![]() |
|||||||
|
Fusion Protein:GAB2-CERS6 |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: GAB2-CERS6 | FusionPDB ID: 32027 | FusionGDB2.0 ID: 32027 | Hgene | Tgene | Gene symbol | GAB2 | CERS6 | Gene ID | 9846 | 253782 |
Gene name | GRB2 associated binding protein 2 | ceramide synthase 6 | |
Synonyms | - | CERS5|LASS6 | |
Cytomap | 11q14.1 | 2q24.3 | |
Type of gene | protein-coding | protein-coding | |
Description | GRB2-associated-binding protein 2Grb2-associated binder 2growth factor receptor bound protein 2-associated protein 2pp100 | ceramide synthase 6LAG1 homolog, ceramide synthase 6longevity assurance homolog 6 | |
Modification date | 20200327 | 20200313 | |
UniProtAcc | Q9UQC2 Main function of 5'-partner protein: FUNCTION: Adapter protein which acts downstream of several membrane receptors including cytokine, antigen, hormone, cell matrix and growth factor receptors to regulate multiple signaling pathways. Regulates osteoclast differentiation mediating the TNFRSF11A/RANK signaling. In allergic response, it plays a role in mast cells activation and degranulation through PI-3-kinase regulation. Also involved in the regulation of cell proliferation and hematopoiesis. {ECO:0000269|PubMed:15750601, ECO:0000269|PubMed:19172738}. | Q6ZMG9 Main function of 5'-partner protein: FUNCTION: Ceramide synthase that catalyzes formation of ceramide from sphinganine and acyl-CoA substrates, with high selectivity toward palmitoyl-CoA (hexadecanoyl-CoA; C16:0-CoA) as acyl donor (PubMed:17977534, PubMed:17609214, PubMed:23530041, PubMed:26887952, PubMed:31916624). Can use other acyl donors, but with less efficiency (By similarity). Ceramides generated by CERS6 play a role in inflammatory response (By similarity). Acts as a regulator of metabolism and hepatic lipid accumulation (By similarity). Under high fat diet, palmitoyl- (C16:0-) ceramides generated by CERS6 specifically bind the mitochondrial fission factor MFF, thereby promoting mitochondrial fragmentation and contributing to the development of obesity (By similarity). {ECO:0000250|UniProtKB:Q8C172, ECO:0000269|PubMed:17609214, ECO:0000269|PubMed:17977534, ECO:0000269|PubMed:23530041, ECO:0000269|PubMed:26887952, ECO:0000269|PubMed:31916624}. | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000526030, ENST00000361507, ENST00000340149, | ENST00000305747, ENST00000392687, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 25 X 12 X 7=2100 | 5 X 5 X 3=75 |
# samples | 27 | 5 | |
** MAII score | log2(27/2100*10)=-2.95935801550265 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(5/75*10)=-0.584962500721156 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
Fusion gene context | PubMed: GAB2 [Title/Abstract] AND CERS6 [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: GAB2 [Title/Abstract] AND CERS6 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | GAB2(78128691)-CERS6(169547543), # samples:1 | ||
Anticipated loss of major functional domain due to fusion event. | GAB2-CERS6 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. GAB2-CERS6 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
Hgene | GAB2 | GO:0008284 | positive regulation of cell proliferation | 19172738 |
Tgene | CERS6 | GO:0046513 | ceramide biosynthetic process | 17609214|17977534 |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr11:78128691/chr2:169547543) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000361507 | GAB2 | chr11 | 78128691 | - | ENST00000305747 | CERS6 | chr2 | 169547543 | + | 6323 | 161 | 20 | 850 | 276 |
ENST00000361507 | GAB2 | chr11 | 78128691 | - | ENST00000392687 | CERS6 | chr2 | 169547543 | + | 6347 | 161 | 20 | 874 | 284 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000361507 | ENST00000305747 | GAB2 | chr11 | 78128691 | - | CERS6 | chr2 | 169547543 | + | 0.01018854 | 0.9898115 |
ENST00000361507 | ENST00000392687 | GAB2 | chr11 | 78128691 | - | CERS6 | chr2 | 169547543 | + | 0.011284169 | 0.9887158 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for GAB2-CERS6 |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
GAB2 | chr11 | 78128691 | CERS6 | chr2 | 169547543 | 161 | 47 | LRKSPPEKKLRRYTPWLWNTRHCWYN |
Top |
Potential FusionNeoAntigen Information of GAB2-CERS6 in HLA I |
![]() |
GAB2-CERS6_78128691_169547543.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
GAB2-CERS6 | chr11 | 78128691 | chr2 | 169547543 | 161 | HLA-B27:02 | RRYTPWLW | 0.9997 | 0.6729 | 10 | 18 |
GAB2-CERS6 | chr11 | 78128691 | chr2 | 169547543 | 161 | HLA-B27:05 | RRYTPWLW | 0.9997 | 0.8459 | 10 | 18 |
GAB2-CERS6 | chr11 | 78128691 | chr2 | 169547543 | 161 | HLA-B27:04 | RRYTPWLW | 0.9994 | 0.7707 | 10 | 18 |
GAB2-CERS6 | chr11 | 78128691 | chr2 | 169547543 | 161 | HLA-A68:24 | YTPWLWNTR | 0.975 | 0.9868 | 12 | 21 |
GAB2-CERS6 | chr11 | 78128691 | chr2 | 169547543 | 161 | HLA-B27:02 | LRRYTPWLW | 0.9735 | 0.8033 | 9 | 18 |
GAB2-CERS6 | chr11 | 78128691 | chr2 | 169547543 | 161 | HLA-A33:01 | YTPWLWNTR | 0.9666 | 0.9717 | 12 | 21 |
GAB2-CERS6 | chr11 | 78128691 | chr2 | 169547543 | 161 | HLA-A33:05 | YTPWLWNTR | 0.9666 | 0.9717 | 12 | 21 |
GAB2-CERS6 | chr11 | 78128691 | chr2 | 169547543 | 161 | HLA-A68:03 | YTPWLWNTR | 0.9649 | 0.9842 | 12 | 21 |
GAB2-CERS6 | chr11 | 78128691 | chr2 | 169547543 | 161 | HLA-A68:05 | YTPWLWNTR | 0.9445 | 0.9833 | 12 | 21 |
GAB2-CERS6 | chr11 | 78128691 | chr2 | 169547543 | 161 | HLA-A68:08 | YTPWLWNTR | 0.9435 | 0.9796 | 12 | 21 |
GAB2-CERS6 | chr11 | 78128691 | chr2 | 169547543 | 161 | HLA-A66:01 | YTPWLWNTR | 0.9227 | 0.977 | 12 | 21 |
GAB2-CERS6 | chr11 | 78128691 | chr2 | 169547543 | 161 | HLA-A68:06 | YTPWLWNTR | 0.8683 | 0.9822 | 12 | 21 |
GAB2-CERS6 | chr11 | 78128691 | chr2 | 169547543 | 161 | HLA-A31:02 | YTPWLWNTR | 0.8494 | 0.9923 | 12 | 21 |
GAB2-CERS6 | chr11 | 78128691 | chr2 | 169547543 | 161 | HLA-A34:01 | YTPWLWNTR | 0.7407 | 0.9865 | 12 | 21 |
GAB2-CERS6 | chr11 | 78128691 | chr2 | 169547543 | 161 | HLA-A34:05 | YTPWLWNTR | 0.7407 | 0.9865 | 12 | 21 |
GAB2-CERS6 | chr11 | 78128691 | chr2 | 169547543 | 161 | HLA-A26:03 | YTPWLWNTR | 0.6838 | 0.9754 | 12 | 21 |
GAB2-CERS6 | chr11 | 78128691 | chr2 | 169547543 | 161 | HLA-A66:03 | YTPWLWNTR | 0.494 | 0.948 | 12 | 21 |
GAB2-CERS6 | chr11 | 78128691 | chr2 | 169547543 | 161 | HLA-B57:01 | KLRRYTPWLW | 0.9982 | 0.9872 | 8 | 18 |
GAB2-CERS6 | chr11 | 78128691 | chr2 | 169547543 | 161 | HLA-A31:02 | RYTPWLWNTR | 0.9835 | 0.9844 | 11 | 21 |
GAB2-CERS6 | chr11 | 78128691 | chr2 | 169547543 | 161 | HLA-A32:13 | KLRRYTPWLW | 0.9016 | 0.9767 | 8 | 18 |
GAB2-CERS6 | chr11 | 78128691 | chr2 | 169547543 | 161 | HLA-A31:06 | RYTPWLWNTR | 0.8572 | 0.9775 | 11 | 21 |
GAB2-CERS6 | chr11 | 78128691 | chr2 | 169547543 | 161 | HLA-B27:02 | KLRRYTPWLW | 0.8444 | 0.7869 | 8 | 18 |
GAB2-CERS6 | chr11 | 78128691 | chr2 | 169547543 | 161 | HLA-B27:05 | RRYTPWLWNTR | 1 | 0.8663 | 10 | 21 |
GAB2-CERS6 | chr11 | 78128691 | chr2 | 169547543 | 161 | HLA-B27:02 | RRYTPWLWNTR | 1 | 0.7257 | 10 | 21 |
GAB2-CERS6 | chr11 | 78128691 | chr2 | 169547543 | 161 | HLA-B27:04 | RRYTPWLWNTR | 0.9999 | 0.8626 | 10 | 21 |
GAB2-CERS6 | chr11 | 78128691 | chr2 | 169547543 | 161 | HLA-B27:03 | RRYTPWLW | 0.9971 | 0.8549 | 10 | 18 |
GAB2-CERS6 | chr11 | 78128691 | chr2 | 169547543 | 161 | HLA-A68:01 | YTPWLWNTR | 0.975 | 0.9868 | 12 | 21 |
GAB2-CERS6 | chr11 | 78128691 | chr2 | 169547543 | 161 | HLA-A33:03 | YTPWLWNTR | 0.9557 | 0.9585 | 12 | 21 |
GAB2-CERS6 | chr11 | 78128691 | chr2 | 169547543 | 161 | HLA-B27:14 | RRYTPWLWNT | 0.9988 | 0.8763 | 10 | 20 |
GAB2-CERS6 | chr11 | 78128691 | chr2 | 169547543 | 161 | HLA-A31:01 | RYTPWLWNTR | 0.9898 | 0.9806 | 11 | 21 |
GAB2-CERS6 | chr11 | 78128691 | chr2 | 169547543 | 161 | HLA-B27:03 | RRYTPWLWNT | 0.9798 | 0.8862 | 10 | 20 |
GAB2-CERS6 | chr11 | 78128691 | chr2 | 169547543 | 161 | HLA-B27:14 | RRYTPWLWNTR | 1 | 0.8837 | 10 | 21 |
GAB2-CERS6 | chr11 | 78128691 | chr2 | 169547543 | 161 | HLA-B27:03 | RRYTPWLWNTR | 0.9987 | 0.8771 | 10 | 21 |
GAB2-CERS6 | chr11 | 78128691 | chr2 | 169547543 | 161 | HLA-B27:10 | RRYTPWLW | 0.9993 | 0.8443 | 10 | 18 |
GAB2-CERS6 | chr11 | 78128691 | chr2 | 169547543 | 161 | HLA-A66:02 | YTPWLWNTR | 0.5172 | 0.9439 | 12 | 21 |
GAB2-CERS6 | chr11 | 78128691 | chr2 | 169547543 | 161 | HLA-B57:10 | KLRRYTPWLW | 0.9982 | 0.9872 | 8 | 18 |
GAB2-CERS6 | chr11 | 78128691 | chr2 | 169547543 | 161 | HLA-B27:10 | RRYTPWLWNT | 0.998 | 0.9028 | 10 | 20 |
GAB2-CERS6 | chr11 | 78128691 | chr2 | 169547543 | 161 | HLA-A32:01 | KLRRYTPWLW | 0.9782 | 0.9721 | 8 | 18 |
GAB2-CERS6 | chr11 | 78128691 | chr2 | 169547543 | 161 | HLA-B27:08 | RRYTPWLWNTR | 1 | 0.822 | 10 | 21 |
GAB2-CERS6 | chr11 | 78128691 | chr2 | 169547543 | 161 | HLA-B27:10 | RRYTPWLWNTR | 0.9999 | 0.9081 | 10 | 21 |
Top |
Potential FusionNeoAntigen Information of GAB2-CERS6 in HLA II |
![]() |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of GAB2-CERS6 |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
1838 | EKKLRRYTPWLWNT | GAB2 | CERS6 | chr11 | 78128691 | chr2 | 169547543 | 161 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of GAB2-CERS6 |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 1838 | EKKLRRYTPWLWNT | -6.12283 | -6.12283 |
HLA-A24:02 | 5HGA | 1838 | EKKLRRYTPWLWNT | -7.36995 | -7.36995 |
Top |
Vaccine Design for the FusionNeoAntigens of GAB2-CERS6 |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
GAB2-CERS6 | chr11 | 78128691 | chr2 | 169547543 | 10 | 18 | RRYTPWLW | AGGCGCTATACCCCCTGGTTGTGG |
GAB2-CERS6 | chr11 | 78128691 | chr2 | 169547543 | 10 | 20 | RRYTPWLWNT | AGGCGCTATACCCCCTGGTTGTGGAATACG |
GAB2-CERS6 | chr11 | 78128691 | chr2 | 169547543 | 10 | 21 | RRYTPWLWNTR | AGGCGCTATACCCCCTGGTTGTGGAATACGAGG |
GAB2-CERS6 | chr11 | 78128691 | chr2 | 169547543 | 11 | 21 | RYTPWLWNTR | CGCTATACCCCCTGGTTGTGGAATACGAGG |
GAB2-CERS6 | chr11 | 78128691 | chr2 | 169547543 | 12 | 21 | YTPWLWNTR | TATACCCCCTGGTTGTGGAATACGAGG |
GAB2-CERS6 | chr11 | 78128691 | chr2 | 169547543 | 8 | 18 | KLRRYTPWLW | AAGTTGAGGCGCTATACCCCCTGGTTGTGG |
GAB2-CERS6 | chr11 | 78128691 | chr2 | 169547543 | 9 | 18 | LRRYTPWLW | TTGAGGCGCTATACCCCCTGGTTGTGG |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of GAB2-CERS6 |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
SKCM | GAB2-CERS6 | chr11 | 78128691 | ENST00000361507 | chr2 | 169547543 | ENST00000305747 | TCGA-EE-A2M6 |
Top |
Potential target of CAR-T therapy development for GAB2-CERS6 |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
Tgene | CERS6 | chr11:78128691 | chr2:169547543 | ENST00000305747 | 3 | 10 | 178_198 | 0 | 385.0 | Transmembrane | Helical | |
Tgene | CERS6 | chr11:78128691 | chr2:169547543 | ENST00000305747 | 3 | 10 | 205_225 | 0 | 385.0 | Transmembrane | Helical | |
Tgene | CERS6 | chr11:78128691 | chr2:169547543 | ENST00000305747 | 3 | 10 | 263_283 | 0 | 385.0 | Transmembrane | Helical | |
Tgene | CERS6 | chr11:78128691 | chr2:169547543 | ENST00000305747 | 3 | 10 | 303_323 | 0 | 385.0 | Transmembrane | Helical | |
Tgene | CERS6 | chr11:78128691 | chr2:169547543 | ENST00000392687 | 3 | 11 | 178_198 | 0 | 393.0 | Transmembrane | Helical | |
Tgene | CERS6 | chr11:78128691 | chr2:169547543 | ENST00000392687 | 3 | 11 | 205_225 | 0 | 393.0 | Transmembrane | Helical | |
Tgene | CERS6 | chr11:78128691 | chr2:169547543 | ENST00000392687 | 3 | 11 | 263_283 | 0 | 393.0 | Transmembrane | Helical | |
Tgene | CERS6 | chr11:78128691 | chr2:169547543 | ENST00000392687 | 3 | 11 | 303_323 | 0 | 393.0 | Transmembrane | Helical |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to GAB2-CERS6 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to GAB2-CERS6 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |