on 'Thr-743', which promotes the production and the nuclear translocation of the APP intracellular domain (AICD), regulates dopaminergic neuron apoptosis (PubMed:28720718). Independent of its kinase activity, inhibits the proteosomal degradation of MAPT, thus promoting MAPT oligomerization and secretion (PubMed:26014385). In addition, has GTPase activity via its Roc domain which regulates LRRK2 kinase activity (PubMed:18230735, PubMed:26824392, PubMed:29125462, PubMed:28720718, PubMed:29212815). {ECO:0000269|PubMed:17114044, ECO:0000269|PubMed:18230735, ECO:0000269|PubMed:20949042, ECO:0000269|PubMed:21850687, ECO:0000269|PubMed:22012985, ECO:0000269|PubMed:23395371, ECO:0000269|PubMed:24687852, ECO:0000269|PubMed:25201882, ECO:0000269|PubMed:26014385, ECO:0000269|PubMed:26824392, ECO:0000269|PubMed:28720718, ECO:0000269|PubMed:29125462, ECO:0000269|PubMed:29127255, ECO:0000269|PubMed:29212815, ECO:0000269|PubMed:30398148, ECO:0000269|PubMed:30635421}. | |
| Ensembl transtripts involved in fusion gene | ENST ids | ENST00000534526, ENST00000266482, ENST00000381025, ENST00000427716, ENST00000472289, ENST00000473513, ENST00000525053, ENST00000531134, ENST00000546442, | ENST00000481256, ENST00000298910, ENST00000343742, |
| Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 19 X 13 X 13=3211 | 3 X 3 X 2=18 |
| # samples | 22 | 3 | |
| ** MAII score | log2(22/3211*10)=-3.86744723620111 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(3/18*10)=0.736965594166206 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0 | |
| Fusion gene context | PubMed: FGD4 [Title/Abstract] AND LRRK2 [Title/Abstract] AND fusion [Title/Abstract] | ||
| Fusion neoantigen context | PubMed: FGD4 [Title/Abstract] AND LRRK2 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
| Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | FGD4(32552893)-LRRK2(40619357), # samples:1 | ||
| Anticipated loss of major functional domain due to fusion event. | FGD4-LRRK2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. FGD4-LRRK2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. FGD4-LRRK2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. FGD4-LRRK2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. | ||
| * DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
| Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Partner | Gene | GO ID | GO term | PubMed ID |
| Tgene | LRRK2 | GO:0000165 | MAPK cascade | 17200152 |
| Tgene | LRRK2 | GO:0000186 | activation of MAPKK activity | 19302196 |
| Tgene | LRRK2 | GO:0001934 | positive regulation of protein phosphorylation | 22012985 |
| Tgene | LRRK2 | GO:0006468 | protein phosphorylation | 25500533 |
| Tgene | LRRK2 | GO:0010955 | negative regulation of protein processing | 21370995 |
| Tgene | LRRK2 | GO:0018105 | peptidyl-serine phosphorylation | 19576176 |
| Tgene | LRRK2 | GO:0018107 | peptidyl-threonine phosphorylation | 21048939 |
| Tgene | LRRK2 | GO:0031398 | positive regulation of protein ubiquitination | 16352719|20173330 |
| Tgene | LRRK2 | GO:0032092 | positive regulation of protein binding | 21370995 |
| Tgene | LRRK2 | GO:0034260 | negative regulation of GTPase activity | 22423108 |
| Tgene | LRRK2 | GO:0043068 | positive regulation of programmed cell death | 17200152 |
| Tgene | LRRK2 | GO:0046039 | GTP metabolic process | 21048939 |
| Tgene | LRRK2 | GO:0046777 | protein autophosphorylation | 16269541|16321986|17200152|17442267 |
| Tgene | LRRK2 | GO:1902499 | positive regulation of protein autoubiquitination | 16352719 |
| Tgene | LRRK2 | GO:1903125 | negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation | 21850687 |
| Tgene | LRRK2 | GO:1903215 | negative regulation of protein targeting to mitochondrion | 21370995 |
| Four levels of functional features of fusion genes Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr12:32552893/chr12:40619357) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
 |
| Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here. |
| Fusion gene breakpoints across FGD4 (5'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
| Fusion gene breakpoints across LRRK2 (3'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Fusion Amino Acid Sequences |
| Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
| ENST00000534526 | FGD4 | chr12 | 32552893 | - | ENST00000343742 | LRRK2 | chr12 | 40619357 | + | 4899 | 431 | 178 | 4095 | 1305 |
| ENST00000534526 | FGD4 | chr12 | 32552893 | - | ENST00000298910 | LRRK2 | chr12 | 40619357 | + | 9380 | 431 | 178 | 7863 | 2561 |
| DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
| ENST00000534526 | ENST00000343742 | FGD4 | chr12 | 32552893 | - | LRRK2 | chr12 | 40619357 | + | 0.000284481 | 0.9997155 |
| ENST00000534526 | ENST00000298910 | FGD4 | chr12 | 32552893 | - | LRRK2 | chr12 | 40619357 | + | 0.00015402 | 0.999846 |
| Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones. |
Get the fusion protein sequences from here. |
| Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for FGD4-LRRK2 |
| +/-13 AA sequence from the breakpoints of the fusion protein sequences. |
| Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
| FGD4 | chr12 | 32552893 | LRRK2 | chr12 | 40619357 | 431 | 84 | TAAFKGQVPSGATASKLFQGKNIHVP |
Top |
Potential FusionNeoAntigen Information of FGD4-LRRK2 in HLA I |
| Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| FGD4-LRRK2_32552893_40619357.msa |
| Potential FusionNeoAntigen Information * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
| FGD4-LRRK2 | chr12 | 32552893 | chr12 | 40619357 | 431 | HLA-A30:08 | ATASKLFQGK | 0.9945 | 0.8466 | 11 | 21 |
| FGD4-LRRK2 | chr12 | 32552893 | chr12 | 40619357 | 431 | HLA-A74:09 | ATASKLFQGK | 0.9133 | 0.5744 | 11 | 21 |
| FGD4-LRRK2 | chr12 | 32552893 | chr12 | 40619357 | 431 | HLA-A74:03 | ATASKLFQGK | 0.9133 | 0.5744 | 11 | 21 |
| FGD4-LRRK2 | chr12 | 32552893 | chr12 | 40619357 | 431 | HLA-A74:11 | ATASKLFQGK | 0.9133 | 0.5744 | 11 | 21 |
| FGD4-LRRK2 | chr12 | 32552893 | chr12 | 40619357 | 431 | HLA-B35:03 | VPSGATASKL | 0.5973 | 0.7694 | 7 | 17 |
| FGD4-LRRK2 | chr12 | 32552893 | chr12 | 40619357 | 431 | HLA-B35:04 | VPSGATASKL | 0.3884 | 0.8986 | 7 | 17 |
| FGD4-LRRK2 | chr12 | 32552893 | chr12 | 40619357 | 431 | HLA-B35:02 | VPSGATASKL | 0.3884 | 0.8986 | 7 | 17 |
| FGD4-LRRK2 | chr12 | 32552893 | chr12 | 40619357 | 431 | HLA-B35:08 | VPSGATASKLF | 0.9904 | 0.6878 | 7 | 18 |
| FGD4-LRRK2 | chr12 | 32552893 | chr12 | 40619357 | 431 | HLA-B35:01 | VPSGATASKLF | 0.9883 | 0.7159 | 7 | 18 |
| FGD4-LRRK2 | chr12 | 32552893 | chr12 | 40619357 | 431 | HLA-B07:12 | VPSGATASKL | 0.9751 | 0.5629 | 7 | 17 |
| FGD4-LRRK2 | chr12 | 32552893 | chr12 | 40619357 | 431 | HLA-B42:02 | VPSGATASKL | 0.5195 | 0.5428 | 7 | 17 |
| FGD4-LRRK2 | chr12 | 32552893 | chr12 | 40619357 | 431 | HLA-B42:01 | VPSGATASKL | 0.464 | 0.5371 | 7 | 17 |
| FGD4-LRRK2 | chr12 | 32552893 | chr12 | 40619357 | 431 | HLA-B35:12 | VPSGATASKL | 0.3884 | 0.8986 | 7 | 17 |
| FGD4-LRRK2 | chr12 | 32552893 | chr12 | 40619357 | 431 | HLA-B39:10 | VPSGATASKL | 0.3553 | 0.874 | 7 | 17 |
| FGD4-LRRK2 | chr12 | 32552893 | chr12 | 40619357 | 431 | HLA-B07:12 | VPSGATASKLF | 0.9977 | 0.5911 | 7 | 18 |
| FGD4-LRRK2 | chr12 | 32552893 | chr12 | 40619357 | 431 | HLA-C01:17 | QVPSGATASKL | 0.9573 | 0.9702 | 6 | 17 |
| FGD4-LRRK2 | chr12 | 32552893 | chr12 | 40619357 | 431 | HLA-A30:01 | ATASKLFQGK | 0.9936 | 0.9061 | 11 | 21 |
| FGD4-LRRK2 | chr12 | 32552893 | chr12 | 40619357 | 431 | HLA-A74:01 | ATASKLFQGK | 0.9133 | 0.5744 | 11 | 21 |
| FGD4-LRRK2 | chr12 | 32552893 | chr12 | 40619357 | 431 | HLA-B35:13 | VPSGATASKL | 0.5824 | 0.7755 | 7 | 17 |
| FGD4-LRRK2 | chr12 | 32552893 | chr12 | 40619357 | 431 | HLA-B35:09 | VPSGATASKL | 0.3884 | 0.8986 | 7 | 17 |
| FGD4-LRRK2 | chr12 | 32552893 | chr12 | 40619357 | 431 | HLA-B67:01 | VPSGATASKL | 0.3344 | 0.6783 | 7 | 17 |
| FGD4-LRRK2 | chr12 | 32552893 | chr12 | 40619357 | 431 | HLA-B35:43 | VPSGATASKLF | 0.9974 | 0.8066 | 7 | 18 |
| FGD4-LRRK2 | chr12 | 32552893 | chr12 | 40619357 | 431 | HLA-B15:08 | VPSGATASKLF | 0.9972 | 0.806 | 7 | 18 |
| FGD4-LRRK2 | chr12 | 32552893 | chr12 | 40619357 | 431 | HLA-B15:11 | VPSGATASKLF | 0.997 | 0.8116 | 7 | 18 |
| FGD4-LRRK2 | chr12 | 32552893 | chr12 | 40619357 | 431 | HLA-B35:11 | VPSGATASKLF | 0.9958 | 0.8563 | 7 | 18 |
| FGD4-LRRK2 | chr12 | 32552893 | chr12 | 40619357 | 431 | HLA-B35:17 | VPSGATASKLF | 0.9919 | 0.6029 | 7 | 18 |
| FGD4-LRRK2 | chr12 | 32552893 | chr12 | 40619357 | 431 | HLA-B35:30 | VPSGATASKLF | 0.9919 | 0.6029 | 7 | 18 |
| FGD4-LRRK2 | chr12 | 32552893 | chr12 | 40619357 | 431 | HLA-B35:23 | VPSGATASKLF | 0.9889 | 0.7268 | 7 | 18 |
| FGD4-LRRK2 | chr12 | 32552893 | chr12 | 40619357 | 431 | HLA-B35:77 | VPSGATASKLF | 0.9883 | 0.7159 | 7 | 18 |
| FGD4-LRRK2 | chr12 | 32552893 | chr12 | 40619357 | 431 | HLA-C01:02 | QVPSGATASKL | 0.9614 | 0.9696 | 6 | 17 |
| FGD4-LRRK2 | chr12 | 32552893 | chr12 | 40619357 | 431 | HLA-B67:01 | VPSGATASKLF | 0.7698 | 0.7276 | 7 | 18 |
Top |
Potential FusionNeoAntigen Information of FGD4-LRRK2 in HLA II |
| Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| Potential FusionNeoAntigen Information * We used NetMHCIIpan v4.1 (%rank<0.5). |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of FGD4-LRRK2 |
| 3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
| File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
| 7629 | QVPSGATASKLFQG | FGD4 | LRRK2 | chr12 | 32552893 | chr12 | 40619357 | 431 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of FGD4-LRRK2 |
| Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens * We used Glide to predict the interaction between HLAs and neoantigens. |
| HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
| HLA-B14:02 | 3BVN | 7629 | QVPSGATASKLFQG | -7.15543 | -7.26883 |
| HLA-B14:02 | 3BVN | 7629 | QVPSGATASKLFQG | -4.77435 | -5.80965 |
| HLA-B52:01 | 3W39 | 7629 | QVPSGATASKLFQG | -6.80875 | -6.92215 |
| HLA-B52:01 | 3W39 | 7629 | QVPSGATASKLFQG | -4.20386 | -5.23916 |
| HLA-A11:01 | 4UQ2 | 7629 | QVPSGATASKLFQG | -7.5194 | -8.5547 |
| HLA-A11:01 | 4UQ2 | 7629 | QVPSGATASKLFQG | -6.9601 | -7.0735 |
| HLA-A24:02 | 5HGA | 7629 | QVPSGATASKLFQG | -7.52403 | -7.63743 |
| HLA-A24:02 | 5HGA | 7629 | QVPSGATASKLFQG | -5.82433 | -6.85963 |
| HLA-B27:05 | 6PYJ | 7629 | QVPSGATASKLFQG | -3.28285 | -4.31815 |
| HLA-B44:05 | 3DX8 | 7629 | QVPSGATASKLFQG | -5.91172 | -6.94702 |
| HLA-B44:05 | 3DX8 | 7629 | QVPSGATASKLFQG | -4.24346 | -4.35686 |
Top |
Vaccine Design for the FusionNeoAntigens of FGD4-LRRK2 |
| mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
| FGD4-LRRK2 | chr12 | 32552893 | chr12 | 40619357 | 11 | 21 | ATASKLFQGK | CCACAGCCTCCAAGTTATTTCAAGGCAAAA |
| FGD4-LRRK2 | chr12 | 32552893 | chr12 | 40619357 | 6 | 17 | QVPSGATASKL | AGGTGCCCTCAGGAGCCACAGCCTCCAAGTTAT |
| FGD4-LRRK2 | chr12 | 32552893 | chr12 | 40619357 | 7 | 17 | VPSGATASKL | TGCCCTCAGGAGCCACAGCCTCCAAGTTAT |
| FGD4-LRRK2 | chr12 | 32552893 | chr12 | 40619357 | 7 | 18 | VPSGATASKLF | TGCCCTCAGGAGCCACAGCCTCCAAGTTATTTC |
| mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of FGD4-LRRK2 |
| These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens. |
| Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
| GBM | FGD4-LRRK2 | chr12 | 32552893 | ENST00000534526 | chr12 | 40619357 | ENST00000298910 | TCGA-06-0129-01A |
Top |
Potential target of CAR-T therapy development for FGD4-LRRK2 |
| Predicted 3D structure. We used RoseTTAFold. |
| Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features * Minus value of BPloci means that the break point is located before the CDS. |
| - In-frame and retained 'Transmembrane'. |
| Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
| Subcellular localization prediction of the transmembrane domain retained fusion proteins * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
| Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to FGD4-LRRK2 |
| Drugs used for this fusion-positive patient. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to FGD4-LRRK2 |
| Diseases that have this fusion gene. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Disease | Source | PMID |
| Diseases associated with fusion partners. (DisGeNet 4.0) |
| Partner | Gene | Disease ID | Disease name | # pubmeds | Source |
Copyright 2023-PresentThe University of Texas Health Science Center at Houston (UTHealth)
Web File Viewing | Emergency Information
Campus Carry|Site Policies