![]() |
|||||||
|
Fusion Protein:HNRNPUL1-BRSK1 |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: HNRNPUL1-BRSK1 | FusionPDB ID: 37305 | FusionGDB2.0 ID: 37305 | Hgene | Tgene | Gene symbol | HNRNPUL1 | BRSK1 | Gene ID | 11100 | 84446 |
Gene name | heterogeneous nuclear ribonucleoprotein U like 1 | BR serine/threonine kinase 1 | |
Synonyms | E1B-AP5|E1BAP5|HNRPUL1 | hSAD1 | |
Cytomap | 19q13.2 | 19q13.42 | |
Type of gene | protein-coding | protein-coding | |
Description | heterogeneous nuclear ribonucleoprotein U-like protein 1E1B 55kDa associated protein 5E1B-55 kDa-associated protein 5adenovirus early region 1B-associated protein 5 | serine/threonine-protein kinase BRSK1BR serine/threonine-protein kinase 1SAD1 homologSAD1 kinaseSadB kinase short isoformbrain-selective kinase 1brain-specific serine/threonine-protein kinase 1protein kinase SAD1Aserine/threonine-protein kinase SA | |
Modification date | 20200327 | 20200313 | |
UniProtAcc | Q9BUJ2 Main function of 5'-partner protein: FUNCTION: Acts as a basic transcriptional regulator. Represses basic transcription driven by several virus and cellular promoters. When associated with BRD7, activates transcription of glucocorticoid-responsive promoter in the absence of ligand-stimulation. Plays also a role in mRNA processing and transport. Binds avidly to poly(G) and poly(C) RNA homopolymers in vitro. {ECO:0000269|PubMed:12489984, ECO:0000269|PubMed:9733834}. | Q8TDC3 Main function of 5'-partner protein: FUNCTION: Serine/threonine-protein kinase that plays a key role in polarization of neurons and centrosome duplication. Phosphorylates CDC25B, CDC25C, MAPT/TAU, RIMS1, TUBG1, TUBG2 and WEE1. Following phosphorylation and activation by STK11/LKB1, acts as a key regulator of polarization of cortical neurons, probably by mediating phosphorylation of microtubule-associated proteins such as MAPT/TAU at 'Thr-529' and 'Ser-579'. Also regulates neuron polarization by mediating phosphorylation of WEE1 at 'Ser-642' in postmitotic neurons, leading to down-regulate WEE1 activity in polarized neurons. In neurons, localizes to synaptic vesicles and plays a role in neurotransmitter release, possibly by phosphorylating RIMS1. Also acts as a positive regulator of centrosome duplication by mediating phosphorylation of gamma-tubulin (TUBG1 and TUBG2) at 'Ser-131', leading to translocation of gamma-tubulin and its associated proteins to the centrosome. Involved in the UV-induced DNA damage checkpoint response, probably by inhibiting CDK1 activity through phosphorylation and activation of WEE1, and inhibition of CDC25B and CDC25C. {ECO:0000269|PubMed:14976552, ECO:0000269|PubMed:15150265, ECO:0000269|PubMed:20026642, ECO:0000269|PubMed:21985311}. | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000263367, ENST00000352456, ENST00000392006, ENST00000593587, ENST00000595018, ENST00000602130, ENST00000378215, ENST00000594207, | ENST00000326848, ENST00000588584, ENST00000309383, ENST00000585418, ENST00000590333, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 18 X 14 X 12=3024 | 5 X 5 X 4=100 |
# samples | 20 | 5 | |
** MAII score | log2(20/3024*10)=-3.91838623444635 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(5/100*10)=-1 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
Fusion gene context | PubMed: HNRNPUL1 [Title/Abstract] AND BRSK1 [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: HNRNPUL1 [Title/Abstract] AND BRSK1 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | HNRNPUL1(41787180)-BRSK1(55795889), # samples:1 | ||
Anticipated loss of major functional domain due to fusion event. | HNRNPUL1-BRSK1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. HNRNPUL1-BRSK1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. HNRNPUL1-BRSK1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. HNRNPUL1-BRSK1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. HNRNPUL1-BRSK1 seems lost the major protein functional domain in Hgene partner, which is a essential gene due to the frame-shifted ORF. HNRNPUL1-BRSK1 seems lost the major protein functional domain in Tgene partner, which is a IUPHAR drug target due to the frame-shifted ORF. HNRNPUL1-BRSK1 seems lost the major protein functional domain in Tgene partner, which is a kinase due to the frame-shifted ORF. HNRNPUL1-BRSK1 seems lost the major protein functional domain in Tgene partner, which is a tumor suppressor due to the frame-shifted ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
Tgene | BRSK1 | GO:0000086 | G2/M transition of mitotic cell cycle | 15150265 |
Tgene | BRSK1 | GO:0006468 | protein phosphorylation | 15150265 |
Tgene | BRSK1 | GO:0006974 | cellular response to DNA damage stimulus | 15150265 |
Tgene | BRSK1 | GO:0007095 | mitotic G2 DNA damage checkpoint | 15150265 |
Tgene | BRSK1 | GO:0009411 | response to UV | 15150265 |
Tgene | BRSK1 | GO:0010212 | response to ionizing radiation | 15150265 |
Tgene | BRSK1 | GO:0018105 | peptidyl-serine phosphorylation | 15150265 |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr19:41787180/chr19:55795889) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000352456 | HNRNPUL1 | chr19 | 41787180 | + | ENST00000590333 | BRSK1 | chr19 | 55795889 | + | 3515 | 791 | 11 | 3049 | 1012 |
ENST00000595018 | HNRNPUL1 | chr19 | 41787180 | + | ENST00000590333 | BRSK1 | chr19 | 55795889 | + | 3492 | 768 | 45 | 3026 | 993 |
ENST00000392006 | HNRNPUL1 | chr19 | 41787180 | + | ENST00000590333 | BRSK1 | chr19 | 55795889 | + | 3896 | 1172 | 44 | 3430 | 1128 |
ENST00000602130 | HNRNPUL1 | chr19 | 41787180 | + | ENST00000590333 | BRSK1 | chr19 | 55795889 | + | 3776 | 1052 | 53 | 3310 | 1085 |
ENST00000593587 | HNRNPUL1 | chr19 | 41787180 | + | ENST00000590333 | BRSK1 | chr19 | 55795889 | + | 3517 | 793 | 94 | 3051 | 985 |
ENST00000263367 | HNRNPUL1 | chr19 | 41787180 | + | ENST00000590333 | BRSK1 | chr19 | 55795889 | + | 3650 | 926 | 161 | 3184 | 1007 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000352456 | ENST00000590333 | HNRNPUL1 | chr19 | 41787180 | + | BRSK1 | chr19 | 55795889 | + | 0.002145738 | 0.9978543 |
ENST00000595018 | ENST00000590333 | HNRNPUL1 | chr19 | 41787180 | + | BRSK1 | chr19 | 55795889 | + | 0.002256464 | 0.9977436 |
ENST00000392006 | ENST00000590333 | HNRNPUL1 | chr19 | 41787180 | + | BRSK1 | chr19 | 55795889 | + | 0.003378014 | 0.99662197 |
ENST00000602130 | ENST00000590333 | HNRNPUL1 | chr19 | 41787180 | + | BRSK1 | chr19 | 55795889 | + | 0.003245843 | 0.9967541 |
ENST00000593587 | ENST00000590333 | HNRNPUL1 | chr19 | 41787180 | + | BRSK1 | chr19 | 55795889 | + | 0.002510866 | 0.9974891 |
ENST00000263367 | ENST00000590333 | HNRNPUL1 | chr19 | 41787180 | + | BRSK1 | chr19 | 55795889 | + | 0.00237696 | 0.997623 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for HNRNPUL1-BRSK1 |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
HNRNPUL1 | chr19 | 41787180 | BRSK1 | chr19 | 55795889 | 1052 | 333 | DKFAENDVIGCFAHAQYVGPYRLEKT |
HNRNPUL1 | chr19 | 41787180 | BRSK1 | chr19 | 55795889 | 1172 | 376 | DKFAENDVIGCFAHAQYVGPYRLEKT |
HNRNPUL1 | chr19 | 41787180 | BRSK1 | chr19 | 55795889 | 768 | 241 | DKFAENDVIGCFAHAQYVGPYRLEKT |
HNRNPUL1 | chr19 | 41787180 | BRSK1 | chr19 | 55795889 | 791 | 260 | DKFAENDVIGCFAHAQYVGPYRLEKT |
HNRNPUL1 | chr19 | 41787180 | BRSK1 | chr19 | 55795889 | 793 | 233 | DKFAENDVIGCFAHAQYVGPYRLEKT |
HNRNPUL1 | chr19 | 41787180 | BRSK1 | chr19 | 55795889 | 926 | 255 | DKFAENDVIGCFAHAQYVGPYRLEKT |
Top |
Potential FusionNeoAntigen Information of HNRNPUL1-BRSK1 in HLA I |
![]() |
HNRNPUL1-BRSK1_41787180_55795889.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
HNRNPUL1-BRSK1 | chr19 | 41787180 | chr19 | 55795889 | 926 | HLA-A26:03 | DVIGCFAHA | 0.9927 | 0.8787 | 6 | 15 |
HNRNPUL1-BRSK1 | chr19 | 41787180 | chr19 | 55795889 | 926 | HLA-B15:18 | AHAQYVGPY | 0.493 | 0.5449 | 12 | 21 |
HNRNPUL1-BRSK1 | chr19 | 41787180 | chr19 | 55795889 | 926 | HLA-B15:03 | AHAQYVGPY | 0.4725 | 0.61 | 12 | 21 |
HNRNPUL1-BRSK1 | chr19 | 41787180 | chr19 | 55795889 | 926 | HLA-A26:02 | DVIGCFAHAQY | 0.9997 | 0.7464 | 6 | 17 |
HNRNPUL1-BRSK1 | chr19 | 41787180 | chr19 | 55795889 | 926 | HLA-A26:14 | DVIGCFAHAQY | 0.9994 | 0.7637 | 6 | 17 |
HNRNPUL1-BRSK1 | chr19 | 41787180 | chr19 | 55795889 | 926 | HLA-A26:15 | DVIGCFAHAQY | 0.9994 | 0.7637 | 6 | 17 |
HNRNPUL1-BRSK1 | chr19 | 41787180 | chr19 | 55795889 | 926 | HLA-B38:01 | AHAQYVGPYRL | 0.9988 | 0.9776 | 12 | 23 |
HNRNPUL1-BRSK1 | chr19 | 41787180 | chr19 | 55795889 | 926 | HLA-B38:02 | AHAQYVGPYRL | 0.9987 | 0.9796 | 12 | 23 |
HNRNPUL1-BRSK1 | chr19 | 41787180 | chr19 | 55795889 | 926 | HLA-A66:01 | DVIGCFAHAQY | 0.9972 | 0.7735 | 6 | 17 |
HNRNPUL1-BRSK1 | chr19 | 41787180 | chr19 | 55795889 | 926 | HLA-A26:03 | DVIGCFAHAQY | 0.9941 | 0.7803 | 6 | 17 |
HNRNPUL1-BRSK1 | chr19 | 41787180 | chr19 | 55795889 | 926 | HLA-A26:08 | DVIGCFAHAQY | 0.9821 | 0.5593 | 6 | 17 |
HNRNPUL1-BRSK1 | chr19 | 41787180 | chr19 | 55795889 | 926 | HLA-A34:05 | DVIGCFAHAQY | 0.9451 | 0.6235 | 6 | 17 |
HNRNPUL1-BRSK1 | chr19 | 41787180 | chr19 | 55795889 | 926 | HLA-A34:01 | DVIGCFAHAQY | 0.9451 | 0.6235 | 6 | 17 |
HNRNPUL1-BRSK1 | chr19 | 41787180 | chr19 | 55795889 | 926 | HLA-B48:01 | AHAQYVGPYRL | 0.8746 | 0.6902 | 12 | 23 |
HNRNPUL1-BRSK1 | chr19 | 41787180 | chr19 | 55795889 | 926 | HLA-A66:03 | DVIGCFAHAQY | 0.679 | 0.6166 | 6 | 17 |
HNRNPUL1-BRSK1 | chr19 | 41787180 | chr19 | 55795889 | 926 | HLA-B15:21 | AHAQYVGPY | 0.7018 | 0.7567 | 12 | 21 |
HNRNPUL1-BRSK1 | chr19 | 41787180 | chr19 | 55795889 | 926 | HLA-A26:01 | DVIGCFAHAQY | 0.9994 | 0.7637 | 6 | 17 |
HNRNPUL1-BRSK1 | chr19 | 41787180 | chr19 | 55795889 | 926 | HLA-B39:05 | AHAQYVGPYRL | 0.9984 | 0.9356 | 12 | 23 |
HNRNPUL1-BRSK1 | chr19 | 41787180 | chr19 | 55795889 | 926 | HLA-A68:02 | DVIGCFAHA | 0.9947 | 0.7558 | 6 | 15 |
HNRNPUL1-BRSK1 | chr19 | 41787180 | chr19 | 55795889 | 926 | HLA-A69:01 | DVIGCFAHA | 0.9869 | 0.8011 | 6 | 15 |
HNRNPUL1-BRSK1 | chr19 | 41787180 | chr19 | 55795889 | 926 | HLA-B15:54 | AHAQYVGPY | 0.0426 | 0.6357 | 12 | 21 |
HNRNPUL1-BRSK1 | chr19 | 41787180 | chr19 | 55795889 | 926 | HLA-A25:01 | DVIGCFAHAQY | 0.9993 | 0.9729 | 6 | 17 |
HNRNPUL1-BRSK1 | chr19 | 41787180 | chr19 | 55795889 | 926 | HLA-B38:05 | AHAQYVGPYRL | 0.9988 | 0.9776 | 12 | 23 |
HNRNPUL1-BRSK1 | chr19 | 41787180 | chr19 | 55795889 | 926 | HLA-B39:11 | AHAQYVGPYRL | 0.9777 | 0.9259 | 12 | 23 |
Top |
Potential FusionNeoAntigen Information of HNRNPUL1-BRSK1 in HLA II |
![]() |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of HNRNPUL1-BRSK1 |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
1459 | DVIGCFAHAQYVGP | HNRNPUL1 | BRSK1 | chr19 | 41787180 | chr19 | 55795889 | 926 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of HNRNPUL1-BRSK1 |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 1459 | DVIGCFAHAQYVGP | -7.9962 | -8.1096 |
HLA-B14:02 | 3BVN | 1459 | DVIGCFAHAQYVGP | -5.70842 | -6.74372 |
HLA-B52:01 | 3W39 | 1459 | DVIGCFAHAQYVGP | -6.83737 | -6.95077 |
HLA-B52:01 | 3W39 | 1459 | DVIGCFAHAQYVGP | -4.4836 | -5.5189 |
HLA-A11:01 | 4UQ2 | 1459 | DVIGCFAHAQYVGP | -10.0067 | -10.1201 |
HLA-A11:01 | 4UQ2 | 1459 | DVIGCFAHAQYVGP | -9.03915 | -10.0745 |
HLA-A24:02 | 5HGA | 1459 | DVIGCFAHAQYVGP | -6.56204 | -6.67544 |
HLA-A24:02 | 5HGA | 1459 | DVIGCFAHAQYVGP | -5.42271 | -6.45801 |
HLA-B44:05 | 3DX8 | 1459 | DVIGCFAHAQYVGP | -7.85648 | -8.89178 |
HLA-B44:05 | 3DX8 | 1459 | DVIGCFAHAQYVGP | -5.3978 | -5.5112 |
HLA-A02:01 | 6TDR | 1459 | DVIGCFAHAQYVGP | -3.37154 | -4.40684 |
Top |
Vaccine Design for the FusionNeoAntigens of HNRNPUL1-BRSK1 |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
HNRNPUL1-BRSK1 | chr19 | 41787180 | chr19 | 55795889 | 12 | 21 | AHAQYVGPY | GCGCACGCCCAATATGTGGGCCCCTAT |
HNRNPUL1-BRSK1 | chr19 | 41787180 | chr19 | 55795889 | 12 | 23 | AHAQYVGPYRL | GCGCACGCCCAATATGTGGGCCCCTATCGGCTG |
HNRNPUL1-BRSK1 | chr19 | 41787180 | chr19 | 55795889 | 6 | 15 | DVIGCFAHA | GATGTGATTGGCTGCTTTGCGCACGCC |
HNRNPUL1-BRSK1 | chr19 | 41787180 | chr19 | 55795889 | 6 | 17 | DVIGCFAHAQY | GATGTGATTGGCTGCTTTGCGCACGCCCAATAT |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of HNRNPUL1-BRSK1 |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
CESC | HNRNPUL1-BRSK1 | chr19 | 41787180 | ENST00000263367 | chr19 | 55795889 | ENST00000590333 | TCGA-C5-A907-01A |
Top |
Potential target of CAR-T therapy development for HNRNPUL1-BRSK1 |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to HNRNPUL1-BRSK1 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to HNRNPUL1-BRSK1 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |