Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:GNB2-EEF2

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: GNB2-EEF2
	FusionPDB ID: 33700
	FusionGDB2.0 ID: 33700
		Hgene	Tgene
	Gene symbol	GNB2	EEF2
	Gene ID	2783	1938
	Gene name	G protein subunit beta 2	eukaryotic translation elongation factor 2
	Synonyms	-	EEF-2\|EF-2\|EF2\|SCA26
	Cytomap	7q22.1	19p13.3
	Type of gene	protein-coding	protein-coding
	Description	guanine nucleotide-binding protein G(I)/G(S)/G(T) subunit beta-2G protein, beta-2 subunitepididymis secretory sperm binding proteing protein subunit beta-2guanine nucleotide binding protein (G protein), beta polypeptide 2guanine nucleotide-binding pr	elongation factor 2epididymis secretory sperm binding proteinpolypeptidyl-tRNA translocase
	Modification date	20200313	20200313
	UniProtAcc	P62879 Main function of 5'-partner protein: FUNCTION: Guanine nucleotide-binding proteins (G proteins) are involved as a modulator or transducer in various transmembrane signaling systems. The beta and gamma chains are required for the GTPase activity, for replacement of GDP by GTP, and for G protein-effector interaction.	Q96G04 Main function of 5'-partner protein: FUNCTION: Catalyzes the trimethylation of eukaryotic elongation factor 2 (EEF2) on 'Lys-525'. {ECO:0000269\|PubMed:25231979}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000303210, ENST00000393924, ENST00000393926, ENST00000424361, ENST00000436220, ENST00000419828, ENST00000427895,	ENST00000600720, ENST00000309311,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	4 X 5 X 4=80	17 X 23 X 7=2737
	# samples	5	28
	** MAII score	log2(5/80*10)=-0.678071905112638 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(28/2737*10)=-3.28909670241999 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: GNB2 [Title/Abstract] AND EEF2 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: GNB2 [Title/Abstract] AND EEF2 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	GNB2(100275038)-EEF2(3978170), # samples:1
Anticipated loss of major functional domain due to fusion event.	GNB2-EEF2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. GNB2-EEF2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner

Gene

GO ID

GO term

PubMed ID

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr7:100275038/chr19:3978170)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across GNB2 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across EEF2 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000303210	GNB2	chr7	100275038	+	ENST00000309311	EEF2	chr19	3978170	-	2111	749	461	1612	383
ENST00000436220	GNB2	chr7	100275038	+	ENST00000309311	EEF2	chr19	3978170	-	1738	376	196	1239	347
ENST00000424361	GNB2	chr7	100275038	+	ENST00000309311	EEF2	chr19	3978170	-	1747	385	205	1248	347
ENST00000393926	GNB2	chr7	100275038	+	ENST00000309311	EEF2	chr19	3978170	-	1874	512	224	1375	383
ENST00000393924	GNB2	chr7	100275038	+	ENST00000309311	EEF2	chr19	3978170	-	1757	395	14	1258	414

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000303210	ENST00000309311	GNB2	chr7	100275038	+	EEF2	chr19	3978170	-	0.004804627	0.9951953
ENST00000436220	ENST00000309311	GNB2	chr7	100275038	+	EEF2	chr19	3978170	-	0.008030494	0.9919695
ENST00000424361	ENST00000309311	GNB2	chr7	100275038	+	EEF2	chr19	3978170	-	0.008008323	0.9919917
ENST00000393926	ENST00000309311	GNB2	chr7	100275038	+	EEF2	chr19	3978170	-	0.005256906	0.9947431
ENST00000393924	ENST00000309311	GNB2	chr7	100275038	+	EEF2	chr19	3978170	-	0.005381746	0.99461824

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for GNB2-EEF2

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
GNB2	chr7	100275038	EEF2	chr19	3978170	376	60	GKLIIWDSYTTNKKSDPVVSYRETVS
GNB2	chr7	100275038	EEF2	chr19	3978170	385	60	GKLIIWDSYTTNKKSDPVVSYRETVS
GNB2	chr7	100275038	EEF2	chr19	3978170	395	127	GKLIIWDSYTTNKKSDPVVSYRETVS
GNB2	chr7	100275038	EEF2	chr19	3978170	512	96	GKLIIWDSYTTNKKSDPVVSYRETVS
GNB2	chr7	100275038	EEF2	chr19	3978170	749	96	GKLIIWDSYTTNKKSDPVVSYRETVS

Top

Potential FusionNeoAntigen Information of GNB2-EEF2 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

GNB2-EEF2_100275038_3978170.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
GNB2-EEF2	chr7	100275038	chr19	3978170	749	HLA-B27:04	KKSDPVVSY	0.8825	0.5919	12	21
GNB2-EEF2	chr7	100275038	chr19	3978170	749	HLA-B15:25	KKSDPVVSY	0.6042	0.8302	12	21
GNB2-EEF2	chr7	100275038	chr19	3978170	749	HLA-B15:01	KKSDPVVSY	0.4918	0.8057	12	21
GNB2-EEF2	chr7	100275038	chr19	3978170	749	HLA-B15:03	KKSDPVVSY	0.2984	0.6399	12	21
GNB2-EEF2	chr7	100275038	chr19	3978170	749	HLA-B15:18	KKSDPVVSY	0.2974	0.5712	12	21
GNB2-EEF2	chr7	100275038	chr19	3978170	749	HLA-C07:27	KKSDPVVSY	0.9838	0.8559	12	21
GNB2-EEF2	chr7	100275038	chr19	3978170	749	HLA-C07:05	KKSDPVVSY	0.9413	0.8579	12	21
GNB2-EEF2	chr7	100275038	chr19	3978170	749	HLA-C07:19	KKSDPVVSY	0.8765	0.5697	12	21
GNB2-EEF2	chr7	100275038	chr19	3978170	749	HLA-C07:67	KKSDPVVSY	0.8303	0.8166	12	21
GNB2-EEF2	chr7	100275038	chr19	3978170	749	HLA-C07:80	KKSDPVVSY	0.8303	0.8166	12	21
GNB2-EEF2	chr7	100275038	chr19	3978170	749	HLA-C07:10	KKSDPVVSY	0.8197	0.8518	12	21
GNB2-EEF2	chr7	100275038	chr19	3978170	749	HLA-C03:14	KKSDPVVSY	0.8017	0.9116	12	21
GNB2-EEF2	chr7	100275038	chr19	3978170	749	HLA-C07:46	KKSDPVVSY	0.7888	0.6935	12	21
GNB2-EEF2	chr7	100275038	chr19	3978170	749	HLA-B15:21	KKSDPVVSY	0.451	0.793	12	21
GNB2-EEF2	chr7	100275038	chr19	3978170	749	HLA-B15:05	KKSDPVVSY	0.4076	0.7592	12	21
GNB2-EEF2	chr7	100275038	chr19	3978170	749	HLA-B15:07	KKSDPVVSY	0.3754	0.5346	12	21
GNB2-EEF2	chr7	100275038	chr19	3978170	749	HLA-B15:04	KKSDPVVSY	0.2092	0.8211	12	21
GNB2-EEF2	chr7	100275038	chr19	3978170	749	HLA-C15:04	KKSDPVVSY	0.0718	0.7469	12	21
GNB2-EEF2	chr7	100275038	chr19	3978170	749	HLA-C12:16	KKSDPVVSY	0.0327	0.8345	12	21
GNB2-EEF2	chr7	100275038	chr19	3978170	749	HLA-C12:04	KKSDPVVSY	0.021	0.9621	12	21
GNB2-EEF2	chr7	100275038	chr19	3978170	749	HLA-C06:03	KKSDPVVSY	0.0183	0.9598	12	21
GNB2-EEF2	chr7	100275038	chr19	3978170	749	HLA-C12:12	KKSDPVVSY	0.01	0.7653	12	21
GNB2-EEF2	chr7	100275038	chr19	3978170	749	HLA-B15:21	NKKSDPVVSY	0.8722	0.6301	11	21
GNB2-EEF2	chr7	100275038	chr19	3978170	749	HLA-B27:08	KKSDPVVSY	0.9174	0.6542	12	21
GNB2-EEF2	chr7	100275038	chr19	3978170	749	HLA-B27:10	KKSDPVVSY	0.9062	0.7534	12	21
GNB2-EEF2	chr7	100275038	chr19	3978170	749	HLA-C07:02	KKSDPVVSY	0.8303	0.8166	12	21
GNB2-EEF2	chr7	100275038	chr19	3978170	749	HLA-C07:17	KKSDPVVSY	0.7979	0.8687	12	21
GNB2-EEF2	chr7	100275038	chr19	3978170	749	HLA-B15:39	KKSDPVVSY	0.6138	0.7307	12	21
GNB2-EEF2	chr7	100275038	chr19	3978170	749	HLA-B15:12	KKSDPVVSY	0.5046	0.6654	12	21
GNB2-EEF2	chr7	100275038	chr19	3978170	749	HLA-B15:33	KKSDPVVSY	0.4918	0.8057	12	21
GNB2-EEF2	chr7	100275038	chr19	3978170	749	HLA-B15:34	KKSDPVVSY	0.4918	0.8057	12	21
GNB2-EEF2	chr7	100275038	chr19	3978170	749	HLA-B15:125	KKSDPVVSY	0.4918	0.8057	12	21
GNB2-EEF2	chr7	100275038	chr19	3978170	749	HLA-B15:27	KKSDPVVSY	0.4836	0.7907	12	21
GNB2-EEF2	chr7	100275038	chr19	3978170	749	HLA-B15:135	KKSDPVVSY	0.4658	0.8422	12	21
GNB2-EEF2	chr7	100275038	chr19	3978170	749	HLA-B15:20	KKSDPVVSY	0.4049	0.8079	12	21
GNB2-EEF2	chr7	100275038	chr19	3978170	749	HLA-B15:35	KKSDPVVSY	0.4028	0.7678	12	21
GNB2-EEF2	chr7	100275038	chr19	3978170	749	HLA-B15:50	KKSDPVVSY	0.3909	0.652	12	21
GNB2-EEF2	chr7	100275038	chr19	3978170	749	HLA-B35:28	KKSDPVVSY	0.2956	0.8152	12	21
GNB2-EEF2	chr7	100275038	chr19	3978170	749	HLA-B35:20	KKSDPVVSY	0.2897	0.8293	12	21
GNB2-EEF2	chr7	100275038	chr19	3978170	749	HLA-B48:02	KKSDPVVSY	0.2181	0.8034	12	21
GNB2-EEF2	chr7	100275038	chr19	3978170	749	HLA-B15:53	KKSDPVVSY	0.148	0.7555	12	21
GNB2-EEF2	chr7	100275038	chr19	3978170	749	HLA-B18:04	KKSDPVVSY	0.1411	0.7138	12	21
GNB2-EEF2	chr7	100275038	chr19	3978170	749	HLA-C06:08	KKSDPVVSY	0.1296	0.9569	12	21
GNB2-EEF2	chr7	100275038	chr19	3978170	749	HLA-C16:04	KKSDPVVSY	0.0956	0.8795	12	21
GNB2-EEF2	chr7	100275038	chr19	3978170	749	HLA-C06:06	KKSDPVVSY	0.0772	0.9561	12	21
GNB2-EEF2	chr7	100275038	chr19	3978170	749	HLA-C15:09	KKSDPVVSY	0.0718	0.7469	12	21
GNB2-EEF2	chr7	100275038	chr19	3978170	749	HLA-B18:06	KKSDPVVSY	0.0545	0.6677	12	21
GNB2-EEF2	chr7	100275038	chr19	3978170	749	HLA-B15:54	KKSDPVVSY	0.0528	0.7277	12	21
GNB2-EEF2	chr7	100275038	chr19	3978170	749	HLA-C12:03	KKSDPVVSY	0.0238	0.8909	12	21
GNB2-EEF2	chr7	100275038	chr19	3978170	749	HLA-C02:10	KKSDPVVSY	0.0231	0.934	12	21
GNB2-EEF2	chr7	100275038	chr19	3978170	749	HLA-C02:02	KKSDPVVSY	0.0231	0.934	12	21
GNB2-EEF2	chr7	100275038	chr19	3978170	749	HLA-C03:02	KKSDPVVSY	0.023	0.9154	12	21
GNB2-EEF2	chr7	100275038	chr19	3978170	749	HLA-C06:02	KKSDPVVSY	0.0165	0.9591	12	21
GNB2-EEF2	chr7	100275038	chr19	3978170	749	HLA-C06:17	KKSDPVVSY	0.0165	0.9591	12	21
GNB2-EEF2	chr7	100275038	chr19	3978170	749	HLA-C12:02	KKSDPVVSY	0.008	0.8384	12	21
GNB2-EEF2	chr7	100275038	chr19	3978170	749	HLA-B15:53	NKKSDPVVSY	0.9533	0.5551	11	21
GNB2-EEF2	chr7	100275038	chr19	3978170	749	HLA-B15:54	NKKSDPVVSY	0.9118	0.5139	11	21
GNB2-EEF2	chr7	100275038	chr19	3978170	749	HLA-B48:02	NKKSDPVVSY	0.8904	0.6704	11	21
GNB2-EEF2	chr7	100275038	chr19	3978170	749	HLA-B15:53	TNKKSDPVVSY	0.9991	0.6214	10	21
GNB2-EEF2	chr7	100275038	chr19	3978170	749	HLA-B15:54	TNKKSDPVVSY	0.9975	0.5742	10	21
GNB2-EEF2	chr7	100275038	chr19	3978170	749	HLA-B48:02	TNKKSDPVVSY	0.9773	0.7265	10	21

Top

Potential FusionNeoAntigen Information of GNB2-EEF2 in HLA II

GNB2-EEF2_100275038_3978170.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
GNB2-EEF2	chr7	100275038	chr19	3978170	749	DRB1-1501	GKLIIWDSYTTNKKS	0	15
GNB2-EEF2	chr7	100275038	chr19	3978170	749	DRB1-1504	GKLIIWDSYTTNKKS	0	15
GNB2-EEF2	chr7	100275038	chr19	3978170	749	DRB1-1505	GKLIIWDSYTTNKKS	0	15
GNB2-EEF2	chr7	100275038	chr19	3978170	749	DRB1-1506	GKLIIWDSYTTNKKS	0	15
GNB2-EEF2	chr7	100275038	chr19	3978170	749	DRB1-1507	GKLIIWDSYTTNKKS	0	15
GNB2-EEF2	chr7	100275038	chr19	3978170	749	DRB1-1509	GKLIIWDSYTTNKKS	0	15
GNB2-EEF2	chr7	100275038	chr19	3978170	749	DRB1-1510	GKLIIWDSYTTNKKS	0	15
GNB2-EEF2	chr7	100275038	chr19	3978170	749	DRB1-1512	GKLIIWDSYTTNKKS	0	15
GNB2-EEF2	chr7	100275038	chr19	3978170	749	DRB1-1513	GKLIIWDSYTTNKKS	0	15
GNB2-EEF2	chr7	100275038	chr19	3978170	749	DRB1-1516	GKLIIWDSYTTNKKS	0	15
GNB2-EEF2	chr7	100275038	chr19	3978170	749	DRB1-1518	GKLIIWDSYTTNKKS	0	15
GNB2-EEF2	chr7	100275038	chr19	3978170	749	DRB1-1520	GKLIIWDSYTTNKKS	0	15
GNB2-EEF2	chr7	100275038	chr19	3978170	749	DRB1-1521	GKLIIWDSYTTNKKS	0	15
GNB2-EEF2	chr7	100275038	chr19	3978170	749	DRB1-1522	GKLIIWDSYTTNKKS	0	15
GNB2-EEF2	chr7	100275038	chr19	3978170	749	DRB1-1524	GKLIIWDSYTTNKKS	0	15
GNB2-EEF2	chr7	100275038	chr19	3978170	749	DRB1-1528	GKLIIWDSYTTNKKS	0	15
GNB2-EEF2	chr7	100275038	chr19	3978170	749	DRB1-1532	GKLIIWDSYTTNKKS	0	15
GNB2-EEF2	chr7	100275038	chr19	3978170	749	DRB1-1533	GKLIIWDSYTTNKKS	0	15
GNB2-EEF2	chr7	100275038	chr19	3978170	749	DRB1-1535	GKLIIWDSYTTNKKS	0	15
GNB2-EEF2	chr7	100275038	chr19	3978170	749	DRB1-1536	GKLIIWDSYTTNKKS	0	15
GNB2-EEF2	chr7	100275038	chr19	3978170	749	DRB1-1537	GKLIIWDSYTTNKKS	0	15
GNB2-EEF2	chr7	100275038	chr19	3978170	749	DRB1-1540	GKLIIWDSYTTNKKS	0	15
GNB2-EEF2	chr7	100275038	chr19	3978170	749	DRB1-1541	GKLIIWDSYTTNKKS	0	15
GNB2-EEF2	chr7	100275038	chr19	3978170	749	DRB1-1542	GKLIIWDSYTTNKKS	0	15
GNB2-EEF2	chr7	100275038	chr19	3978170	749	DRB1-1543	GKLIIWDSYTTNKKS	0	15
GNB2-EEF2	chr7	100275038	chr19	3978170	749	DRB1-1545	GKLIIWDSYTTNKKS	0	15
GNB2-EEF2	chr7	100275038	chr19	3978170	749	DRB1-1546	GKLIIWDSYTTNKKS	0	15
GNB2-EEF2	chr7	100275038	chr19	3978170	749	DRB1-1548	GKLIIWDSYTTNKKS	0	15
GNB2-EEF2	chr7	100275038	chr19	3978170	749	DRB1-1549	GKLIIWDSYTTNKKS	0	15
GNB2-EEF2	chr7	100275038	chr19	3978170	749	DRB5-0111	LIIWDSYTTNKKSDP	2	17
GNB2-EEF2	chr7	100275038	chr19	3978170	749	DRB5-0203	LIIWDSYTTNKKSDP	2	17
GNB2-EEF2	chr7	100275038	chr19	3978170	749	DRB5-0203	KLIIWDSYTTNKKSD	1	16

Top

Fusion breakpoint peptide structures of GNB2-EEF2

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
1431	DSYTTNKKSDPVVS	GNB2	EEF2	chr7	100275038	chr19	3978170	749

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of GNB2-EEF2

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	1431	DSYTTNKKSDPVVS	-6.14799	-6.26139
HLA-B14:02	3BVN	1431	DSYTTNKKSDPVVS	-3.9938	-5.0291
HLA-B52:01	3W39	1431	DSYTTNKKSDPVVS	-6.39568	-7.43098
HLA-B52:01	3W39	1431	DSYTTNKKSDPVVS	-6.37734	-6.49074
HLA-B18:01	4JQV	1431	DSYTTNKKSDPVVS	-3.76829	-3.88169
HLA-B18:01	4JQV	1431	DSYTTNKKSDPVVS	-0.790392	-1.82569
HLA-A11:01	4UQ2	1431	DSYTTNKKSDPVVS	-7.83536	-7.94876
HLA-A11:01	4UQ2	1431	DSYTTNKKSDPVVS	-7.78281	-8.81811
HLA-A24:02	5HGA	1431	DSYTTNKKSDPVVS	-8.60655	-8.71995
HLA-A24:02	5HGA	1431	DSYTTNKKSDPVVS	-6.14617	-7.18147
HLA-B27:05	6PYJ	1431	DSYTTNKKSDPVVS	-6.73584	-7.77114
HLA-B27:05	6PYJ	1431	DSYTTNKKSDPVVS	-5.16345	-5.27685
HLA-B27:03	6PZ5	1431	DSYTTNKKSDPVVS	-8.07462	-8.18802
HLA-B27:03	6PZ5	1431	DSYTTNKKSDPVVS	-4.23376	-5.26906
HLA-B44:05	3DX8	1431	DSYTTNKKSDPVVS	-5.03276	-5.14616
HLA-B44:05	3DX8	1431	DSYTTNKKSDPVVS	-3.56209	-4.59739

Top

Vaccine Design for the FusionNeoAntigens of GNB2-EEF2

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
GNB2-EEF2	chr7	100275038	chr19	3978170	10	21	TNKKSDPVVSY	ACCAACAAGAAATCTGACCCGGTCGTCTCGTAC
GNB2-EEF2	chr7	100275038	chr19	3978170	11	21	NKKSDPVVSY	AACAAGAAATCTGACCCGGTCGTCTCGTAC
GNB2-EEF2	chr7	100275038	chr19	3978170	12	21	KKSDPVVSY	AAGAAATCTGACCCGGTCGTCTCGTAC

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
GNB2-EEF2	chr7	100275038	chr19	3978170	0	15	GKLIIWDSYTTNKKS	GGGAAGCTCATCATCTGGGACAGCTACACCACCAACAAGAAATCT
GNB2-EEF2	chr7	100275038	chr19	3978170	1	16	KLIIWDSYTTNKKSD	AAGCTCATCATCTGGGACAGCTACACCACCAACAAGAAATCTGAC
GNB2-EEF2	chr7	100275038	chr19	3978170	2	17	LIIWDSYTTNKKSDP	CTCATCATCTGGGACAGCTACACCACCAACAAGAAATCTGACCCG

Top

Information of the samples that have these potential fusion neoantigens of GNB2-EEF2

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
OV	GNB2-EEF2	chr7	100275038	ENST00000303210	chr19	3978170	ENST00000309311	TCGA-61-1728

Top

Potential target of CAR-T therapy development for GNB2-EEF2

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to GNB2-EEF2

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to GNB2-EEF2

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)