|
|||||||
|
Fusion Protein:IFT20-GLS |
Fusion Gene and Fusion Protein Summary |
 Fusion gene summary |
| Fusion partner gene information | Fusion gene name: IFT20-GLS | FusionPDB ID: 38416 | FusionGDB2.0 ID: 38416 | Hgene | Tgene | Gene symbol | IFT20 | GLS | Gene ID | 90410 | 27165 |
| Gene name | intraflagellar transport 20 | glutaminase 2 | |
| Synonyms | - | GA|GLS|LGA|hLGA | |
| Cytomap | 17q11.2 | 12q13.3 | |
| Type of gene | protein-coding | protein-coding | |
| Description | intraflagellar transport protein 20 homologintraflagellar transport 20 homologintraflagellar transport protein IFT20 | glutaminase liver isoform, mitochondrialL-glutamine amidohydrolasebreast cell glutaminaseglutaminase 2 (liver, mitochondrial)glutaminase Iphosphate-activated glutaminasephosphate-dependent glutaminase | |
| Modification date | 20200327 | 20200313 | |
| UniProtAcc | Q8IY31 Main function of 5'-partner protein: FUNCTION: Part of intraflagellar transport (IFT) particles involved in ciliary process assembly. May play a role in the trafficking of ciliary membrane proteins from the Golgi complex to the cilium (PubMed:16775004). Regulates the platelet-derived growth factor receptor-alpha (PDGFRA) signaling pathway. Required for protein stability of E3 ubiquitin ligases CBL and CBLB that mediate ubiquitination and internalization of PDGFRA for proper feedback inhibition of PDGFRA signaling (PubMed:29237719). Essential for male fertility. Plays an important role in spermatogenesis, particularly spermiogenesis, when germ cells form flagella. May play a role in the transport of flagellar proteins ODF2 and SPAG16 to build sperm flagella and in the removal of redundant sperm cytoplasm (By similarity). Also involved in autophagy since it is required for trafficking of ATG16L and the expansion of the autophagic compartment (By similarity). {ECO:0000250|UniProtKB:Q61025, ECO:0000269|PubMed:16775004, ECO:0000269|PubMed:29237719}. | Q9UI32 Main function of 5'-partner protein: FUNCTION: Plays an important role in the regulation of glutamine catabolism. Promotes mitochondrial respiration and increases ATP generation in cells by catalyzing the synthesis of glutamate and alpha-ketoglutarate. Increases cellular anti-oxidant function via NADH and glutathione production. May play a role in preventing tumor proliferation. {ECO:0000269|PubMed:20378837}. | |
| Ensembl transtripts involved in fusion gene | ENST ids | ENST00000357896, ENST00000395418, ENST00000578122, ENST00000578985, ENST00000579419, ENST00000585089, ENST00000585313, | ENST00000338435, ENST00000409215, ENST00000409428, ENST00000409626, ENST00000471443, ENST00000320717, |
| Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 3 X 3 X 3=27 | 12 X 9 X 5=540 |
| # samples | 3 | 12 | |
| ** MAII score | log2(3/27*10)=0.15200309344505 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0 | log2(12/540*10)=-2.16992500144231 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
| Fusion gene context | PubMed: IFT20 [Title/Abstract] AND GLS [Title/Abstract] AND fusion [Title/Abstract] | ||
| Fusion neoantigen context | PubMed: IFT20 [Title/Abstract] AND GLS [Title/Abstract] AND neoantigen [Title/Abstract] | ||
| Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | IFT20(26658882)-GLS(191827556), # samples:1 | ||
| Anticipated loss of major functional domain due to fusion event. | IFT20-GLS seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. IFT20-GLS seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. IFT20-GLS seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. IFT20-GLS seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. IFT20-GLS seems lost the major protein functional domain in Hgene partner, which is a essential gene due to the frame-shifted ORF. IFT20-GLS seems lost the major protein functional domain in Tgene partner, which is a cell metabolism gene due to the frame-shifted ORF. IFT20-GLS seems lost the major protein functional domain in Tgene partner, which is a IUPHAR drug target due to the frame-shifted ORF. | ||
| * DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
| Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Partner | Gene | GO ID | GO term | PubMed ID |
| Four levels of functional features of fusion genes Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr17:26658882/chr2:191827556) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
 |
| Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here. |
| Fusion gene breakpoints across IFT20 (5'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
| Fusion gene breakpoints across GLS (3'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Fusion Amino Acid Sequences |
| Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
| ENST00000585089 | IFT20 | chr17 | 26658882 | - | ENST00000320717 | GLS | chr2 | 191827556 | + | 3199 | 476 | 256 | 672 | 138 |
| ENST00000578122 | IFT20 | chr17 | 26658882 | - | ENST00000320717 | GLS | chr2 | 191827556 | + | 3185 | 462 | 242 | 658 | 138 |
| ENST00000578985 | IFT20 | chr17 | 26658882 | - | ENST00000320717 | GLS | chr2 | 191827556 | + | 3190 | 467 | 247 | 663 | 138 |
| DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
| ENST00000585089 | ENST00000320717 | IFT20 | chr17 | 26658882 | - | GLS | chr2 | 191827556 | + | 0.017680187 | 0.9823198 |
| ENST00000578122 | ENST00000320717 | IFT20 | chr17 | 26658882 | - | GLS | chr2 | 191827556 | + | 0.017822243 | 0.98217773 |
| ENST00000578985 | ENST00000320717 | IFT20 | chr17 | 26658882 | - | GLS | chr2 | 191827556 | + | 0.017833116 | 0.9821669 |
| Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones. |
Get the fusion protein sequences from here. |
| Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for IFT20-GLS |
| +/-13 AA sequence from the breakpoints of the fusion protein sequences. |
| Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
| IFT20 | chr17 | 26658882 | GLS | chr2 | 191827556 | 462 | 74 | IELKEECKDFVDSGITLPWMKHCTLD |
| IFT20 | chr17 | 26658882 | GLS | chr2 | 191827556 | 467 | 74 | IELKEECKDFVDSGITLPWMKHCTLD |
| IFT20 | chr17 | 26658882 | GLS | chr2 | 191827556 | 476 | 74 | IELKEECKDFVDSGITLPWMKHCTLD |
Top |
Potential FusionNeoAntigen Information of IFT20-GLS in HLA I |
| Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| IFT20-GLS_26658882_191827556.msa |
| Potential FusionNeoAntigen Information * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
| IFT20-GLS | chr17 | 26658882 | chr2 | 191827556 | 462 | HLA-B35:02 | FVDSGITL | 0.9264 | 0.962 | 9 | 17 |
| IFT20-GLS | chr17 | 26658882 | chr2 | 191827556 | 462 | HLA-B35:04 | FVDSGITL | 0.9264 | 0.962 | 9 | 17 |
| IFT20-GLS | chr17 | 26658882 | chr2 | 191827556 | 462 | HLA-B15:37 | DFVDSGITL | 0.7411 | 0.6454 | 8 | 17 |
| IFT20-GLS | chr17 | 26658882 | chr2 | 191827556 | 462 | HLA-B15:10 | DFVDSGITL | 0.5613 | 0.63 | 8 | 17 |
| IFT20-GLS | chr17 | 26658882 | chr2 | 191827556 | 462 | HLA-B58:01 | FVDSGITLPW | 0.9968 | 0.9797 | 9 | 19 |
| IFT20-GLS | chr17 | 26658882 | chr2 | 191827556 | 462 | HLA-B53:01 | FVDSGITLPW | 0.9757 | 0.7727 | 9 | 19 |
| IFT20-GLS | chr17 | 26658882 | chr2 | 191827556 | 462 | HLA-B47:01 | KDFVDSGITL | 0.8214 | 0.5908 | 7 | 17 |
| IFT20-GLS | chr17 | 26658882 | chr2 | 191827556 | 462 | HLA-C01:17 | FVDSGITL | 1 | 0.9464 | 9 | 17 |
| IFT20-GLS | chr17 | 26658882 | chr2 | 191827556 | 462 | HLA-C08:15 | FVDSGITL | 1 | 0.937 | 9 | 17 |
| IFT20-GLS | chr17 | 26658882 | chr2 | 191827556 | 462 | HLA-C05:09 | FVDSGITL | 1 | 0.9395 | 9 | 17 |
| IFT20-GLS | chr17 | 26658882 | chr2 | 191827556 | 462 | HLA-C04:10 | FVDSGITL | 1 | 0.6435 | 9 | 17 |
| IFT20-GLS | chr17 | 26658882 | chr2 | 191827556 | 462 | HLA-C04:07 | FVDSGITL | 1 | 0.6827 | 9 | 17 |
| IFT20-GLS | chr17 | 26658882 | chr2 | 191827556 | 462 | HLA-C03:19 | FVDSGITL | 0.9999 | 0.9773 | 9 | 17 |
| IFT20-GLS | chr17 | 26658882 | chr2 | 191827556 | 462 | HLA-C03:07 | FVDSGITL | 0.9999 | 0.9857 | 9 | 17 |
| IFT20-GLS | chr17 | 26658882 | chr2 | 191827556 | 462 | HLA-C03:08 | FVDSGITL | 0.9999 | 0.8819 | 9 | 17 |
| IFT20-GLS | chr17 | 26658882 | chr2 | 191827556 | 462 | HLA-C15:06 | FVDSGITL | 0.9998 | 0.9225 | 9 | 17 |
| IFT20-GLS | chr17 | 26658882 | chr2 | 191827556 | 462 | HLA-C04:06 | FVDSGITL | 0.9998 | 0.7183 | 9 | 17 |
| IFT20-GLS | chr17 | 26658882 | chr2 | 191827556 | 462 | HLA-C08:04 | FVDSGITL | 0.9996 | 0.8839 | 9 | 17 |
| IFT20-GLS | chr17 | 26658882 | chr2 | 191827556 | 462 | HLA-C08:13 | FVDSGITL | 0.9996 | 0.8839 | 9 | 17 |
| IFT20-GLS | chr17 | 26658882 | chr2 | 191827556 | 462 | HLA-C01:30 | FVDSGITL | 0.9993 | 0.9441 | 9 | 17 |
| IFT20-GLS | chr17 | 26658882 | chr2 | 191827556 | 462 | HLA-C04:14 | FVDSGITL | 0.9978 | 0.6377 | 9 | 17 |
| IFT20-GLS | chr17 | 26658882 | chr2 | 191827556 | 462 | HLA-C08:03 | FVDSGITL | 0.9949 | 0.9303 | 9 | 17 |
| IFT20-GLS | chr17 | 26658882 | chr2 | 191827556 | 462 | HLA-C02:06 | FVDSGITL | 0.9918 | 0.9724 | 9 | 17 |
| IFT20-GLS | chr17 | 26658882 | chr2 | 191827556 | 462 | HLA-B35:12 | FVDSGITL | 0.9264 | 0.962 | 9 | 17 |
| IFT20-GLS | chr17 | 26658882 | chr2 | 191827556 | 462 | HLA-B44:04 | VDSGITLPW | 0.9932 | 0.6933 | 10 | 19 |
| IFT20-GLS | chr17 | 26658882 | chr2 | 191827556 | 462 | HLA-B44:08 | VDSGITLPW | 0.9678 | 0.7951 | 10 | 19 |
| IFT20-GLS | chr17 | 26658882 | chr2 | 191827556 | 462 | HLA-B14:03 | DFVDSGITL | 0.6031 | 0.6887 | 8 | 17 |
| IFT20-GLS | chr17 | 26658882 | chr2 | 191827556 | 462 | HLA-B39:08 | KDFVDSGITL | 0.947 | 0.7179 | 7 | 17 |
| IFT20-GLS | chr17 | 26658882 | chr2 | 191827556 | 462 | HLA-C05:09 | FVDSGITLPWM | 0.9999 | 0.9432 | 9 | 20 |
| IFT20-GLS | chr17 | 26658882 | chr2 | 191827556 | 462 | HLA-C08:15 | FVDSGITLPWM | 0.9997 | 0.9588 | 9 | 20 |
| IFT20-GLS | chr17 | 26658882 | chr2 | 191827556 | 462 | HLA-A02:07 | FVDSGITLPWM | 0.922 | 0.5771 | 9 | 20 |
| IFT20-GLS | chr17 | 26658882 | chr2 | 191827556 | 462 | HLA-C01:03 | FVDSGITL | 1 | 0.9274 | 9 | 17 |
| IFT20-GLS | chr17 | 26658882 | chr2 | 191827556 | 462 | HLA-C18:01 | FVDSGITL | 1 | 0.6828 | 9 | 17 |
| IFT20-GLS | chr17 | 26658882 | chr2 | 191827556 | 462 | HLA-C04:03 | FVDSGITL | 1 | 0.7221 | 9 | 17 |
| IFT20-GLS | chr17 | 26658882 | chr2 | 191827556 | 462 | HLA-C04:01 | FVDSGITL | 1 | 0.6827 | 9 | 17 |
| IFT20-GLS | chr17 | 26658882 | chr2 | 191827556 | 462 | HLA-C05:01 | FVDSGITL | 1 | 0.9395 | 9 | 17 |
| IFT20-GLS | chr17 | 26658882 | chr2 | 191827556 | 462 | HLA-C01:02 | FVDSGITL | 1 | 0.9459 | 9 | 17 |
| IFT20-GLS | chr17 | 26658882 | chr2 | 191827556 | 462 | HLA-C08:02 | FVDSGITL | 1 | 0.937 | 9 | 17 |
| IFT20-GLS | chr17 | 26658882 | chr2 | 191827556 | 462 | HLA-C03:04 | FVDSGITL | 0.9999 | 0.9861 | 9 | 17 |
| IFT20-GLS | chr17 | 26658882 | chr2 | 191827556 | 462 | HLA-C03:03 | FVDSGITL | 0.9999 | 0.9861 | 9 | 17 |
| IFT20-GLS | chr17 | 26658882 | chr2 | 191827556 | 462 | HLA-C03:67 | FVDSGITL | 0.9998 | 0.9747 | 9 | 17 |
| IFT20-GLS | chr17 | 26658882 | chr2 | 191827556 | 462 | HLA-C03:17 | FVDSGITL | 0.9998 | 0.9685 | 9 | 17 |
| IFT20-GLS | chr17 | 26658882 | chr2 | 191827556 | 462 | HLA-C03:05 | FVDSGITL | 0.9998 | 0.8964 | 9 | 17 |
| IFT20-GLS | chr17 | 26658882 | chr2 | 191827556 | 462 | HLA-C04:04 | FVDSGITL | 0.9997 | 0.6815 | 9 | 17 |
| IFT20-GLS | chr17 | 26658882 | chr2 | 191827556 | 462 | HLA-C15:05 | FVDSGITL | 0.9997 | 0.9306 | 9 | 17 |
| IFT20-GLS | chr17 | 26658882 | chr2 | 191827556 | 462 | HLA-C03:06 | FVDSGITL | 0.9995 | 0.9878 | 9 | 17 |
| IFT20-GLS | chr17 | 26658882 | chr2 | 191827556 | 462 | HLA-C08:01 | FVDSGITL | 0.9949 | 0.9303 | 9 | 17 |
| IFT20-GLS | chr17 | 26658882 | chr2 | 191827556 | 462 | HLA-C17:01 | FVDSGITL | 0.9925 | 0.7328 | 9 | 17 |
| IFT20-GLS | chr17 | 26658882 | chr2 | 191827556 | 462 | HLA-C07:04 | FVDSGITL | 0.9901 | 0.7997 | 9 | 17 |
| IFT20-GLS | chr17 | 26658882 | chr2 | 191827556 | 462 | HLA-B35:09 | FVDSGITL | 0.9264 | 0.962 | 9 | 17 |
| IFT20-GLS | chr17 | 26658882 | chr2 | 191827556 | 462 | HLA-B07:13 | FVDSGITL | 0.847 | 0.7433 | 9 | 17 |
| IFT20-GLS | chr17 | 26658882 | chr2 | 191827556 | 462 | HLA-C03:67 | DFVDSGITL | 0.7268 | 0.9676 | 8 | 17 |
| IFT20-GLS | chr17 | 26658882 | chr2 | 191827556 | 462 | HLA-C04:04 | DFVDSGITL | 0.4472 | 0.7708 | 8 | 17 |
| IFT20-GLS | chr17 | 26658882 | chr2 | 191827556 | 462 | HLA-C14:02 | DFVDSGITL | 0.4261 | 0.9561 | 8 | 17 |
| IFT20-GLS | chr17 | 26658882 | chr2 | 191827556 | 462 | HLA-C14:03 | DFVDSGITL | 0.4261 | 0.9561 | 8 | 17 |
| IFT20-GLS | chr17 | 26658882 | chr2 | 191827556 | 462 | HLA-B15:09 | DFVDSGITL | 0.4159 | 0.7365 | 8 | 17 |
| IFT20-GLS | chr17 | 26658882 | chr2 | 191827556 | 462 | HLA-B57:04 | FVDSGITLPW | 0.9992 | 0.7529 | 9 | 19 |
| IFT20-GLS | chr17 | 26658882 | chr2 | 191827556 | 462 | HLA-B57:02 | FVDSGITLPW | 0.9929 | 0.9626 | 9 | 19 |
| IFT20-GLS | chr17 | 26658882 | chr2 | 191827556 | 462 | HLA-B15:13 | FVDSGITLPW | 0.9836 | 0.9773 | 9 | 19 |
| IFT20-GLS | chr17 | 26658882 | chr2 | 191827556 | 462 | HLA-A25:01 | FVDSGITLPW | 0.7396 | 0.9398 | 9 | 19 |
| IFT20-GLS | chr17 | 26658882 | chr2 | 191827556 | 462 | HLA-C05:01 | FVDSGITLPWM | 0.9999 | 0.9432 | 9 | 20 |
| IFT20-GLS | chr17 | 26658882 | chr2 | 191827556 | 462 | HLA-C04:03 | FVDSGITLPWM | 0.9999 | 0.8356 | 9 | 20 |
| IFT20-GLS | chr17 | 26658882 | chr2 | 191827556 | 462 | HLA-C08:02 | FVDSGITLPWM | 0.9997 | 0.9588 | 9 | 20 |
Top |
Potential FusionNeoAntigen Information of IFT20-GLS in HLA II |
| Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| Potential FusionNeoAntigen Information * We used NetMHCIIpan v4.1 (%rank<0.5). |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of IFT20-GLS |
| 3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
| File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
| 851 | CKDFVDSGITLPWM | IFT20 | GLS | chr17 | 26658882 | chr2 | 191827556 | 462 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of IFT20-GLS |
| Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens * We used Glide to predict the interaction between HLAs and neoantigens. |
| HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
| HLA-B14:02 | 3BVN | 851 | CKDFVDSGITLPWM | -7.15543 | -7.26883 |
| HLA-B14:02 | 3BVN | 851 | CKDFVDSGITLPWM | -4.77435 | -5.80965 |
| HLA-B52:01 | 3W39 | 851 | CKDFVDSGITLPWM | -6.80875 | -6.92215 |
| HLA-B52:01 | 3W39 | 851 | CKDFVDSGITLPWM | -4.20386 | -5.23916 |
| HLA-A11:01 | 4UQ2 | 851 | CKDFVDSGITLPWM | -7.5194 | -8.5547 |
| HLA-A11:01 | 4UQ2 | 851 | CKDFVDSGITLPWM | -6.9601 | -7.0735 |
| HLA-A24:02 | 5HGA | 851 | CKDFVDSGITLPWM | -7.52403 | -7.63743 |
| HLA-A24:02 | 5HGA | 851 | CKDFVDSGITLPWM | -5.82433 | -6.85963 |
| HLA-B27:05 | 6PYJ | 851 | CKDFVDSGITLPWM | -3.28285 | -4.31815 |
| HLA-B44:05 | 3DX8 | 851 | CKDFVDSGITLPWM | -5.91172 | -6.94702 |
| HLA-B44:05 | 3DX8 | 851 | CKDFVDSGITLPWM | -4.24346 | -4.35686 |
Top |
Vaccine Design for the FusionNeoAntigens of IFT20-GLS |
| mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
| IFT20-GLS | chr17 | 26658882 | chr2 | 191827556 | 10 | 19 | VDSGITLPW | TTGTGGACAGTGGAATAACACTCCCAT |
| IFT20-GLS | chr17 | 26658882 | chr2 | 191827556 | 7 | 17 | KDFVDSGITL | GCAAAGACTTTGTGGACAGTGGAATAACAC |
| IFT20-GLS | chr17 | 26658882 | chr2 | 191827556 | 8 | 17 | DFVDSGITL | AAGACTTTGTGGACAGTGGAATAACAC |
| IFT20-GLS | chr17 | 26658882 | chr2 | 191827556 | 9 | 17 | FVDSGITL | ACTTTGTGGACAGTGGAATAACAC |
| IFT20-GLS | chr17 | 26658882 | chr2 | 191827556 | 9 | 19 | FVDSGITLPW | ACTTTGTGGACAGTGGAATAACACTCCCAT |
| IFT20-GLS | chr17 | 26658882 | chr2 | 191827556 | 9 | 20 | FVDSGITLPWM | ACTTTGTGGACAGTGGAATAACACTCCCATGGA |
| mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of IFT20-GLS |
| These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens. |
| Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
| N/A | IFT20-GLS | chr17 | 26658882 | ENST00000578122 | chr2 | 191827556 | ENST00000320717 | DC316034 |
Top |
Potential target of CAR-T therapy development for IFT20-GLS |
| Predicted 3D structure. We used RoseTTAFold. |
| Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features * Minus value of BPloci means that the break point is located before the CDS. |
| - In-frame and retained 'Transmembrane'. |
| Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
| Subcellular localization prediction of the transmembrane domain retained fusion proteins * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
| Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to IFT20-GLS |
| Drugs used for this fusion-positive patient. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to IFT20-GLS |
| Diseases that have this fusion gene. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Disease | Source | PMID |
| Diseases associated with fusion partners. (DisGeNet 4.0) |
| Partner | Gene | Disease ID | Disease name | # pubmeds | Source |
Copyright 2023-PresentThe University of Texas Health Science Center at Houston (UTHealth)
Web File Viewing | Emergency Information
Campus Carry|Site Policies