Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:HNF1B-ANAPC16

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: HNF1B-ANAPC16
	FusionPDB ID: 37002
	FusionGDB2.0 ID: 37002
		Hgene	Tgene
	Gene symbol	HNF1B	ANAPC16
	Gene ID	6928	119504
	Gene name	HNF1 homeobox B	anaphase promoting complex subunit 16
	Synonyms	FJHN\|HNF-1-beta\|HNF-1B\|HNF1beta\|HNF2\|HPC11\|LF-B3\|LFB3\|MODY5\|TCF-2\|TCF2\|VHNF1	APC16\|C10orf104\|CENP-27\|MSAG\|bA570G20.3
	Cytomap	17q12	10q22.1
	Type of gene	protein-coding	protein-coding
	Description	hepatocyte nuclear factor 1-betaHNF1 beta Ahomeoprotein LFB3transcription factor 2, hepatic	anaphase-promoting complex subunit 16centromere protein 27cyclosome subunit 16metabolic syndrome-associated protein
	Modification date	20200313	20200313
	UniProtAcc	P35680 Main function of 5'-partner protein: FUNCTION: Transcription factor, probably binds to the inverted palindrome 5'-GTTAATNATTAAC-3'.	Q96DE5 Main function of 5'-partner protein: FUNCTION: Component of the anaphase promoting complex/cyclosome (APC/C), a cell cycle-regulated E3 ubiquitin ligase that controls progression through mitosis and the G1 phase of the cell cycle. The APC/C complex acts by mediating ubiquitination and subsequent degradation of target proteins: it mainly mediates the formation of 'Lys-11'-linked polyubiquitin chains and, to a lower extent, the formation of 'Lys-48'- and 'Lys-63'-linked polyubiquitin chains. {ECO:0000269\|PubMed:20360068}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000225893, ENST00000427275, ENST00000560016, ENST00000561193,	ENST00000470481, ENST00000299381,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	10 X 10 X 8=800	8 X 6 X 5=240
	# samples	10	10
	** MAII score	log2(10/800*10)=-3 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(10/240*10)=-1.26303440583379 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: HNF1B [Title/Abstract] AND ANAPC16 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: HNF1B [Title/Abstract] AND ANAPC16 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	HNF1B(36091586)-ANAPC16(73990124), # samples:2
Anticipated loss of major functional domain due to fusion event.	HNF1B-ANAPC16 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. HNF1B-ANAPC16 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. HNF1B-ANAPC16 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. HNF1B-ANAPC16 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	HNF1B	GO:0001822	kidney development	21281489
Hgene	HNF1B	GO:0045893	positive regulation of transcription, DNA-templated	16297991\|21281489
Hgene	HNF1B	GO:0060261	positive regulation of transcription initiation from RNA polymerase II promoter	15355349
Tgene	ANAPC16	GO:0016567	protein ubiquitination	20360068

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr17:36091586/chr10:73990124)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across HNF1B (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across ANAPC16 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000225893	HNF1B	chr17	36091586	-	ENST00000299381	ANAPC16	chr10	73990124	+	4342	1407	362	1597	411
ENST00000561193	HNF1B	chr17	36091586	-	ENST00000299381	ANAPC16	chr10	73990124	+	4077	1142	175	1332	385
ENST00000560016	HNF1B	chr17	36091586	-	ENST00000299381	ANAPC16	chr10	73990124	+	4114	1179	134	1369	411
ENST00000427275	HNF1B	chr17	36091586	-	ENST00000299381	ANAPC16	chr10	73990124	+	4036	1101	134	1291	385

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000225893	ENST00000299381	HNF1B	chr17	36091586	-	ANAPC16	chr10	73990124	+	0.000911174	0.9990889
ENST00000561193	ENST00000299381	HNF1B	chr17	36091586	-	ANAPC16	chr10	73990124	+	0.00087509	0.99912494
ENST00000560016	ENST00000299381	HNF1B	chr17	36091586	-	ANAPC16	chr10	73990124	+	0.000820565	0.9991794
ENST00000427275	ENST00000299381	HNF1B	chr17	36091586	-	ANAPC16	chr10	73990124	+	0.000864417	0.99913555

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for HNF1B-ANAPC16

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
HNF1B	chr17	36091586	ANAPC16	chr10	73990124	1101	322	HHQPSSSPPNKLSDGSERFLCESVFS
HNF1B	chr17	36091586	ANAPC16	chr10	73990124	1142	322	HHQPSSSPPNKLSDGSERFLCESVFS
HNF1B	chr17	36091586	ANAPC16	chr10	73990124	1179	348	HHQPSSSPPNKLSDGSERFLCESVFS
HNF1B	chr17	36091586	ANAPC16	chr10	73990124	1407	348	HHQPSSSPPNKLSDGSERFLCESVFS

Top

Potential FusionNeoAntigen Information of HNF1B-ANAPC16 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

HNF1B-ANAPC16_36091586_73990124.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
HNF1B-ANAPC16	chr17	36091586	chr10	73990124	1407	HLA-B15:01	KLSDGSERF	0.9948	0.8692	10	19
HNF1B-ANAPC16	chr17	36091586	chr10	73990124	1407	HLA-B15:25	KLSDGSERF	0.9	0.9079	10	19
HNF1B-ANAPC16	chr17	36091586	chr10	73990124	1407	HLA-A32:13	KLSDGSERF	0.857	0.8593	10	19
HNF1B-ANAPC16	chr17	36091586	chr10	73990124	1407	HLA-B15:03	KLSDGSERF	0.6266	0.7111	10	19
HNF1B-ANAPC16	chr17	36091586	chr10	73990124	1407	HLA-B13:01	KLSDGSERF	0.0052	0.8958	10	19
HNF1B-ANAPC16	chr17	36091586	chr10	73990124	1407	HLA-A02:27	KLSDGSERFL	0.9599	0.5365	10	20
HNF1B-ANAPC16	chr17	36091586	chr10	73990124	1407	HLA-A02:67	KLSDGSERFL	0.957	0.6095	10	20
HNF1B-ANAPC16	chr17	36091586	chr10	73990124	1407	HLA-A02:30	KLSDGSERFL	0.957	0.6095	10	20
HNF1B-ANAPC16	chr17	36091586	chr10	73990124	1407	HLA-A02:24	KLSDGSERFL	0.957	0.6095	10	20
HNF1B-ANAPC16	chr17	36091586	chr10	73990124	1407	HLA-A02:60	KLSDGSERFL	0.9549	0.5178	10	20
HNF1B-ANAPC16	chr17	36091586	chr10	73990124	1407	HLA-A02:16	KLSDGSERFL	0.9293	0.5093	10	20
HNF1B-ANAPC16	chr17	36091586	chr10	73990124	1407	HLA-A02:29	KLSDGSERFL	0.8058	0.6104	10	20
HNF1B-ANAPC16	chr17	36091586	chr10	73990124	1407	HLA-A02:20	KLSDGSERFL	0.7902	0.614	10	20
HNF1B-ANAPC16	chr17	36091586	chr10	73990124	1407	HLA-C08:15	LSDGSERF	1	0.9406	11	19
HNF1B-ANAPC16	chr17	36091586	chr10	73990124	1407	HLA-C05:09	LSDGSERF	1	0.8946	11	19
HNF1B-ANAPC16	chr17	36091586	chr10	73990124	1407	HLA-C04:10	LSDGSERFL	0.9999	0.7997	11	20
HNF1B-ANAPC16	chr17	36091586	chr10	73990124	1407	HLA-C05:09	LSDGSERFL	0.9999	0.9306	11	20
HNF1B-ANAPC16	chr17	36091586	chr10	73990124	1407	HLA-C04:07	LSDGSERFL	0.9998	0.803	11	20
HNF1B-ANAPC16	chr17	36091586	chr10	73990124	1407	HLA-C08:15	LSDGSERFL	0.9998	0.9733	11	20
HNF1B-ANAPC16	chr17	36091586	chr10	73990124	1407	HLA-C03:07	LSDGSERFL	0.9975	0.9701	11	20
HNF1B-ANAPC16	chr17	36091586	chr10	73990124	1407	HLA-C03:19	LSDGSERFL	0.9957	0.9886	11	20
HNF1B-ANAPC16	chr17	36091586	chr10	73990124	1407	HLA-C15:06	LSDGSERFL	0.9949	0.9518	11	20
HNF1B-ANAPC16	chr17	36091586	chr10	73990124	1407	HLA-B15:07	KLSDGSERF	0.9933	0.6067	10	19
HNF1B-ANAPC16	chr17	36091586	chr10	73990124	1407	HLA-C04:06	LSDGSERFL	0.9902	0.7791	11	20
HNF1B-ANAPC16	chr17	36091586	chr10	73990124	1407	HLA-C03:08	LSDGSERFL	0.9809	0.8355	11	20
HNF1B-ANAPC16	chr17	36091586	chr10	73990124	1407	HLA-C08:04	LSDGSERFL	0.9315	0.9531	11	20
HNF1B-ANAPC16	chr17	36091586	chr10	73990124	1407	HLA-C08:13	LSDGSERFL	0.9315	0.9531	11	20
HNF1B-ANAPC16	chr17	36091586	chr10	73990124	1407	HLA-C08:03	LSDGSERFL	0.6676	0.9895	11	20
HNF1B-ANAPC16	chr17	36091586	chr10	73990124	1407	HLA-B15:05	KLSDGSERF	0.4663	0.8727	10	19
HNF1B-ANAPC16	chr17	36091586	chr10	73990124	1407	HLA-A02:01	KLSDGSERFL	0.957	0.6095	10	20
HNF1B-ANAPC16	chr17	36091586	chr10	73990124	1407	HLA-C08:02	LSDGSERF	1	0.9406	11	19
HNF1B-ANAPC16	chr17	36091586	chr10	73990124	1407	HLA-C05:01	LSDGSERF	1	0.8946	11	19
HNF1B-ANAPC16	chr17	36091586	chr10	73990124	1407	HLA-C04:03	LSDGSERF	1	0.7247	11	19
HNF1B-ANAPC16	chr17	36091586	chr10	73990124	1407	HLA-C04:03	LSDGSERFL	0.9999	0.8344	11	20
HNF1B-ANAPC16	chr17	36091586	chr10	73990124	1407	HLA-C05:01	LSDGSERFL	0.9999	0.9306	11	20
HNF1B-ANAPC16	chr17	36091586	chr10	73990124	1407	HLA-C04:01	LSDGSERFL	0.9998	0.803	11	20
HNF1B-ANAPC16	chr17	36091586	chr10	73990124	1407	HLA-C08:02	LSDGSERFL	0.9998	0.9733	11	20
HNF1B-ANAPC16	chr17	36091586	chr10	73990124	1407	HLA-C18:01	LSDGSERFL	0.9998	0.8282	11	20
HNF1B-ANAPC16	chr17	36091586	chr10	73990124	1407	HLA-C01:03	LSDGSERFL	0.9997	0.9342	11	20
HNF1B-ANAPC16	chr17	36091586	chr10	73990124	1407	HLA-B15:50	KLSDGSERF	0.9951	0.8473	10	19
HNF1B-ANAPC16	chr17	36091586	chr10	73990124	1407	HLA-B15:135	KLSDGSERF	0.995	0.8688	10	19
HNF1B-ANAPC16	chr17	36091586	chr10	73990124	1407	HLA-B15:33	KLSDGSERF	0.9948	0.8692	10	19
HNF1B-ANAPC16	chr17	36091586	chr10	73990124	1407	HLA-B15:27	KLSDGSERF	0.9948	0.8853	10	19
HNF1B-ANAPC16	chr17	36091586	chr10	73990124	1407	HLA-B15:125	KLSDGSERF	0.9948	0.8692	10	19
HNF1B-ANAPC16	chr17	36091586	chr10	73990124	1407	HLA-B15:34	KLSDGSERF	0.9948	0.8692	10	19
HNF1B-ANAPC16	chr17	36091586	chr10	73990124	1407	HLA-C15:05	LSDGSERFL	0.9941	0.922	11	20
HNF1B-ANAPC16	chr17	36091586	chr10	73990124	1407	HLA-B15:24	KLSDGSERF	0.9939	0.8864	10	19
HNF1B-ANAPC16	chr17	36091586	chr10	73990124	1407	HLA-B15:35	KLSDGSERF	0.993	0.8311	10	19
HNF1B-ANAPC16	chr17	36091586	chr10	73990124	1407	HLA-B15:12	KLSDGSERF	0.9923	0.7951	10	19
HNF1B-ANAPC16	chr17	36091586	chr10	73990124	1407	HLA-C03:04	LSDGSERFL	0.9912	0.9859	11	20
HNF1B-ANAPC16	chr17	36091586	chr10	73990124	1407	HLA-C03:03	LSDGSERFL	0.9912	0.9859	11	20
HNF1B-ANAPC16	chr17	36091586	chr10	73990124	1407	HLA-C15:02	LSDGSERFL	0.9901	0.9287	11	20
HNF1B-ANAPC16	chr17	36091586	chr10	73990124	1407	HLA-B15:53	KLSDGSERF	0.9764	0.8345	10	19
HNF1B-ANAPC16	chr17	36091586	chr10	73990124	1407	HLA-A32:01	KLSDGSERF	0.9633	0.8444	10	19
HNF1B-ANAPC16	chr17	36091586	chr10	73990124	1407	HLA-C03:06	LSDGSERFL	0.9177	0.9914	11	20
HNF1B-ANAPC16	chr17	36091586	chr10	73990124	1407	HLA-B15:39	KLSDGSERF	0.912	0.7961	10	19
HNF1B-ANAPC16	chr17	36091586	chr10	73990124	1407	HLA-B15:54	KLSDGSERF	0.8371	0.8038	10	19
HNF1B-ANAPC16	chr17	36091586	chr10	73990124	1407	HLA-B15:73	KLSDGSERF	0.7612	0.7384	10	19
HNF1B-ANAPC16	chr17	36091586	chr10	73990124	1407	HLA-C08:01	LSDGSERFL	0.6676	0.9895	11	20
HNF1B-ANAPC16	chr17	36091586	chr10	73990124	1407	HLA-B15:30	KLSDGSERF	0.4809	0.6174	10	19
HNF1B-ANAPC16	chr17	36091586	chr10	73990124	1407	HLA-B15:20	KLSDGSERF	0.465	0.9184	10	19
HNF1B-ANAPC16	chr17	36091586	chr10	73990124	1407	HLA-B35:28	KLSDGSERF	0.4207	0.9198	10	19
HNF1B-ANAPC16	chr17	36091586	chr10	73990124	1407	HLA-C17:01	LSDGSERFL	0.3865	0.8828	11	20
HNF1B-ANAPC16	chr17	36091586	chr10	73990124	1407	HLA-B07:13	LSDGSERFL	0.0045	0.7168	11	20

Top

Potential FusionNeoAntigen Information of HNF1B-ANAPC16 in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of HNF1B-ANAPC16

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
8892	SPPNKLSDGSERFL	HNF1B	ANAPC16	chr17	36091586	chr10	73990124	1407

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of HNF1B-ANAPC16

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	8892	SPPNKLSDGSERFL	-7.15543	-7.26883
HLA-B14:02	3BVN	8892	SPPNKLSDGSERFL	-4.77435	-5.80965
HLA-B52:01	3W39	8892	SPPNKLSDGSERFL	-6.80875	-6.92215
HLA-B52:01	3W39	8892	SPPNKLSDGSERFL	-4.20386	-5.23916
HLA-A11:01	4UQ2	8892	SPPNKLSDGSERFL	-7.5194	-8.5547
HLA-A11:01	4UQ2	8892	SPPNKLSDGSERFL	-6.9601	-7.0735
HLA-A24:02	5HGA	8892	SPPNKLSDGSERFL	-7.52403	-7.63743
HLA-A24:02	5HGA	8892	SPPNKLSDGSERFL	-5.82433	-6.85963
HLA-B27:05	6PYJ	8892	SPPNKLSDGSERFL	-3.28285	-4.31815
HLA-B44:05	3DX8	8892	SPPNKLSDGSERFL	-5.91172	-6.94702
HLA-B44:05	3DX8	8892	SPPNKLSDGSERFL	-4.24346	-4.35686

Top

Vaccine Design for the FusionNeoAntigens of HNF1B-ANAPC16

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
HNF1B-ANAPC16	chr17	36091586	chr10	73990124	10	19	KLSDGSERF	AGCTGTCAGATGGCTCTGAGAGATTCC
HNF1B-ANAPC16	chr17	36091586	chr10	73990124	10	20	KLSDGSERFL	AGCTGTCAGATGGCTCTGAGAGATTCCTCT
HNF1B-ANAPC16	chr17	36091586	chr10	73990124	11	19	LSDGSERF	TGTCAGATGGCTCTGAGAGATTCC
HNF1B-ANAPC16	chr17	36091586	chr10	73990124	11	20	LSDGSERFL	TGTCAGATGGCTCTGAGAGATTCCTCT

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of HNF1B-ANAPC16

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
KIRC	HNF1B-ANAPC16	chr17	36091586	ENST00000225893	chr10	73990124	ENST00000299381	TCGA-CJ-4920-01A

Top

Potential target of CAR-T therapy development for HNF1B-ANAPC16

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to HNF1B-ANAPC16

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to HNF1B-ANAPC16

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)