|
|||||||
|
Fusion Protein:AKT1-ITPK1 |
Fusion Gene and Fusion Protein Summary |
 Fusion gene summary |
| Fusion partner gene information | Fusion gene name: AKT1-ITPK1 | FusionPDB ID: 3466 | FusionGDB2.0 ID: 3466 | Hgene | Tgene | Gene symbol | AKT1 | ITPK1 | Gene ID | 207 | 3705 |
| Gene name | AKT serine/threonine kinase 1 | inositol-tetrakisphosphate 1-kinase | |
| Synonyms | AKT|CWS6|PKB|PKB-ALPHA|PRKBA|RAC|RAC-ALPHA | ITRPK1 | |
| Cytomap | 14q32.33 | 14q32.12 | |
| Type of gene | protein-coding | protein-coding | |
| Description | RAC-alpha serine/threonine-protein kinaseAKT1mPKB alphaRAC-PK-alphaprotein kinase B alphaproto-oncogene c-Aktrac protein kinase alphaserine-threonine protein kinasev-akt murine thymoma viral oncogene homolog 1v-akt murine thymoma viral oncogene-l | inositol-tetrakisphosphate 1-kinaseinositol 1,3,4-trisphosphate 5/6-kinaseins(1,3,4)P(3) 5/6-kinase | |
| Modification date | 20200329 | 20200313 | |
| UniProtAcc | Q96B36 Main function of 5'-partner protein: FUNCTION: Subunit of mTORC1, which regulates cell growth and survival in response to nutrient and hormonal signals. mTORC1 is activated in response to growth factors or amino acids. Growth factor-stimulated mTORC1 activation involves a AKT1-mediated phosphorylation of TSC1-TSC2, which leads to the activation of the RHEB GTPase that potently activates the protein kinase activity of mTORC1. Amino acid-signaling to mTORC1 requires its relocalization to the lysosomes mediated by the Ragulator complex and the Rag GTPases. Activated mTORC1 up-regulates protein synthesis by phosphorylating key regulators of mRNA translation and ribosome synthesis. mTORC1 phosphorylates EIF4EBP1 and releases it from inhibiting the elongation initiation factor 4E (eiF4E). mTORC1 phosphorylates and activates S6K1 at 'Thr-389', which then promotes protein synthesis by phosphorylating PDCD4 and targeting it for degradation. Within mTORC1, AKT1S1 negatively regulates mTOR activity in a manner that is dependent on its phosphorylation state and binding to 14-3-3 proteins. Inhibits RHEB-GTP-dependent mTORC1 activation. Substrate for AKT1 phosphorylation, but can also be activated by AKT1-independent mechanisms. May also play a role in nerve growth factor-mediated neuroprotection. {ECO:0000269|PubMed:16174443, ECO:0000269|PubMed:17277771, ECO:0000269|PubMed:17386266}. | Q13572 Main function of 5'-partner protein: FUNCTION: Kinase that can phosphorylate various inositol polyphosphate such as Ins(3,4,5,6)P4 or Ins(1,3,4)P3. Phosphorylates Ins(3,4,5,6)P4 at position 1 to form Ins(1,3,4,5,6)P5. This reaction is thought to have regulatory importance, since Ins(3,4,5,6)P4 is an inhibitor of plasma membrane Ca(2+)-activated Cl(-) channels, while Ins(1,3,4,5,6)P5 is not. Also phosphorylates Ins(1,3,4)P3 on O-5 and O-6 to form Ins(1,3,4,6)P4, an essential molecule in the hexakisphosphate (InsP6) pathway. Also acts as an inositol polyphosphate phosphatase that dephosphorylate Ins(1,3,4,5)P4 and Ins(1,3,4,6)P4 to Ins(1,3,4)P3, and Ins(1,3,4,5,6)P5 to Ins(3,4,5,6)P4. May also act as an isomerase that interconverts the inositol tetrakisphosphate isomers Ins(1,3,4,5)P4 and Ins(1,3,4,6)P4 in the presence of ADP and magnesium. Probably acts as the rate-limiting enzyme of the InsP6 pathway. Modifies TNF-alpha-induced apoptosis by interfering with the activation of TNFRSF1A-associated death domain (PubMed:11909533, PubMed:12925536, PubMed:17616525). Plays an important role in MLKL-mediated necroptosis. Produces highly phosphorylated inositol phosphates such as inositolhexakisphosphate (InsP6) which bind to MLKL mediating the release of an N-terminal auto-inhibitory region leading to its activation. Essential for activated phospho-MLKL to oligomerize and localize to the cell membrane during necroptosis (PubMed:17616525). {ECO:0000269|PubMed:11909533, ECO:0000269|PubMed:12925536, ECO:0000269|PubMed:17616525}. | |
| Ensembl transtripts involved in fusion gene | ENST ids | ENST00000349310, ENST00000402615, ENST00000407796, ENST00000554581, ENST00000554848, ENST00000555528, ENST00000544168, ENST00000554192, ENST00000554585, ENST00000555458, | ENST00000555495, ENST00000556954, ENST00000267615, ENST00000354313, ENST00000556603, |
| Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 10 X 6 X 4=240 | 9 X 8 X 7=504 |
| # samples | 10 | 8 | |
| ** MAII score | log2(10/240*10)=-1.26303440583379 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(8/504*10)=-2.65535182861255 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
| Fusion gene context | PubMed: AKT1 [Title/Abstract] AND ITPK1 [Title/Abstract] AND fusion [Title/Abstract] | ||
| Fusion neoantigen context | PubMed: AKT1 [Title/Abstract] AND ITPK1 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
| Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | AKT1(105258935)-ITPK1(93542964), # samples:1 | ||
| Anticipated loss of major functional domain due to fusion event. | AKT1-ITPK1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. AKT1-ITPK1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. AKT1-ITPK1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. AKT1-ITPK1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. AKT1-ITPK1 seems lost the major protein functional domain in Hgene partner, which is a cell metabolism gene due to the frame-shifted ORF. AKT1-ITPK1 seems lost the major protein functional domain in Hgene partner, which is a CGC due to the frame-shifted ORF. AKT1-ITPK1 seems lost the major protein functional domain in Hgene partner, which is a IUPHAR drug target due to the frame-shifted ORF. AKT1-ITPK1 seems lost the major protein functional domain in Hgene partner, which is a kinase due to the frame-shifted ORF. AKT1-ITPK1 seems lost the major protein functional domain in Tgene partner, which is a cell metabolism gene due to the frame-shifted ORF. AKT1-ITPK1 seems lost the major protein functional domain in Tgene partner, which is a essential gene due to the frame-shifted ORF. | ||
| * DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
| Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Partner | Gene | GO ID | GO term | PubMed ID |
| Hgene | AKT1 | GO:0001934 | positive regulation of protein phosphorylation | 19057511 |
| Hgene | AKT1 | GO:0006468 | protein phosphorylation | 11994271|14749367|23431171 |
| Hgene | AKT1 | GO:0007173 | epidermal growth factor receptor signaling pathway | 20878056 |
| Hgene | AKT1 | GO:0016310 | phosphorylation | 20333297 |
| Hgene | AKT1 | GO:0018105 | peptidyl-serine phosphorylation | 16139227 |
| Hgene | AKT1 | GO:0018107 | peptidyl-threonine phosphorylation | 20605787 |
| Hgene | AKT1 | GO:0030307 | positive regulation of cell growth | 19203586 |
| Hgene | AKT1 | GO:0032079 | positive regulation of endodeoxyribonuclease activity | 20605787 |
| Hgene | AKT1 | GO:0033138 | positive regulation of peptidyl-serine phosphorylation | 19667065 |
| Hgene | AKT1 | GO:0035556 | intracellular signal transduction | 14749367 |
| Hgene | AKT1 | GO:0035655 | interleukin-18-mediated signaling pathway | 21321938 |
| Hgene | AKT1 | GO:0043066 | negative regulation of apoptotic process | 19203586 |
| Hgene | AKT1 | GO:0043536 | positive regulation of blood vessel endothelial cell migration | 20011604 |
| Hgene | AKT1 | GO:0048661 | positive regulation of smooth muscle cell proliferation | 21321938 |
| Hgene | AKT1 | GO:0051091 | positive regulation of DNA-binding transcription factor activity | 19057511 |
| Hgene | AKT1 | GO:0070141 | response to UV-A | 18483258 |
| Four levels of functional features of fusion genes Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr14:105258935/chr14:93542964) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
 |
| Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here. |
| Fusion gene breakpoints across AKT1 (5'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
| Fusion gene breakpoints across ITPK1 (3'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Fusion Amino Acid Sequences |
| Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
| ENST00000402615 | AKT1 | chr14 | 105258935 | - | ENST00000267615 | ITPK1 | chr14 | 93542964 | - | 7324 | 1527 | 1087 | 2676 | 529 |
| ENST00000402615 | AKT1 | chr14 | 105258935 | - | ENST00000354313 | ITPK1 | chr14 | 93542964 | - | 3946 | 1527 | 2064 | 616 | 482 |
| ENST00000402615 | AKT1 | chr14 | 105258935 | - | ENST00000556603 | ITPK1 | chr14 | 93542964 | - | 4485 | 1527 | 1087 | 2676 | 529 |
| ENST00000555528 | AKT1 | chr14 | 105258935 | - | ENST00000267615 | ITPK1 | chr14 | 93542964 | - | 6496 | 699 | 259 | 1848 | 529 |
| ENST00000555528 | AKT1 | chr14 | 105258935 | - | ENST00000354313 | ITPK1 | chr14 | 93542964 | - | 3118 | 699 | 259 | 1548 | 429 |
| ENST00000555528 | AKT1 | chr14 | 105258935 | - | ENST00000556603 | ITPK1 | chr14 | 93542964 | - | 3657 | 699 | 259 | 1848 | 529 |
| DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
| ENST00000402615 | ENST00000267615 | AKT1 | chr14 | 105258935 | - | ITPK1 | chr14 | 93542964 | - | 0.004019531 | 0.9959805 |
| ENST00000402615 | ENST00000354313 | AKT1 | chr14 | 105258935 | - | ITPK1 | chr14 | 93542964 | - | 0.003742648 | 0.9962573 |
| ENST00000402615 | ENST00000556603 | AKT1 | chr14 | 105258935 | - | ITPK1 | chr14 | 93542964 | - | 0.005585109 | 0.9944149 |
| ENST00000555528 | ENST00000267615 | AKT1 | chr14 | 105258935 | - | ITPK1 | chr14 | 93542964 | - | 0.00419804 | 0.995802 |
| ENST00000555528 | ENST00000354313 | AKT1 | chr14 | 105258935 | - | ITPK1 | chr14 | 93542964 | - | 0.005226501 | 0.99477357 |
| ENST00000555528 | ENST00000556603 | AKT1 | chr14 | 105258935 | - | ITPK1 | chr14 | 93542964 | - | 0.007237264 | 0.99276274 |
| Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones. |
Get the fusion protein sequences from here. |
| Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for AKT1-ITPK1 |
| +/-13 AA sequence from the breakpoints of the fusion protein sequences. |
| Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
| AKT1 | chr14 | 105258935 | ITPK1 | chr14 | 93542964 | 1527 | 146 | RRGYCEGGLAAQTRKRGMEVVQLNLS |
| AKT1 | chr14 | 105258935 | ITPK1 | chr14 | 93542964 | 699 | 146 | RRGYCEGGLAAQTRKRGMEVVQLNLS |
Top |
Potential FusionNeoAntigen Information of AKT1-ITPK1 in HLA I |
| Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| AKT1-ITPK1_105258935_93542964.msa |
| Potential FusionNeoAntigen Information * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | HLA-B08:09 | QTRKRGMEV | 0.9939 | 0.5789 | 11 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | HLA-A30:08 | QTRKRGMEV | 0.9543 | 0.6325 | 11 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | HLA-A30:01 | QTRKRGMEV | 0.9627 | 0.7553 | 11 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | HLA-C16:01 | AAQTRKRGM | 0.2051 | 0.9543 | 9 | 18 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | HLA-C06:17 | TRKRGMEVV | 0.0445 | 0.9726 | 12 | 21 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | HLA-C06:02 | TRKRGMEVV | 0.0445 | 0.9726 | 12 | 21 |
Top |
Potential FusionNeoAntigen Information of AKT1-ITPK1 in HLA II |
| Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| AKT1-ITPK1_105258935_93542964.msa |
| Potential FusionNeoAntigen Information * We used NetMHCIIpan v4.1 (%rank<0.5). |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-0804 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-0804 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-0820 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-0820 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-0828 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-0828 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-0831 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-0831 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1101 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1102 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1102 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1103 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1103 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1104 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1104 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1104 | YCEGGLAAQTRKRGM | 3 | 18 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1106 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1106 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1109 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1110 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1111 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1111 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1112 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1115 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1116 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1116 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1118 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1118 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1121 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1124 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1125 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1125 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1127 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1128 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1129 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1133 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1135 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1135 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1135 | YCEGGLAAQTRKRGM | 3 | 18 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1136 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1136 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1137 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1137 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1138 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1138 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1138 | YCEGGLAAQTRKRGM | 3 | 18 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1139 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1141 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1141 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1141 | YCEGGLAAQTRKRGM | 3 | 18 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1141 | GGLAAQTRKRGMEVV | 6 | 21 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1142 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1142 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1143 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1143 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1143 | YCEGGLAAQTRKRGM | 3 | 18 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1144 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1144 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1144 | YCEGGLAAQTRKRGM | 3 | 18 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1146 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1146 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1146 | YCEGGLAAQTRKRGM | 3 | 18 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1147 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1147 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1148 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1148 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1149 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1150 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1150 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1150 | YCEGGLAAQTRKRGM | 3 | 18 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1151 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1154 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1154 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1155 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1155 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1156 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1156 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1156 | YCEGGLAAQTRKRGM | 3 | 18 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1157 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1158 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1158 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1158 | YCEGGLAAQTRKRGM | 3 | 18 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1159 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1159 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1159 | YCEGGLAAQTRKRGM | 3 | 18 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1160 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1160 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1160 | YCEGGLAAQTRKRGM | 3 | 18 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1161 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1162 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1163 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1163 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1165 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1165 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1166 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1167 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1167 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1169 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1169 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1170 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1174 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1175 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1176 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1176 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1177 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1177 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1177 | YCEGGLAAQTRKRGM | 3 | 18 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1178 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1178 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1178 | YCEGGLAAQTRKRGM | 3 | 18 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1180 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1180 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1181 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1183 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1183 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1183 | YCEGGLAAQTRKRGM | 3 | 18 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1184 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1184 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1185 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1185 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1187 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1187 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1188 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1188 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1188 | YCEGGLAAQTRKRGM | 3 | 18 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1190 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1191 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1191 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1192 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1192 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1193 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1193 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1194 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1195 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1196 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1301 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1301 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1305 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1306 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1306 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1307 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1307 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1308 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1308 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1309 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1311 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1311 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1311 | YCEGGLAAQTRKRGM | 3 | 18 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1314 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1318 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1318 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1319 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1319 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1320 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1320 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1322 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1322 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1324 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1324 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1326 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1327 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1327 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1335 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1335 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1342 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1342 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1342 | YCEGGLAAQTRKRGM | 3 | 18 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1350 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1351 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1351 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1352 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1352 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1353 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1353 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1359 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1359 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1362 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1363 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1363 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1364 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1364 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1368 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1368 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1369 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1369 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1370 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1370 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1371 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1371 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1372 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1372 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1375 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1375 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1376 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1378 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1378 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1379 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1379 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1380 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1380 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1383 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1383 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1384 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1384 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1387 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1387 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1391 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1391 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1392 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1392 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1398 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1398 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1412 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1412 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1415 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1415 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1437 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1437 | CEGGLAAQTRKRGME | 4 | 19 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1484 | EGGLAAQTRKRGMEV | 5 | 20 |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 | DRB1-1484 | CEGGLAAQTRKRGME | 4 | 19 |
Top |
Fusion breakpoint peptide structures of AKT1-ITPK1 |
| 3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
| File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
| 2823 | GGLAAQTRKRGMEV | AKT1 | ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 1527 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of AKT1-ITPK1 |
| Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens * We used Glide to predict the interaction between HLAs and neoantigens. |
| HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
| HLA-B14:02 | 3BVN | 2823 | GGLAAQTRKRGMEV | -7.9962 | -8.1096 |
| HLA-B14:02 | 3BVN | 2823 | GGLAAQTRKRGMEV | -5.70842 | -6.74372 |
| HLA-B52:01 | 3W39 | 2823 | GGLAAQTRKRGMEV | -6.83737 | -6.95077 |
| HLA-B52:01 | 3W39 | 2823 | GGLAAQTRKRGMEV | -4.4836 | -5.5189 |
| HLA-A11:01 | 4UQ2 | 2823 | GGLAAQTRKRGMEV | -10.0067 | -10.1201 |
| HLA-A11:01 | 4UQ2 | 2823 | GGLAAQTRKRGMEV | -9.03915 | -10.0745 |
| HLA-A24:02 | 5HGA | 2823 | GGLAAQTRKRGMEV | -6.56204 | -6.67544 |
| HLA-A24:02 | 5HGA | 2823 | GGLAAQTRKRGMEV | -5.42271 | -6.45801 |
| HLA-B44:05 | 3DX8 | 2823 | GGLAAQTRKRGMEV | -7.85648 | -8.89178 |
| HLA-B44:05 | 3DX8 | 2823 | GGLAAQTRKRGMEV | -5.3978 | -5.5112 |
| HLA-A02:01 | 6TDR | 2823 | GGLAAQTRKRGMEV | -3.37154 | -4.40684 |
Top |
Vaccine Design for the FusionNeoAntigens of AKT1-ITPK1 |
| mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 11 | 20 | QTRKRGMEV | AACGAGGAAGCGAGGGATGGAGGTTGT |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 12 | 21 | TRKRGMEVV | GAGGAAGCGAGGGATGGAGGTTGTGCA |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 9 | 18 | AAQTRKRGM | TGCACAAACGAGGAAGCGAGGGATGGA |
| mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 3 | 18 | YCEGGLAAQTRKRGM | TTGTGAAGGAGGGTTGGCTGCACAAACGAGGAAGCGAGGGATGGA |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 4 | 19 | CEGGLAAQTRKRGME | TGAAGGAGGGTTGGCTGCACAAACGAGGAAGCGAGGGATGGAGGT |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 5 | 20 | EGGLAAQTRKRGMEV | AGGAGGGTTGGCTGCACAAACGAGGAAGCGAGGGATGGAGGTTGT |
| AKT1-ITPK1 | chr14 | 105258935 | chr14 | 93542964 | 6 | 21 | GGLAAQTRKRGMEVV | AGGGTTGGCTGCACAAACGAGGAAGCGAGGGATGGAGGTTGTGCA |
Top |
Information of the samples that have these potential fusion neoantigens of AKT1-ITPK1 |
| These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens. |
| Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
| STAD | AKT1-ITPK1 | chr14 | 105258935 | ENST00000402615 | chr14 | 93542964 | ENST00000267615 | TCGA-HU-A4GN-01A |
Top |
Potential target of CAR-T therapy development for AKT1-ITPK1 |
| Predicted 3D structure. We used RoseTTAFold. |
| Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features * Minus value of BPloci means that the break point is located before the CDS. |
| - In-frame and retained 'Transmembrane'. |
| Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
| Subcellular localization prediction of the transmembrane domain retained fusion proteins * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
| Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to AKT1-ITPK1 |
| Drugs used for this fusion-positive patient. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to AKT1-ITPK1 |
| Diseases that have this fusion gene. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Disease | Source | PMID |
| Diseases associated with fusion partners. (DisGeNet 4.0) |
| Partner | Gene | Disease ID | Disease name | # pubmeds | Source |
Copyright 2023-PresentThe University of Texas Health Science Center at Houston (UTHealth)
Web File Viewing | Emergency Information
Campus Carry|Site Policies