|
|||||||
|
Fusion Protein:HOOK3-IKBKB |
Fusion Gene and Fusion Protein Summary |
 Fusion gene summary |
| Fusion partner gene information | Fusion gene name: HOOK3-IKBKB | FusionPDB ID: 37391 | FusionGDB2.0 ID: 37391 | Hgene | Tgene | Gene symbol | HOOK3 | IKBKB | Gene ID | 84376 | 3551 |
| Gene name | hook microtubule tethering protein 3 | inhibitor of nuclear factor kappa B kinase subunit beta | |
| Synonyms | HK3 | IKK-beta|IKK2|IKKB|IMD15|IMD15A|IMD15B|NFKBIKB | |
| Cytomap | 8p11.21 | 8p11.21 | |
| Type of gene | protein-coding | protein-coding | |
| Description | protein Hook homolog 3h-hook3hHK3hook homolog 3 | inhibitor of nuclear factor kappa-B kinase subunit betaI-kappa-B kinase 2I-kappa-B-kinase betainhibitor of kappa light polypeptide gene enhancer in B-cells, kinase betanuclear factor NF-kappa-B inhibitor kinase beta | |
| Modification date | 20200313 | 20200313 | |
| UniProtAcc | Q86VS8 Main function of 5'-partner protein: FUNCTION: Probably serves as a target for the spiC protein from Salmonella typhimurium, which inactivates it, leading to a strong alteration in cellular trafficking (By similarity). Component of the FTS/Hook/FHIP complex (FHF complex). The FHF complex may function to promote vesicle trafficking and/or fusion via the homotypic vesicular protein sorting complex (the HOPS complex). May regulate clearance of endocytosed receptors such as MSR1. Participates in defining the architecture and localization of the Golgi complex. Acts as an adapter protein linking the dynein motor complex to various cargos and converts dynein from a non-processive to a highly processive motor in the presence of dynactin. Facilitates the interaction between dynein and dynactin and activates dynein processivity (the ability to move along a microtubule for a long distance without falling off the track) (PubMed:25035494). FHF complex promotes the distribution of AP-4 complex to the perinuclear area of the cell (PubMed:32073997). {ECO:0000250|UniProtKB:Q8BUK6, ECO:0000269|PubMed:11238449, ECO:0000269|PubMed:17237231, ECO:0000269|PubMed:18799622, ECO:0000269|PubMed:25035494, ECO:0000269|PubMed:32073997}.; FUNCTION: (Microbial infection) May serve as a target for the spiC protein from Salmonella typhimurium, which inactivates it, leading to a strong alteration in cellular trafficking. {ECO:0000305}. | O14920 Main function of 5'-partner protein: FUNCTION: Serine kinase that plays an essential role in the NF-kappa-B signaling pathway which is activated by multiple stimuli such as inflammatory cytokines, bacterial or viral products, DNA damages or other cellular stresses (PubMed:30337470). Acts as part of the canonical IKK complex in the conventional pathway of NF-kappa-B activation. Phosphorylates inhibitors of NF-kappa-B on 2 critical serine residues. These modifications allow polyubiquitination of the inhibitors and subsequent degradation by the proteasome. In turn, free NF-kappa-B is translocated into the nucleus and activates the transcription of hundreds of genes involved in immune response, growth control, or protection against apoptosis. In addition to the NF-kappa-B inhibitors, phosphorylates several other components of the signaling pathway including NEMO/IKBKG, NF-kappa-B subunits RELA and NFKB1, as well as IKK-related kinases TBK1 and IKBKE (PubMed:11297557, PubMed:20410276). IKK-related kinase phosphorylations may prevent the overproduction of inflammatory mediators since they exert a negative regulation on canonical IKKs. Phosphorylates FOXO3, mediating the TNF-dependent inactivation of this pro-apoptotic transcription factor (PubMed:15084260). Also phosphorylates other substrates including NCOA3, BCL10 and IRS1 (PubMed:17213322). Within the nucleus, acts as an adapter protein for NFKBIA degradation in UV-induced NF-kappa-B activation (PubMed:11297557). Phosphorylates RIPK1 at 'Ser-25' which represses its kinase activity and consequently prevents TNF-mediated RIPK1-dependent cell death (By similarity). Phosphorylates the C-terminus of IRF5, stimulating IRF5 homodimerization and translocation into the nucleus (PubMed:25326418). {ECO:0000250|UniProtKB:O88351, ECO:0000269|PubMed:11297557, ECO:0000269|PubMed:15084260, ECO:0000269|PubMed:17213322, ECO:0000269|PubMed:19716809, ECO:0000269|PubMed:20410276, ECO:0000269|PubMed:20434986, ECO:0000269|PubMed:20797629, ECO:0000269|PubMed:21138416, ECO:0000269|PubMed:25326418, ECO:0000269|PubMed:30337470}. | |
| Ensembl transtripts involved in fusion gene | ENST ids | ENST00000307602, ENST00000524839, | ENST00000379708, ENST00000518983, ENST00000522147, ENST00000522785, ENST00000416505, ENST00000519735, ENST00000520810, ENST00000520835, |
| Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 16 X 13 X 9=1872 | 11 X 14 X 4=616 |
| # samples | 19 | 14 | |
| ** MAII score | log2(19/1872*10)=-3.30050911125246 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(14/616*10)=-2.13750352374993 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
| Fusion gene context | PubMed: HOOK3 [Title/Abstract] AND IKBKB [Title/Abstract] AND fusion [Title/Abstract] | ||
| Fusion neoantigen context | PubMed: HOOK3 [Title/Abstract] AND IKBKB [Title/Abstract] AND neoantigen [Title/Abstract] | ||
| Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | HOOK3(42798588)-IKBKB(42162705), # samples:3 | ||
| Anticipated loss of major functional domain due to fusion event. | HOOK3-IKBKB seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. HOOK3-IKBKB seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. HOOK3-IKBKB seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. HOOK3-IKBKB seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. HOOK3-IKBKB seems lost the major protein functional domain in Hgene partner, which is a CGC due to the frame-shifted ORF. HOOK3-IKBKB seems lost the major protein functional domain in Hgene partner, which is a essential gene due to the frame-shifted ORF. HOOK3-IKBKB seems lost the major protein functional domain in Tgene partner, which is a CGC due to the frame-shifted ORF. HOOK3-IKBKB seems lost the major protein functional domain in Tgene partner, which is a IUPHAR drug target due to the frame-shifted ORF. HOOK3-IKBKB seems lost the major protein functional domain in Tgene partner, which is a kinase due to the frame-shifted ORF. | ||
| * DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
| Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Partner | Gene | GO ID | GO term | PubMed ID |
| Tgene | IKBKB | GO:0006468 | protein phosphorylation | 15084260|20434986 |
| Tgene | IKBKB | GO:0018105 | peptidyl-serine phosphorylation | 21399639 |
| Tgene | IKBKB | GO:0042325 | regulation of phosphorylation | 26212789 |
| Tgene | IKBKB | GO:0045944 | positive regulation of transcription by RNA polymerase II | 23091055|23453807 |
| Tgene | IKBKB | GO:0051092 | positive regulation of NF-kappaB transcription factor activity | 15790681 |
| Tgene | IKBKB | GO:0071356 | cellular response to tumor necrosis factor | 23091055 |
| Four levels of functional features of fusion genes Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr8:42798588/chr8:42162705) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
 |
| Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here. |
| Fusion gene breakpoints across HOOK3 (5'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
| Fusion gene breakpoints across IKBKB (3'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Fusion Amino Acid Sequences |
| Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
| ENST00000307602 | HOOK3 | chr8 | 42798588 | + | ENST00000520810 | IKBKB | chr8 | 42162705 | + | 3112 | 600 | 182 | 2482 | 766 |
| ENST00000307602 | HOOK3 | chr8 | 42798588 | + | ENST00000416505 | IKBKB | chr8 | 42162705 | + | 2636 | 600 | 182 | 2482 | 766 |
| ENST00000307602 | HOOK3 | chr8 | 42798588 | + | ENST00000519735 | IKBKB | chr8 | 42162705 | + | 1208 | 600 | 182 | 982 | 266 |
| ENST00000307602 | HOOK3 | chr8 | 42798588 | + | ENST00000520835 | IKBKB | chr8 | 42162705 | + | 2568 | 600 | 182 | 2482 | 766 |
| DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
| ENST00000307602 | ENST00000520810 | HOOK3 | chr8 | 42798588 | + | IKBKB | chr8 | 42162705 | + | 0.00313604 | 0.99686396 |
| ENST00000307602 | ENST00000416505 | HOOK3 | chr8 | 42798588 | + | IKBKB | chr8 | 42162705 | + | 0.005803003 | 0.994197 |
| ENST00000307602 | ENST00000519735 | HOOK3 | chr8 | 42798588 | + | IKBKB | chr8 | 42162705 | + | 0.00492399 | 0.995076 |
| ENST00000307602 | ENST00000520835 | HOOK3 | chr8 | 42798588 | + | IKBKB | chr8 | 42162705 | + | 0.005431653 | 0.99456835 |
| Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones. |
Get the fusion protein sequences from here. |
| Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for HOOK3-IKBKB |
| +/-13 AA sequence from the breakpoints of the fusion protein sequences. |
| Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
| HOOK3 | chr8 | 42798588 | IKBKB | chr8 | 42162705 | 600 | 139 | LILGCAVNCEQKQASALRYLHENRII |
Top |
Potential FusionNeoAntigen Information of HOOK3-IKBKB in HLA I |
| Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| HOOK3-IKBKB_42798588_42162705.msa |
| Potential FusionNeoAntigen Information * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 600 | HLA-B15:01 | KQASALRY | 0.9997 | 0.6849 | 11 | 19 |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 600 | HLA-B14:02 | EQKQASAL | 0.9994 | 0.7867 | 9 | 17 |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 600 | HLA-B14:01 | EQKQASAL | 0.9994 | 0.7867 | 9 | 17 |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 600 | HLA-B15:25 | KQASALRY | 0.992 | 0.8119 | 11 | 19 |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 600 | HLA-B15:03 | KQASALRY | 0.9121 | 0.5656 | 11 | 19 |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 600 | HLA-A30:08 | KQASALRYL | 0.9077 | 0.5022 | 11 | 20 |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 600 | HLA-B13:02 | KQASALRYL | 0.8441 | 0.5499 | 11 | 20 |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 600 | HLA-B15:03 | KQASALRYL | 0.8104 | 0.5586 | 11 | 20 |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 600 | HLA-B39:13 | CEQKQASAL | 0.7776 | 0.9454 | 8 | 17 |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 600 | HLA-B13:01 | KQASALRYL | 0.7295 | 0.9281 | 11 | 20 |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 600 | HLA-B39:13 | KQASALRYL | 0.6118 | 0.7364 | 11 | 20 |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 600 | HLA-B52:01 | KQASALRYL | 0.0136 | 0.8533 | 11 | 20 |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 600 | HLA-B15:02 | EQKQASALRY | 0.9542 | 0.6417 | 9 | 19 |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 600 | HLA-B14:03 | EQKQASAL | 0.9474 | 0.7549 | 9 | 17 |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 600 | HLA-B15:04 | KQASALRYL | 0.9506 | 0.7388 | 11 | 20 |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 600 | HLA-C06:03 | KQASALRYL | 0.8965 | 0.9709 | 11 | 20 |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 600 | HLA-C12:04 | KQASALRYL | 0.8902 | 0.9692 | 11 | 20 |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 600 | HLA-C02:06 | KQASALRYL | 0.8775 | 0.845 | 11 | 20 |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 600 | HLA-B39:08 | CEQKQASAL | 0.8558 | 0.8206 | 8 | 17 |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 600 | HLA-B39:08 | KQASALRYL | 0.6496 | 0.6882 | 11 | 20 |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 600 | HLA-C12:16 | KQASALRYL | 0.5108 | 0.8961 | 11 | 20 |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 600 | HLA-B15:31 | EQKQASALRY | 0.8718 | 0.501 | 9 | 19 |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 600 | HLA-B15:27 | KQASALRY | 0.9997 | 0.713 | 11 | 19 |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 600 | HLA-B15:34 | KQASALRY | 0.9997 | 0.6849 | 11 | 19 |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 600 | HLA-B15:125 | KQASALRY | 0.9997 | 0.6849 | 11 | 19 |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 600 | HLA-B15:33 | KQASALRY | 0.9997 | 0.6849 | 11 | 19 |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 600 | HLA-B15:135 | KQASALRY | 0.9996 | 0.7087 | 11 | 19 |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 600 | HLA-B15:50 | KQASALRY | 0.9996 | 0.6436 | 11 | 19 |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 600 | HLA-B15:53 | KQASALRY | 0.9979 | 0.6406 | 11 | 19 |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 600 | HLA-B15:35 | KQASALRY | 0.9971 | 0.6478 | 11 | 19 |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 600 | HLA-C16:01 | QASALRYL | 0.9959 | 0.9707 | 12 | 20 |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 600 | HLA-B15:39 | KQASALRY | 0.9918 | 0.6635 | 11 | 19 |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 600 | HLA-B15:54 | KQASALRY | 0.9859 | 0.595 | 11 | 19 |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 600 | HLA-B35:28 | KQASALRY | 0.9316 | 0.8519 | 11 | 19 |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 600 | HLA-B48:02 | KQASALRY | 0.7039 | 0.816 | 11 | 19 |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 600 | HLA-B40:04 | CEQKQASAL | 0.9978 | 0.6691 | 8 | 17 |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 600 | HLA-B15:50 | KQASALRYL | 0.9942 | 0.6848 | 11 | 20 |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 600 | HLA-B15:24 | KQASALRYL | 0.9941 | 0.8088 | 11 | 20 |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 600 | HLA-A32:01 | KQASALRYL | 0.9811 | 0.7748 | 11 | 20 |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 600 | HLA-C06:06 | KQASALRYL | 0.9605 | 0.9677 | 11 | 20 |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 600 | HLA-B15:73 | KQASALRYL | 0.9248 | 0.8087 | 11 | 20 |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 600 | HLA-C06:08 | KQASALRYL | 0.9202 | 0.9539 | 11 | 20 |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 600 | HLA-C07:04 | KQASALRYL | 0.9054 | 0.8593 | 11 | 20 |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 600 | HLA-B15:35 | KQASALRYL | 0.9013 | 0.6775 | 11 | 20 |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 600 | HLA-C06:17 | KQASALRYL | 0.8546 | 0.9667 | 11 | 20 |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 600 | HLA-C06:02 | KQASALRYL | 0.8546 | 0.9667 | 11 | 20 |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 600 | HLA-B15:53 | KQASALRYL | 0.823 | 0.6746 | 11 | 20 |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 600 | HLA-B15:54 | KQASALRYL | 0.8119 | 0.6415 | 11 | 20 |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 600 | HLA-B41:03 | CEQKQASAL | 0.7871 | 0.593 | 8 | 17 |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 600 | HLA-B15:30 | KQASALRYL | 0.7779 | 0.806 | 11 | 20 |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 600 | HLA-B39:02 | CEQKQASAL | 0.772 | 0.9445 | 8 | 17 |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 600 | HLA-B39:02 | KQASALRYL | 0.7136 | 0.7375 | 11 | 20 |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 600 | HLA-B48:02 | KQASALRYL | 0.5746 | 0.8223 | 11 | 20 |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 600 | HLA-B48:02 | QKQASALRY | 0.3325 | 0.7228 | 10 | 19 |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 600 | HLA-B15:53 | QKQASALRY | 0.2732 | 0.5062 | 10 | 19 |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 600 | HLA-B15:27 | EQKQASALRY | 0.9995 | 0.5192 | 9 | 19 |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 600 | HLA-B15:50 | EQKQASALRY | 0.9983 | 0.5429 | 9 | 19 |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 600 | HLA-B15:12 | EQKQASALRY | 0.9949 | 0.5832 | 9 | 19 |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 600 | HLA-B35:20 | EQKQASALRY | 0.8584 | 0.6178 | 9 | 19 |
Top |
Potential FusionNeoAntigen Information of HOOK3-IKBKB in HLA II |
| Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| HOOK3-IKBKB_42798588_42162705.msa |
| Potential FusionNeoAntigen Information * We used NetMHCIIpan v4.1 (%rank<0.5). |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 600 | DRB1-1201 | KQASALRYLHENRII | 11 | 26 |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 600 | DRB1-1203 | KQASALRYLHENRII | 11 | 26 |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 600 | DRB1-1205 | KQASALRYLHENRII | 11 | 26 |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 600 | DRB1-1206 | KQASALRYLHENRII | 11 | 26 |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 600 | DRB1-1207 | KQASALRYLHENRII | 11 | 26 |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 600 | DRB1-1208 | KQASALRYLHENRII | 11 | 26 |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 600 | DRB1-1210 | KQASALRYLHENRII | 11 | 26 |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 600 | DRB1-1211 | KQASALRYLHENRII | 11 | 26 |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 600 | DRB1-1213 | KQASALRYLHENRII | 11 | 26 |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 600 | DRB1-1214 | KQASALRYLHENRII | 11 | 26 |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 600 | DRB1-1215 | KQASALRYLHENRII | 11 | 26 |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 600 | DRB1-1216 | KQASALRYLHENRII | 11 | 26 |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 600 | DRB1-1217 | KQASALRYLHENRII | 11 | 26 |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 600 | DRB1-1218 | KQASALRYLHENRII | 11 | 26 |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 600 | DRB1-1219 | KQASALRYLHENRII | 11 | 26 |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 600 | DRB1-1220 | KQASALRYLHENRII | 11 | 26 |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 600 | DRB1-1221 | KQASALRYLHENRII | 11 | 26 |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 600 | DRB1-1223 | KQASALRYLHENRII | 11 | 26 |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 600 | DRB1-1503 | KQASALRYLHENRII | 11 | 26 |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 600 | DRB1-1523 | KQASALRYLHENRII | 11 | 26 |
Top |
Fusion breakpoint peptide structures of HOOK3-IKBKB |
| 3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
| File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
| 10131 | VNCEQKQASALRYL | HOOK3 | IKBKB | chr8 | 42798588 | chr8 | 42162705 | 600 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of HOOK3-IKBKB |
| Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens * We used Glide to predict the interaction between HLAs and neoantigens. |
| HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
| HLA-B14:02 | 3BVN | 10131 | VNCEQKQASALRYL | -7.9962 | -8.1096 |
| HLA-B14:02 | 3BVN | 10131 | VNCEQKQASALRYL | -5.70842 | -6.74372 |
| HLA-B52:01 | 3W39 | 10131 | VNCEQKQASALRYL | -6.83737 | -6.95077 |
| HLA-B52:01 | 3W39 | 10131 | VNCEQKQASALRYL | -4.4836 | -5.5189 |
| HLA-A11:01 | 4UQ2 | 10131 | VNCEQKQASALRYL | -10.0067 | -10.1201 |
| HLA-A11:01 | 4UQ2 | 10131 | VNCEQKQASALRYL | -9.03915 | -10.0745 |
| HLA-A24:02 | 5HGA | 10131 | VNCEQKQASALRYL | -6.56204 | -6.67544 |
| HLA-A24:02 | 5HGA | 10131 | VNCEQKQASALRYL | -5.42271 | -6.45801 |
| HLA-B44:05 | 3DX8 | 10131 | VNCEQKQASALRYL | -7.85648 | -8.89178 |
| HLA-B44:05 | 3DX8 | 10131 | VNCEQKQASALRYL | -5.3978 | -5.5112 |
| HLA-B35:01 | 1A1N | 10131 | VNCEQKQASALRYL | -6.27422 | -6.38762 |
| HLA-B35:01 | 1A1N | 10131 | VNCEQKQASALRYL | -5.27424 | -6.30954 |
| HLA-A02:01 | 6TDR | 10131 | VNCEQKQASALRYL | -3.37154 | -4.40684 |
Top |
Vaccine Design for the FusionNeoAntigens of HOOK3-IKBKB |
| mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 10 | 19 | QKQASALRY | AGAAGCAAGCCTCTGCGCTTAGATACC |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 11 | 19 | KQASALRY | AGCAAGCCTCTGCGCTTAGATACC |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 11 | 20 | KQASALRYL | AGCAAGCCTCTGCGCTTAGATACCTTC |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 12 | 20 | QASALRYL | AAGCCTCTGCGCTTAGATACCTTC |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 8 | 17 | CEQKQASAL | GTGAACAGAAGCAAGCCTCTGCGCTTA |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 9 | 17 | EQKQASAL | AACAGAAGCAAGCCTCTGCGCTTA |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 9 | 19 | EQKQASALRY | AACAGAAGCAAGCCTCTGCGCTTAGATACC |
| mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
| HOOK3-IKBKB | chr8 | 42798588 | chr8 | 42162705 | 11 | 26 | KQASALRYLHENRII | AGCAAGCCTCTGCGCTTAGATACCTTCATGAAAACAGAATCATCC |
Top |
Information of the samples that have these potential fusion neoantigens of HOOK3-IKBKB |
| These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens. |
| Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
| BRCA | HOOK3-IKBKB | chr8 | 42798588 | ENST00000307602 | chr8 | 42162705 | ENST00000416505 | TCGA-A2-A0D1-01A |
Top |
Potential target of CAR-T therapy development for HOOK3-IKBKB |
| Predicted 3D structure. We used RoseTTAFold. |
| Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features * Minus value of BPloci means that the break point is located before the CDS. |
| - In-frame and retained 'Transmembrane'. |
| Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
| Subcellular localization prediction of the transmembrane domain retained fusion proteins * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
| Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to HOOK3-IKBKB |
| Drugs used for this fusion-positive patient. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to HOOK3-IKBKB |
| Diseases that have this fusion gene. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Disease | Source | PMID |
| Diseases associated with fusion partners. (DisGeNet 4.0) |
| Partner | Gene | Disease ID | Disease name | # pubmeds | Source |
| Hgene | HOOK3 | C0032460 | Polycystic Ovary Syndrome | 1 | CTD_human |
| Hgene | HOOK3 | C1136382 | Sclerocystic Ovaries | 1 | CTD_human |
Copyright 2023-PresentThe University of Texas Health Science Center at Houston (UTHealth)
Web File Viewing | Emergency Information
Campus Carry|Site Policies