|
Fusion Protein:HIVEP3-LRP8 |
Fusion Gene and Fusion Protein Summary |
Fusion gene summary |
Fusion partner gene information | Fusion gene name: HIVEP3-LRP8 | FusionPDB ID: 36558 | FusionGDB2.0 ID: 36558 | Hgene | Tgene | Gene symbol | HIVEP3 | LRP8 | Gene ID | 59269 | 7804 |
Gene name | HIVEP zinc finger 3 | LDL receptor related protein 8 | |
Synonyms | KBP-1|KBP1|KRC|SHN3|Schnurri-3|ZAS3|ZNF40C | APOER2|HSZ75190|LRP-8|MCI1 | |
Cytomap | 1p34.2 | 1p32.3 | |
Type of gene | protein-coding | protein-coding | |
Description | transcription factor HIVEP3ZAS family, member 3human immunodeficiency virus type I enhancer binding protein 3kappa-B and V(D)J recombination signal sequences-binding proteinkappa-binding protein 1zinc finger protein ZAS3 | low-density lipoprotein receptor-related protein 8ApoE receptor 2low density lipoprotein receptor-related protein 8, apolipoprotein e receptor | |
Modification date | 20200313 | 20200313 | |
UniProtAcc | Q5T1R4 Main function of 5'-partner protein: FUNCTION: Plays a role of transcription factor; binds to recognition signal sequences (Rss heptamer) for somatic recombination of immunoglobulin and T-cell receptor gene segments; Binds also to the kappa-B motif of gene such as S100A4, involved in cell progression and differentiation. Kappa-B motif is a gene regulatory element found in promoters and enhancers of genes involved in immunity, inflammation, and growth and that responds to viral antigens, mitogens, and cytokines. Involvement of HIVEP3 in cell growth is strengthened by the fact that its down-regulation promotes cell cycle progression with ultimate formation of multinucleated giant cells. Strongly inhibits TNF-alpha-induced NF-kappa-B activation; Interferes with nuclear factor NF-kappa-B by several mechanisms: as transcription factor, by competing for Kappa-B motif and by repressing transcription in the nucleus; through a non transcriptional process, by inhibiting nuclear translocation of RELA by association with TRAF2, an adapter molecule in the tumor necrosis factor signaling, which blocks the formation of IKK complex. Interaction with TRAF proteins inhibits both NF-Kappa-B-mediated and c-Jun N-terminal kinase/JNK-mediated responses that include apoptosis and proinflammatory cytokine gene expression. Positively regulates the expression of IL2 in T-cell. Essential regulator of adult bone formation. {ECO:0000269|PubMed:11161801}. | Q14114 Main function of 5'-partner protein: FUNCTION: Cell surface receptor for Reelin (RELN) and apolipoprotein E (apoE)-containing ligands. LRP8 participates in transmitting the extracellular Reelin signal to intracellular signaling processes, by binding to DAB1 on its cytoplasmic tail. Reelin acts via both the VLDL receptor (VLDLR) and LRP8 to regulate DAB1 tyrosine phosphorylation and microtubule function in neurons. LRP8 has higher affinity for Reelin than VLDLR. LRP8 is thus a key component of the Reelin pathway which governs neuronal layering of the forebrain during embryonic brain development. Binds the endoplasmic reticulum resident receptor-associated protein (RAP). Binds dimers of beta 2-glycoprotein I and may be involved in the suppression of platelet aggregation in the vasculature. Highly expressed in the initial segment of the epididymis, where it affects the functional expression of clusterin and phospholipid hydroperoxide glutathione peroxidase (PHGPx), two proteins required for sperm maturation. May also function as an endocytic receptor. Not required for endocytic uptake of SEPP1 in the kidney which is mediated by LRP2 (By similarity). Together with its ligand, apolipoprotein E (apoE), may indirectly play a role in the suppression of the innate immune response by controlling the survival of myeloid-derived suppressor cells (By similarity). {ECO:0000250|UniProtKB:Q924X6, ECO:0000269|PubMed:12807892, ECO:0000269|PubMed:12899622, ECO:0000269|PubMed:12950167}. | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000247584, ENST00000372583, ENST00000372584, ENST00000429157, ENST00000460604, | ENST00000347547, ENST00000354412, ENST00000465675, ENST00000460214, ENST00000306052, ENST00000371454, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 21 X 18 X 10=3780 | 4 X 3 X 4=48 |
# samples | 25 | 4 | |
** MAII score | log2(25/3780*10)=-3.91838623444635 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(4/48*10)=-0.263034405833794 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
Fusion gene context | PubMed: HIVEP3 [Title/Abstract] AND LRP8 [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: HIVEP3 [Title/Abstract] AND LRP8 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | HIVEP3(42041214)-LRP8(53792664), # samples:1 | ||
Anticipated loss of major functional domain due to fusion event. | HIVEP3-LRP8 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. HIVEP3-LRP8 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. HIVEP3-LRP8 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. HIVEP3-LRP8 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. HIVEP3-LRP8 seems lost the major protein functional domain in Hgene partner, which is a transcription factor due to the frame-shifted ORF. HIVEP3-LRP8 seems lost the major protein functional domain in Hgene partner, which is a tumor suppressor due to the frame-shifted ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
Partner | Gene | GO ID | GO term | PubMed ID |
Hgene | HIVEP3 | GO:0045893 | positive regulation of transcription, DNA-templated | 15790681 |
Tgene | LRP8 | GO:0006897 | endocytosis | 8626535 |
Four levels of functional features of fusion genes Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr1:42041214/chr1:53792664) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here. |
Fusion gene breakpoints across HIVEP3 (5'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
Fusion gene breakpoints across LRP8 (3'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
Top |
Fusion Amino Acid Sequences |
Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB. |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000372583 | HIVEP3 | chr1 | 42041214 | - | ENST00000306052 | LRP8 | chr1 | 53792664 | - | 10334 | 6093 | 886 | 6180 | 1764 |
ENST00000372583 | HIVEP3 | chr1 | 42041214 | - | ENST00000371454 | LRP8 | chr1 | 53792664 | - | 9149 | 6093 | 886 | 6180 | 1764 |
DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated. |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000372583 | ENST00000306052 | HIVEP3 | chr1 | 42041214 | - | LRP8 | chr1 | 53792664 | - | 0.005030297 | 0.99496967 |
ENST00000372583 | ENST00000371454 | HIVEP3 | chr1 | 42041214 | - | LRP8 | chr1 | 53792664 | - | 0.007761939 | 0.9922381 |
Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones. |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for HIVEP3-LRP8 |
+/-13 AA sequence from the breakpoints of the fusion protein sequences. |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
HIVEP3 | chr1 | 42041214 | LRP8 | chr1 | 53792664 | 6093 | 1736 | RGEPARIKIFEGGAGQGLRKGPIPVP |
Top |
Potential FusionNeoAntigen Information of HIVEP3-LRP8 in HLA I |
Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
HIVEP3-LRP8_42041214_53792664.msa |
Potential FusionNeoAntigen Information * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | HLA-B40:01 | FEGGAGQGL | 0.9879 | 0.6605 | 9 | 18 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | HLA-B40:05 | FEGGAGQGL | 0.4977 | 0.5408 | 9 | 18 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | HLA-B39:13 | FEGGAGQGL | 0.3253 | 0.9716 | 9 | 18 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | HLA-B48:03 | FEGGAGQGL | 0.976 | 0.6509 | 9 | 18 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | HLA-B39:08 | FEGGAGQGL | 0.4686 | 0.9586 | 9 | 18 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | HLA-C04:10 | IFEGGAGQGL | 0.9993 | 0.9305 | 8 | 18 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | HLA-B40:04 | FEGGAGQGL | 0.99 | 0.8639 | 9 | 18 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | HLA-B40:36 | FEGGAGQGL | 0.9876 | 0.673 | 9 | 18 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | HLA-B40:49 | FEGGAGQGL | 0.9874 | 0.6468 | 9 | 18 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | HLA-B40:12 | FEGGAGQGL | 0.976 | 0.6509 | 9 | 18 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | HLA-B39:02 | FEGGAGQGL | 0.4039 | 0.9721 | 9 | 18 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | HLA-B41:03 | FEGGAGQGL | 0.2934 | 0.8184 | 9 | 18 |
Top |
Potential FusionNeoAntigen Information of HIVEP3-LRP8 in HLA II |
Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
HIVEP3-LRP8_42041214_53792664.msa |
Potential FusionNeoAntigen Information * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-0415 | EPARIKIFEGGAGQG | 2 | 17 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-0436 | EPARIKIFEGGAGQG | 2 | 17 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-0442 | EPARIKIFEGGAGQG | 2 | 17 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-0442 | PARIKIFEGGAGQGL | 3 | 18 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-0473 | EPARIKIFEGGAGQG | 2 | 17 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-0473 | PARIKIFEGGAGQGL | 3 | 18 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1501 | EPARIKIFEGGAGQG | 2 | 17 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1501 | PARIKIFEGGAGQGL | 3 | 18 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1501 | GEPARIKIFEGGAGQ | 1 | 16 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1503 | EPARIKIFEGGAGQG | 2 | 17 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1503 | PARIKIFEGGAGQGL | 3 | 18 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1504 | EPARIKIFEGGAGQG | 2 | 17 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1504 | PARIKIFEGGAGQGL | 3 | 18 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1504 | GEPARIKIFEGGAGQ | 1 | 16 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1504 | ARIKIFEGGAGQGLR | 4 | 19 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1505 | EPARIKIFEGGAGQG | 2 | 17 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1505 | PARIKIFEGGAGQGL | 3 | 18 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1505 | GEPARIKIFEGGAGQ | 1 | 16 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1506 | EPARIKIFEGGAGQG | 2 | 17 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1506 | PARIKIFEGGAGQGL | 3 | 18 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1506 | GEPARIKIFEGGAGQ | 1 | 16 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1507 | EPARIKIFEGGAGQG | 2 | 17 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1507 | PARIKIFEGGAGQGL | 3 | 18 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1507 | GEPARIKIFEGGAGQ | 1 | 16 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1509 | EPARIKIFEGGAGQG | 2 | 17 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1509 | PARIKIFEGGAGQGL | 3 | 18 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1509 | GEPARIKIFEGGAGQ | 1 | 16 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1510 | EPARIKIFEGGAGQG | 2 | 17 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1510 | PARIKIFEGGAGQGL | 3 | 18 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1512 | EPARIKIFEGGAGQG | 2 | 17 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1512 | PARIKIFEGGAGQGL | 3 | 18 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1513 | EPARIKIFEGGAGQG | 2 | 17 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1513 | PARIKIFEGGAGQGL | 3 | 18 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1513 | GEPARIKIFEGGAGQ | 1 | 16 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1515 | EPARIKIFEGGAGQG | 2 | 17 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1515 | PARIKIFEGGAGQGL | 3 | 18 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1516 | EPARIKIFEGGAGQG | 2 | 17 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1516 | PARIKIFEGGAGQGL | 3 | 18 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1516 | GEPARIKIFEGGAGQ | 1 | 16 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1518 | EPARIKIFEGGAGQG | 2 | 17 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1518 | PARIKIFEGGAGQGL | 3 | 18 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1518 | GEPARIKIFEGGAGQ | 1 | 16 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1520 | EPARIKIFEGGAGQG | 2 | 17 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1520 | PARIKIFEGGAGQGL | 3 | 18 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1520 | GEPARIKIFEGGAGQ | 1 | 16 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1521 | EPARIKIFEGGAGQG | 2 | 17 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1521 | PARIKIFEGGAGQGL | 3 | 18 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1521 | GEPARIKIFEGGAGQ | 1 | 16 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1522 | EPARIKIFEGGAGQG | 2 | 17 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1522 | PARIKIFEGGAGQGL | 3 | 18 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1522 | GEPARIKIFEGGAGQ | 1 | 16 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1523 | EPARIKIFEGGAGQG | 2 | 17 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1523 | PARIKIFEGGAGQGL | 3 | 18 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1524 | EPARIKIFEGGAGQG | 2 | 17 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1524 | PARIKIFEGGAGQGL | 3 | 18 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1524 | GEPARIKIFEGGAGQ | 1 | 16 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1528 | EPARIKIFEGGAGQG | 2 | 17 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1528 | PARIKIFEGGAGQGL | 3 | 18 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1528 | GEPARIKIFEGGAGQ | 1 | 16 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1531 | EPARIKIFEGGAGQG | 2 | 17 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1532 | EPARIKIFEGGAGQG | 2 | 17 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1532 | PARIKIFEGGAGQGL | 3 | 18 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1532 | GEPARIKIFEGGAGQ | 1 | 16 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1533 | EPARIKIFEGGAGQG | 2 | 17 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1533 | PARIKIFEGGAGQGL | 3 | 18 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1533 | GEPARIKIFEGGAGQ | 1 | 16 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1535 | EPARIKIFEGGAGQG | 2 | 17 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1535 | PARIKIFEGGAGQGL | 3 | 18 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1535 | GEPARIKIFEGGAGQ | 1 | 16 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1536 | EPARIKIFEGGAGQG | 2 | 17 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1536 | PARIKIFEGGAGQGL | 3 | 18 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1536 | GEPARIKIFEGGAGQ | 1 | 16 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1537 | EPARIKIFEGGAGQG | 2 | 17 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1537 | PARIKIFEGGAGQGL | 3 | 18 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1537 | GEPARIKIFEGGAGQ | 1 | 16 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1540 | EPARIKIFEGGAGQG | 2 | 17 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1540 | PARIKIFEGGAGQGL | 3 | 18 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1540 | GEPARIKIFEGGAGQ | 1 | 16 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1541 | EPARIKIFEGGAGQG | 2 | 17 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1541 | PARIKIFEGGAGQGL | 3 | 18 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1541 | GEPARIKIFEGGAGQ | 1 | 16 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1542 | EPARIKIFEGGAGQG | 2 | 17 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1542 | PARIKIFEGGAGQGL | 3 | 18 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1542 | GEPARIKIFEGGAGQ | 1 | 16 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1543 | EPARIKIFEGGAGQG | 2 | 17 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1543 | PARIKIFEGGAGQGL | 3 | 18 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1543 | GEPARIKIFEGGAGQ | 1 | 16 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1545 | EPARIKIFEGGAGQG | 2 | 17 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1545 | PARIKIFEGGAGQGL | 3 | 18 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1545 | GEPARIKIFEGGAGQ | 1 | 16 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1546 | EPARIKIFEGGAGQG | 2 | 17 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1546 | PARIKIFEGGAGQGL | 3 | 18 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1546 | GEPARIKIFEGGAGQ | 1 | 16 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1548 | EPARIKIFEGGAGQG | 2 | 17 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1548 | PARIKIFEGGAGQGL | 3 | 18 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1548 | GEPARIKIFEGGAGQ | 1 | 16 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1549 | EPARIKIFEGGAGQG | 2 | 17 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1549 | PARIKIFEGGAGQGL | 3 | 18 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1549 | GEPARIKIFEGGAGQ | 1 | 16 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1615 | EPARIKIFEGGAGQG | 2 | 17 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1615 | PARIKIFEGGAGQGL | 3 | 18 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB1-1615 | GEPARIKIFEGGAGQ | 1 | 16 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB5-0202 | EPARIKIFEGGAGQG | 2 | 17 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB5-0202 | PARIKIFEGGAGQGL | 3 | 18 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB5-0204 | EPARIKIFEGGAGQG | 2 | 17 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB5-0204 | PARIKIFEGGAGQGL | 3 | 18 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB5-0204 | GEPARIKIFEGGAGQ | 1 | 16 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB5-0204 | ARIKIFEGGAGQGLR | 4 | 19 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB5-0205 | EPARIKIFEGGAGQG | 2 | 17 |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 | DRB5-0205 | PARIKIFEGGAGQGL | 3 | 18 |
Top |
Fusion breakpoint peptide structures of HIVEP3-LRP8 |
3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
3760 | IKIFEGGAGQGLRK | HIVEP3 | LRP8 | chr1 | 42041214 | chr1 | 53792664 | 6093 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of HIVEP3-LRP8 |
Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 3760 | IKIFEGGAGQGLRK | -7.15543 | -7.26883 |
HLA-B14:02 | 3BVN | 3760 | IKIFEGGAGQGLRK | -4.77435 | -5.80965 |
HLA-B52:01 | 3W39 | 3760 | IKIFEGGAGQGLRK | -6.80875 | -6.92215 |
HLA-B52:01 | 3W39 | 3760 | IKIFEGGAGQGLRK | -4.20386 | -5.23916 |
HLA-A11:01 | 4UQ2 | 3760 | IKIFEGGAGQGLRK | -7.5194 | -8.5547 |
HLA-A11:01 | 4UQ2 | 3760 | IKIFEGGAGQGLRK | -6.9601 | -7.0735 |
HLA-A24:02 | 5HGA | 3760 | IKIFEGGAGQGLRK | -7.52403 | -7.63743 |
HLA-A24:02 | 5HGA | 3760 | IKIFEGGAGQGLRK | -5.82433 | -6.85963 |
HLA-B27:05 | 6PYJ | 3760 | IKIFEGGAGQGLRK | -3.28285 | -4.31815 |
HLA-B44:05 | 3DX8 | 3760 | IKIFEGGAGQGLRK | -5.91172 | -6.94702 |
HLA-B44:05 | 3DX8 | 3760 | IKIFEGGAGQGLRK | -4.24346 | -4.35686 |
Top |
Vaccine Design for the FusionNeoAntigens of HIVEP3-LRP8 |
mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is. |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 8 | 18 | IFEGGAGQGL | AATCTTCGAAGGAGGGGCCGGCCAAGGATT |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 9 | 18 | FEGGAGQGL | CTTCGAAGGAGGGGCCGGCCAAGGATT |
mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs. |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 1 | 16 | GEPARIKIFEGGAGQ | AGGGGAGCCGGCGAGGATCAAAATCTTCGAAGGAGGGGCCGGCCA |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 2 | 17 | EPARIKIFEGGAGQG | GGAGCCGGCGAGGATCAAAATCTTCGAAGGAGGGGCCGGCCAAGG |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 3 | 18 | PARIKIFEGGAGQGL | GCCGGCGAGGATCAAAATCTTCGAAGGAGGGGCCGGCCAAGGATT |
HIVEP3-LRP8 | chr1 | 42041214 | chr1 | 53792664 | 4 | 19 | ARIKIFEGGAGQGLR | GGCGAGGATCAAAATCTTCGAAGGAGGGGCCGGCCAAGGATTGCG |
Top |
Information of the samples that have these potential fusion neoantigens of HIVEP3-LRP8 |
These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens. |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
ESCA | HIVEP3-LRP8 | chr1 | 42041214 | ENST00000372583 | chr1 | 53792664 | ENST00000306052 | TCGA-IG-A51D |
Top |
Potential target of CAR-T therapy development for HIVEP3-LRP8 |
Predicted 3D structure. We used RoseTTAFold. |
Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
Tgene | LRP8 | chr1:42041214 | chr1:53792664 | ENST00000306052 | 0 | 19 | 827_847 | 0 | 964.0 | Transmembrane | Helical | |
Tgene | LRP8 | chr1:42041214 | chr1:53792664 | ENST00000347547 | 0 | 17 | 827_847 | 0 | 794.0 | Transmembrane | Helical | |
Tgene | LRP8 | chr1:42041214 | chr1:53792664 | ENST00000354412 | 0 | 16 | 827_847 | 0 | 701.0 | Transmembrane | Helical | |
Tgene | LRP8 | chr1:42041214 | chr1:53792664 | ENST00000371454 | 0 | 18 | 827_847 | 0 | 905.0 | Transmembrane | Helical |
Subcellular localization prediction of the transmembrane domain retained fusion proteins * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to HIVEP3-LRP8 |
Drugs used for this fusion-positive patient. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to HIVEP3-LRP8 |
Diseases that have this fusion gene. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
Diseases associated with fusion partners. (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |