|
|||||||
|
Fusion Protein:ITCH-THAP4 |
Fusion Gene and Fusion Protein Summary |
 Fusion gene summary |
| Fusion partner gene information | Fusion gene name: ITCH-THAP4 | FusionPDB ID: 40369 | FusionGDB2.0 ID: 40369 | Hgene | Tgene | Gene symbol | ITCH | THAP4 | Gene ID | 83737 | 51078 |
| Gene name | itchy E3 ubiquitin protein ligase | THAP domain containing 4 | |
| Synonyms | ADMFD|AIF4|AIP4|NAPP1 | CGI-36|Nb(III)|PP238 | |
| Cytomap | 20q11.22 | 2q37.3 | |
| Type of gene | protein-coding | protein-coding | |
| Description | E3 ubiquitin-protein ligase Itchy homologHECT-type E3 ubiquitin transferase Itchy homologNFE2-associated polypeptide 1atrophin-1 interacting protein 4itchy E3 ubiquitin protein ligase homolog | THAP domain-containing protein 4epididymis secretory sperm binding proteinnitrobindin | |
| Modification date | 20200329 | 20200313 | |
| UniProtAcc | Q96J02 Main function of 5'-partner protein: FUNCTION: Acts as an E3 ubiquitin-protein ligase which accepts ubiquitin from an E2 ubiquitin-conjugating enzyme in the form of a thioester and then directly transfers the ubiquitin to targeted substrates (PubMed:14602072, PubMed:17028573, PubMed:16387660, PubMed:18718448, PubMed:18718449, PubMed:11046148, PubMed:19592251, PubMed:19116316, PubMed:19881509, PubMed:20491914, PubMed:20392206, PubMed:20068034, PubMed:23146885, PubMed:24790097, PubMed:25631046). Catalyzes 'Lys-29'-, 'Lys-48'- and 'Lys-63'-linked ubiquitin conjugation (PubMed:17028573, PubMed:18718448, PubMed:19131965, PubMed:19881509). Involved in the control of inflammatory signaling pathways (PubMed:19131965). Essential component of a ubiquitin-editing protein complex, comprising also TNFAIP3, TAX1BP1 and RNF11, that ensures the transient nature of inflammatory signaling pathways (PubMed:19131965). Promotes the association of the complex after TNF stimulation (PubMed:19131965). Once the complex is formed, TNFAIP3 deubiquitinates 'Lys-63' polyubiquitin chains on RIPK1 and catalyzes the formation of 'Lys-48'-polyubiquitin chains (PubMed:19131965). This leads to RIPK1 proteasomal degradation and consequently termination of the TNF- or LPS-mediated activation of NFKB1 (PubMed:19131965). Ubiquitinates RIPK2 by 'Lys-63'-linked conjugation and influences NOD2-dependent signal transduction pathways (PubMed:19592251). Regulates the transcriptional activity of several transcription factors, and probably plays an important role in the regulation of immune response (PubMed:18718448, PubMed:20491914). Ubiquitinates NFE2 by 'Lys-63' linkages and is implicated in the control of the development of hematopoietic lineages (PubMed:18718448). Mediates JUN ubiquitination and degradation (By similarity). Mediates JUNB ubiquitination and degradation (PubMed:16387660). Critical regulator of type 2 helper T (Th2) cell cytokine production by inducing JUNB ubiquitination and degradation (By similarity). Involved in the negative regulation of MAVS-dependent cellular antiviral responses (PubMed:19881509). Ubiquitinates MAVS through 'Lys-48'-linked conjugation resulting in MAVS proteasomal degradation (PubMed:19881509). Following ligand stimulation, regulates sorting of Wnt receptor FZD4 to the degradative endocytic pathway probably by modulating PI42KA activity (PubMed:23146885). Ubiquitinates PI4K2A and negatively regulates its catalytic activity (PubMed:23146885). Ubiquitinates chemokine receptor CXCR4 and regulates sorting of CXCR4 to the degradative endocytic pathway following ligand stimulation by ubiquitinating endosomal sorting complex required for transport ESCRT-0 components HGS and STAM (PubMed:14602072, PubMed:23146885). Targets DTX1 for lysosomal degradation and controls NOTCH1 degradation, in the absence of ligand, through 'Lys-29'-linked polyubiquitination (PubMed:17028573, PubMed:18628966, PubMed:23886940). Ubiquitinates SNX9 (PubMed:20491914). Ubiquitinates MAP3K7 through 'Lys-48'-linked conjugation (By similarity). Involved in the regulation of apoptosis and reactive oxygen species levels through the ubiquitination and proteasomal degradation of TXNIP (PubMed:20068034). Mediates the antiapoptotic activity of epidermal growth factor through the ubiquitination and proteasomal degradation of p15 BID (PubMed:20392206). Ubiquitinates BRAT1 and this ubiquitination is enhanced in the presence of NDFIP1 (PubMed:25631046). Inhibits the replication of influenza A virus (IAV) via ubiquitination of IAV matrix protein 1 (M1) through 'Lys-48'-linked conjugation resulting in M1 proteasomal degradation (PubMed:30328013). {ECO:0000250|UniProtKB:Q8C863, ECO:0000269|PubMed:14602072, ECO:0000269|PubMed:16387660, ECO:0000269|PubMed:17028573, ECO:0000269|PubMed:18628966, ECO:0000269|PubMed:18718448, ECO:0000269|PubMed:18718449, ECO:0000269|PubMed:19116316, ECO:0000269|PubMed:19131965, ECO:0000269|PubMed:19592251, ECO:0000269|PubMed:19881509, ECO:0000269|PubMed:20068034, ECO:0000269|PubMed:20392206, ECO:0000269|PubMed:20491914, ECO:0000269|PubMed:23146885, ECO:0000269|PubMed:23886940, ECO:0000269|PubMed:24790097, ECO:0000269|PubMed:25631046, ECO:0000269|PubMed:30328013}. | . | |
| Ensembl transtripts involved in fusion gene | ENST ids | ENST00000262650, ENST00000374864, ENST00000535650, ENST00000483727, | ENST00000497486, ENST00000402136, ENST00000402545, ENST00000407315, |
| Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 27 X 16 X 18=7776 | 10 X 4 X 8=320 |
| # samples | 44 | 11 | |
| ** MAII score | log2(44/7776*10)=-4.14345279008112 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(11/320*10)=-1.5405683813627 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
| Fusion gene context | PubMed: ITCH [Title/Abstract] AND THAP4 [Title/Abstract] AND fusion [Title/Abstract] | ||
| Fusion neoantigen context | PubMed: ITCH [Title/Abstract] AND THAP4 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
| Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | ITCH(32981687)-THAP4(242545888), # samples:1 | ||
| Anticipated loss of major functional domain due to fusion event. | ITCH-THAP4 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ITCH-THAP4 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. ITCH-THAP4 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. ITCH-THAP4 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. | ||
| * DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
| Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Partner | Gene | GO ID | GO term | PubMed ID |
| Hgene | ITCH | GO:0006511 | ubiquitin-dependent protein catabolic process | 15678106 |
| Hgene | ITCH | GO:0016567 | protein ubiquitination | 17592138|25631046 |
| Hgene | ITCH | GO:0035519 | protein K29-linked ubiquitination | 17028573|18628966 |
| Hgene | ITCH | GO:0070534 | protein K63-linked ubiquitination | 18718448|19592251 |
| Hgene | ITCH | GO:0070936 | protein K48-linked ubiquitination | 19881509 |
| Four levels of functional features of fusion genes Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr20:32981687/chr2:242545888) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
 |
| Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here. |
| Fusion gene breakpoints across ITCH (5'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
| Fusion gene breakpoints across THAP4 (3'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Fusion Amino Acid Sequences |
| Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
| ENST00000374864 | ITCH | chr20 | 32981687 | + | ENST00000402136 | THAP4 | chr2 | 242545888 | - | 978 | 283 | 213 | 776 | 187 |
| ENST00000374864 | ITCH | chr20 | 32981687 | + | ENST00000407315 | THAP4 | chr2 | 242545888 | - | 978 | 283 | 213 | 776 | 187 |
| ENST00000374864 | ITCH | chr20 | 32981687 | + | ENST00000402545 | THAP4 | chr2 | 242545888 | - | 1037 | 283 | 213 | 857 | 214 |
| ENST00000262650 | ITCH | chr20 | 32981687 | + | ENST00000402136 | THAP4 | chr2 | 242545888 | - | 901 | 206 | 136 | 699 | 187 |
| ENST00000262650 | ITCH | chr20 | 32981687 | + | ENST00000407315 | THAP4 | chr2 | 242545888 | - | 901 | 206 | 136 | 699 | 187 |
| ENST00000262650 | ITCH | chr20 | 32981687 | + | ENST00000402545 | THAP4 | chr2 | 242545888 | - | 960 | 206 | 136 | 780 | 214 |
| DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
| ENST00000374864 | ENST00000402136 | ITCH | chr20 | 32981687 | + | THAP4 | chr2 | 242545888 | - | 0.04446691 | 0.9555331 |
| ENST00000374864 | ENST00000407315 | ITCH | chr20 | 32981687 | + | THAP4 | chr2 | 242545888 | - | 0.04446691 | 0.9555331 |
| ENST00000374864 | ENST00000402545 | ITCH | chr20 | 32981687 | + | THAP4 | chr2 | 242545888 | - | 0.16152579 | 0.83847415 |
| ENST00000262650 | ENST00000402136 | ITCH | chr20 | 32981687 | + | THAP4 | chr2 | 242545888 | - | 0.04021265 | 0.95978737 |
| ENST00000262650 | ENST00000407315 | ITCH | chr20 | 32981687 | + | THAP4 | chr2 | 242545888 | - | 0.04021265 | 0.95978737 |
| ENST00000262650 | ENST00000402545 | ITCH | chr20 | 32981687 | + | THAP4 | chr2 | 242545888 | - | 0.1511777 | 0.8488223 |
| Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones. |
Get the fusion protein sequences from here. |
| Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for ITCH-THAP4 |
| +/-13 AA sequence from the breakpoints of the fusion protein sequences. |
| Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
| ITCH | chr20 | 32981687 | THAP4 | chr2 | 242545888 | 206 | 23 | MGSLTMKSQLQITEPPKMNPVVEPLS |
| ITCH | chr20 | 32981687 | THAP4 | chr2 | 242545888 | 283 | 23 | MGSLTMKSQLQITEPPKMNPVVEPLS |
Top |
Potential FusionNeoAntigen Information of ITCH-THAP4 in HLA I |
| Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| ITCH-THAP4_32981687_242545888.msa |
| Potential FusionNeoAntigen Information * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
| ITCH-THAP4 | chr20 | 32981687 | chr2 | 242545888 | 206 | HLA-B15:01 | LQITEPPKM | 0.997 | 0.9521 | 9 | 18 |
| ITCH-THAP4 | chr20 | 32981687 | chr2 | 242545888 | 206 | HLA-B48:01 | LQITEPPKM | 0.9657 | 0.7815 | 9 | 18 |
| ITCH-THAP4 | chr20 | 32981687 | chr2 | 242545888 | 206 | HLA-B15:25 | LQITEPPKM | 0.9083 | 0.9709 | 9 | 18 |
| ITCH-THAP4 | chr20 | 32981687 | chr2 | 242545888 | 206 | HLA-B13:02 | LQITEPPKM | 0.8197 | 0.8354 | 9 | 18 |
| ITCH-THAP4 | chr20 | 32981687 | chr2 | 242545888 | 206 | HLA-B13:01 | LQITEPPKM | 0.7994 | 0.9929 | 9 | 18 |
| ITCH-THAP4 | chr20 | 32981687 | chr2 | 242545888 | 206 | HLA-A02:21 | LQITEPPKM | 0.7621 | 0.6712 | 9 | 18 |
| ITCH-THAP4 | chr20 | 32981687 | chr2 | 242545888 | 206 | HLA-B15:18 | LQITEPPKM | 0.7513 | 0.8685 | 9 | 18 |
| ITCH-THAP4 | chr20 | 32981687 | chr2 | 242545888 | 206 | HLA-B47:01 | LQITEPPKM | 0.7469 | 0.7017 | 9 | 18 |
| ITCH-THAP4 | chr20 | 32981687 | chr2 | 242545888 | 206 | HLA-B15:03 | LQITEPPKM | 0.7458 | 0.9065 | 9 | 18 |
| ITCH-THAP4 | chr20 | 32981687 | chr2 | 242545888 | 206 | HLA-B15:10 | LQITEPPKM | 0.5079 | 0.7358 | 9 | 18 |
| ITCH-THAP4 | chr20 | 32981687 | chr2 | 242545888 | 206 | HLA-B39:13 | LQITEPPKM | 0.4193 | 0.9722 | 9 | 18 |
| ITCH-THAP4 | chr20 | 32981687 | chr2 | 242545888 | 206 | HLA-B15:37 | LQITEPPKM | 0.3621 | 0.7144 | 9 | 18 |
| ITCH-THAP4 | chr20 | 32981687 | chr2 | 242545888 | 206 | HLA-B52:01 | LQITEPPKM | 0.1077 | 0.9955 | 9 | 18 |
| ITCH-THAP4 | chr20 | 32981687 | chr2 | 242545888 | 206 | HLA-B15:07 | LQITEPPKM | 0.987 | 0.8595 | 9 | 18 |
| ITCH-THAP4 | chr20 | 32981687 | chr2 | 242545888 | 206 | HLA-B15:04 | LQITEPPKM | 0.9717 | 0.964 | 9 | 18 |
| ITCH-THAP4 | chr20 | 32981687 | chr2 | 242545888 | 206 | HLA-B15:21 | LQITEPPKM | 0.9084 | 0.9623 | 9 | 18 |
| ITCH-THAP4 | chr20 | 32981687 | chr2 | 242545888 | 206 | HLA-B15:05 | LQITEPPKM | 0.8346 | 0.9504 | 9 | 18 |
| ITCH-THAP4 | chr20 | 32981687 | chr2 | 242545888 | 206 | HLA-B48:03 | LQITEPPKM | 0.7632 | 0.643 | 9 | 18 |
| ITCH-THAP4 | chr20 | 32981687 | chr2 | 242545888 | 206 | HLA-B39:08 | LQITEPPKM | 0.4039 | 0.9396 | 9 | 18 |
| ITCH-THAP4 | chr20 | 32981687 | chr2 | 242545888 | 206 | HLA-B15:135 | LQITEPPKM | 0.9971 | 0.954 | 9 | 18 |
| ITCH-THAP4 | chr20 | 32981687 | chr2 | 242545888 | 206 | HLA-B15:27 | LQITEPPKM | 0.9971 | 0.9599 | 9 | 18 |
| ITCH-THAP4 | chr20 | 32981687 | chr2 | 242545888 | 206 | HLA-B15:125 | LQITEPPKM | 0.997 | 0.9521 | 9 | 18 |
| ITCH-THAP4 | chr20 | 32981687 | chr2 | 242545888 | 206 | HLA-B15:33 | LQITEPPKM | 0.997 | 0.9521 | 9 | 18 |
| ITCH-THAP4 | chr20 | 32981687 | chr2 | 242545888 | 206 | HLA-B15:34 | LQITEPPKM | 0.997 | 0.9521 | 9 | 18 |
| ITCH-THAP4 | chr20 | 32981687 | chr2 | 242545888 | 206 | HLA-B15:24 | LQITEPPKM | 0.9959 | 0.9699 | 9 | 18 |
| ITCH-THAP4 | chr20 | 32981687 | chr2 | 242545888 | 206 | HLA-B15:50 | LQITEPPKM | 0.9956 | 0.9473 | 9 | 18 |
| ITCH-THAP4 | chr20 | 32981687 | chr2 | 242545888 | 206 | HLA-B15:35 | LQITEPPKM | 0.984 | 0.9466 | 9 | 18 |
| ITCH-THAP4 | chr20 | 32981687 | chr2 | 242545888 | 206 | HLA-B15:53 | LQITEPPKM | 0.973 | 0.9447 | 9 | 18 |
| ITCH-THAP4 | chr20 | 32981687 | chr2 | 242545888 | 206 | HLA-B15:12 | LQITEPPKM | 0.9589 | 0.9559 | 9 | 18 |
| ITCH-THAP4 | chr20 | 32981687 | chr2 | 242545888 | 206 | HLA-B15:73 | LQITEPPKM | 0.9176 | 0.983 | 9 | 18 |
| ITCH-THAP4 | chr20 | 32981687 | chr2 | 242545888 | 206 | HLA-B15:39 | LQITEPPKM | 0.8953 | 0.9324 | 9 | 18 |
| ITCH-THAP4 | chr20 | 32981687 | chr2 | 242545888 | 206 | HLA-B15:68 | LQITEPPKM | 0.8712 | 0.8074 | 9 | 18 |
| ITCH-THAP4 | chr20 | 32981687 | chr2 | 242545888 | 206 | HLA-B15:54 | LQITEPPKM | 0.8653 | 0.9328 | 9 | 18 |
| ITCH-THAP4 | chr20 | 32981687 | chr2 | 242545888 | 206 | HLA-B40:21 | LQITEPPKM | 0.8433 | 0.7591 | 9 | 18 |
| ITCH-THAP4 | chr20 | 32981687 | chr2 | 242545888 | 206 | HLA-B40:49 | LQITEPPKM | 0.8354 | 0.5161 | 9 | 18 |
| ITCH-THAP4 | chr20 | 32981687 | chr2 | 242545888 | 206 | HLA-B15:20 | LQITEPPKM | 0.8109 | 0.9717 | 9 | 18 |
| ITCH-THAP4 | chr20 | 32981687 | chr2 | 242545888 | 206 | HLA-B15:30 | LQITEPPKM | 0.8088 | 0.9644 | 9 | 18 |
| ITCH-THAP4 | chr20 | 32981687 | chr2 | 242545888 | 206 | HLA-B35:28 | LQITEPPKM | 0.8084 | 0.9749 | 9 | 18 |
| ITCH-THAP4 | chr20 | 32981687 | chr2 | 242545888 | 206 | HLA-A02:14 | LQITEPPKM | 0.7658 | 0.6237 | 9 | 18 |
| ITCH-THAP4 | chr20 | 32981687 | chr2 | 242545888 | 206 | HLA-B40:12 | LQITEPPKM | 0.7632 | 0.643 | 9 | 18 |
| ITCH-THAP4 | chr20 | 32981687 | chr2 | 242545888 | 206 | HLA-A02:06 | LQITEPPKM | 0.7621 | 0.6712 | 9 | 18 |
| ITCH-THAP4 | chr20 | 32981687 | chr2 | 242545888 | 206 | HLA-B35:20 | LQITEPPKM | 0.7589 | 0.9769 | 9 | 18 |
| ITCH-THAP4 | chr20 | 32981687 | chr2 | 242545888 | 206 | HLA-B48:02 | LQITEPPKM | 0.6544 | 0.9664 | 9 | 18 |
| ITCH-THAP4 | chr20 | 32981687 | chr2 | 242545888 | 206 | HLA-B39:02 | LQITEPPKM | 0.5985 | 0.9721 | 9 | 18 |
| ITCH-THAP4 | chr20 | 32981687 | chr2 | 242545888 | 206 | HLA-B15:09 | LQITEPPKM | 0.1247 | 0.9704 | 9 | 18 |
Top |
Potential FusionNeoAntigen Information of ITCH-THAP4 in HLA II |
| Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| Potential FusionNeoAntigen Information * We used NetMHCIIpan v4.1 (%rank<0.5). |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of ITCH-THAP4 |
| 3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
| File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
| 4610 | KSQLQITEPPKMNP | ITCH | THAP4 | chr20 | 32981687 | chr2 | 242545888 | 206 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of ITCH-THAP4 |
| Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens * We used Glide to predict the interaction between HLAs and neoantigens. |
| HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
| HLA-B52:01 | 3W39 | 4610 | KSQLQITEPPKMNP | -6.65674 | -6.65674 |
| HLA-B44:05 | 3DX8 | 4610 | KSQLQITEPPKMNP | -6.36866 | -6.36866 |
Top |
Vaccine Design for the FusionNeoAntigens of ITCH-THAP4 |
| mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
| ITCH-THAP4 | chr20 | 32981687 | chr2 | 242545888 | 9 | 18 | LQITEPPKM | TTCAGATCACTGAGCCCCCCAAGATGA |
| mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of ITCH-THAP4 |
| These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens. |
| Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
| STAD | ITCH-THAP4 | chr20 | 32981687 | ENST00000262650 | chr2 | 242545888 | ENST00000402136 | TCGA-BR-7901 |
Top |
Potential target of CAR-T therapy development for ITCH-THAP4 |
| Predicted 3D structure. We used RoseTTAFold. |
| Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features * Minus value of BPloci means that the break point is located before the CDS. |
| - In-frame and retained 'Transmembrane'. |
| Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
| Subcellular localization prediction of the transmembrane domain retained fusion proteins * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
| Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to ITCH-THAP4 |
| Drugs used for this fusion-positive patient. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to ITCH-THAP4 |
| Diseases that have this fusion gene. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Disease | Source | PMID |
| Diseases associated with fusion partners. (DisGeNet 4.0) |
| Partner | Gene | Disease ID | Disease name | # pubmeds | Source |
Copyright 2023-PresentThe University of Texas Health Science Center at Houston (UTHealth)
Web File Viewing | Emergency Information
Campus Carry|Site Policies