Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:KANSL1-PHF20

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: KANSL1-PHF20
	FusionPDB ID: 41149
	FusionGDB2.0 ID: 41149
		Hgene	Tgene
	Gene symbol	KANSL1	PHF20
	Gene ID	284058	51230
	Gene name	KAT8 regulatory NSL complex subunit 1	PHD finger protein 20
	Synonyms	CENP-36\|KDVS\|KIAA1267\|MSL1v1\|NSL1\|hMSL1v1	C20orf104\|GLEA2\|HCA58\|NZF\|TDRD20A\|TZP
	Cytomap	17q21.31	20q11.22-q11.23
	Type of gene	protein-coding	protein-coding
	Description	KAT8 regulatory NSL complex subunit 1MLL1/MLL complex subunit KANSL1MSL1 homolog 1NSL complex protein NSL1centromere protein 36male-specific lethal 1 homolognon-specific lethal 1 homolog	PHD finger protein 20glioma-expressed antigen 2hepatocellular carcinoma-associated antigen 58novel zinc finger proteintranscription factor TZPtudor domain containing 20A
	Modification date	20200327	20200313
	UniProtAcc	A0AUZ9 Main function of 5'-partner protein:	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000262419, ENST00000432791, ENST00000572904, ENST00000574590, ENST00000575318, ENST00000393476, ENST00000576248,	ENST00000439301, ENST00000481202, ENST00000374012,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	34 X 33 X 14=15708	26 X 25 X 15=9750
	# samples	47	32
	** MAII score	log2(47/15708*10)=-5.0626949361014 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(32/9750*10)=-4.92925840863697 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: KANSL1 [Title/Abstract] AND PHF20 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: KANSL1 [Title/Abstract] AND PHF20 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	KANSL1(44171925)-PHF20(34515701), # samples:1
Anticipated loss of major functional domain due to fusion event.	KANSL1-PHF20 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. KANSL1-PHF20 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. KANSL1-PHF20 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. KANSL1-PHF20 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. KANSL1-PHF20 seems lost the major protein functional domain in Hgene partner, which is a epigenetic factor due to the frame-shifted ORF. KANSL1-PHF20 seems lost the major protein functional domain in Hgene partner, which is a essential gene due to the frame-shifted ORF. KANSL1-PHF20 seems lost the major protein functional domain in Tgene partner, which is a epigenetic factor due to the frame-shifted ORF. KANSL1-PHF20 seems lost the major protein functional domain in Tgene partner, which is a essential gene due to the frame-shifted ORF. KANSL1-PHF20 seems lost the major protein functional domain in Tgene partner, which is a transcription factor due to the frame-shifted ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	KANSL1	GO:0043981	histone H4-K5 acetylation	20018852
Hgene	KANSL1	GO:0043982	histone H4-K8 acetylation	20018852
Hgene	KANSL1	GO:0043984	histone H4-K16 acetylation	20018852
Tgene	PHF20	GO:0043981	histone H4-K5 acetylation	20018852
Tgene	PHF20	GO:0043982	histone H4-K8 acetylation	20018852
Tgene	PHF20	GO:0043984	histone H4-K16 acetylation	20018852

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr17:44171925/chr20:34515701)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across KANSL1 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across PHF20 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000574590	KANSL1	chr17	44171925	-	ENST00000374012	PHF20	chr20	34515701	+	5447	1658	227	2692	821
ENST00000575318	KANSL1	chr17	44171925	-	ENST00000374012	PHF20	chr20	34515701	+	5254	1465	34	2499	821
ENST00000432791	KANSL1	chr17	44171925	-	ENST00000374012	PHF20	chr20	34515701	+	5305	1516	85	2550	821

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000574590	ENST00000374012	KANSL1	chr17	44171925	-	PHF20	chr20	34515701	+	0.00140626	0.99859375
ENST00000575318	ENST00000374012	KANSL1	chr17	44171925	-	PHF20	chr20	34515701	+	0.00151366	0.9984863
ENST00000432791	ENST00000374012	KANSL1	chr17	44171925	-	PHF20	chr20	34515701	+	0.001562568	0.99843746

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for KANSL1-PHF20

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
KANSL1	chr17	44171925	PHF20	chr20	34515701	1465	477	QQTDIYKQIRANKCEECQCWQHGVCM
KANSL1	chr17	44171925	PHF20	chr20	34515701	1516	477	QQTDIYKQIRANKCEECQCWQHGVCM
KANSL1	chr17	44171925	PHF20	chr20	34515701	1658	477	QQTDIYKQIRANKCEECQCWQHGVCM

Top

Potential FusionNeoAntigen Information of KANSL1-PHF20 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA I

FusionNeoAntigen peptide

Binding score

Immunogenic score

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Potential FusionNeoAntigen Information of KANSL1-PHF20 in HLA II

KANSL1-PHF20_44171925_34515701.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
KANSL1-PHF20	chr17	44171925	chr20	34515701	1516	DRB1-0101	QTDIYKQIRANKCEE	1	16
KANSL1-PHF20	chr17	44171925	chr20	34515701	1516	DRB1-0101	TDIYKQIRANKCEEC	2	17
KANSL1-PHF20	chr17	44171925	chr20	34515701	1516	DRB1-0101	QQTDIYKQIRANKCE	0	15
KANSL1-PHF20	chr17	44171925	chr20	34515701	1516	DRB1-0103	QTDIYKQIRANKCEE	1	16
KANSL1-PHF20	chr17	44171925	chr20	34515701	1516	DRB1-0103	TDIYKQIRANKCEEC	2	17
KANSL1-PHF20	chr17	44171925	chr20	34515701	1516	DRB1-0103	QQTDIYKQIRANKCE	0	15
KANSL1-PHF20	chr17	44171925	chr20	34515701	1516	DRB1-0105	QTDIYKQIRANKCEE	1	16
KANSL1-PHF20	chr17	44171925	chr20	34515701	1516	DRB1-0105	TDIYKQIRANKCEEC	2	17
KANSL1-PHF20	chr17	44171925	chr20	34515701	1516	DRB1-0105	QQTDIYKQIRANKCE	0	15
KANSL1-PHF20	chr17	44171925	chr20	34515701	1516	DRB1-0107	QTDIYKQIRANKCEE	1	16
KANSL1-PHF20	chr17	44171925	chr20	34515701	1516	DRB1-0107	TDIYKQIRANKCEEC	2	17
KANSL1-PHF20	chr17	44171925	chr20	34515701	1516	DRB1-0107	QQTDIYKQIRANKCE	0	15
KANSL1-PHF20	chr17	44171925	chr20	34515701	1516	DRB1-0109	QTDIYKQIRANKCEE	1	16
KANSL1-PHF20	chr17	44171925	chr20	34515701	1516	DRB1-0109	TDIYKQIRANKCEEC	2	17
KANSL1-PHF20	chr17	44171925	chr20	34515701	1516	DRB1-0109	QQTDIYKQIRANKCE	0	15
KANSL1-PHF20	chr17	44171925	chr20	34515701	1516	DRB1-0111	QTDIYKQIRANKCEE	1	16
KANSL1-PHF20	chr17	44171925	chr20	34515701	1516	DRB1-0111	TDIYKQIRANKCEEC	2	17
KANSL1-PHF20	chr17	44171925	chr20	34515701	1516	DRB1-0111	QQTDIYKQIRANKCE	0	15
KANSL1-PHF20	chr17	44171925	chr20	34515701	1516	DRB1-0113	QTDIYKQIRANKCEE	1	16
KANSL1-PHF20	chr17	44171925	chr20	34515701	1516	DRB1-0113	TDIYKQIRANKCEEC	2	17
KANSL1-PHF20	chr17	44171925	chr20	34515701	1516	DRB1-0113	QQTDIYKQIRANKCE	0	15
KANSL1-PHF20	chr17	44171925	chr20	34515701	1516	DRB1-0115	QTDIYKQIRANKCEE	1	16
KANSL1-PHF20	chr17	44171925	chr20	34515701	1516	DRB1-0115	TDIYKQIRANKCEEC	2	17
KANSL1-PHF20	chr17	44171925	chr20	34515701	1516	DRB1-0115	QQTDIYKQIRANKCE	0	15
KANSL1-PHF20	chr17	44171925	chr20	34515701	1516	DRB1-0117	QTDIYKQIRANKCEE	1	16
KANSL1-PHF20	chr17	44171925	chr20	34515701	1516	DRB1-0117	TDIYKQIRANKCEEC	2	17
KANSL1-PHF20	chr17	44171925	chr20	34515701	1516	DRB1-0117	QQTDIYKQIRANKCE	0	15
KANSL1-PHF20	chr17	44171925	chr20	34515701	1516	DRB1-0119	QTDIYKQIRANKCEE	1	16
KANSL1-PHF20	chr17	44171925	chr20	34515701	1516	DRB1-0119	TDIYKQIRANKCEEC	2	17
KANSL1-PHF20	chr17	44171925	chr20	34515701	1516	DRB1-0119	QQTDIYKQIRANKCE	0	15
KANSL1-PHF20	chr17	44171925	chr20	34515701	1516	DRB1-0121	QTDIYKQIRANKCEE	1	16
KANSL1-PHF20	chr17	44171925	chr20	34515701	1516	DRB1-0121	TDIYKQIRANKCEEC	2	17
KANSL1-PHF20	chr17	44171925	chr20	34515701	1516	DRB1-0121	QQTDIYKQIRANKCE	0	15
KANSL1-PHF20	chr17	44171925	chr20	34515701	1516	DRB1-0125	QTDIYKQIRANKCEE	1	16
KANSL1-PHF20	chr17	44171925	chr20	34515701	1516	DRB1-0125	TDIYKQIRANKCEEC	2	17
KANSL1-PHF20	chr17	44171925	chr20	34515701	1516	DRB1-0125	QQTDIYKQIRANKCE	0	15
KANSL1-PHF20	chr17	44171925	chr20	34515701	1516	DRB1-0127	QTDIYKQIRANKCEE	1	16
KANSL1-PHF20	chr17	44171925	chr20	34515701	1516	DRB1-0127	TDIYKQIRANKCEEC	2	17
KANSL1-PHF20	chr17	44171925	chr20	34515701	1516	DRB1-0127	QQTDIYKQIRANKCE	0	15
KANSL1-PHF20	chr17	44171925	chr20	34515701	1516	DRB1-0129	QTDIYKQIRANKCEE	1	16
KANSL1-PHF20	chr17	44171925	chr20	34515701	1516	DRB1-0129	TDIYKQIRANKCEEC	2	17
KANSL1-PHF20	chr17	44171925	chr20	34515701	1516	DRB1-0129	QQTDIYKQIRANKCE	0	15
KANSL1-PHF20	chr17	44171925	chr20	34515701	1516	DRB1-0131	QTDIYKQIRANKCEE	1	16
KANSL1-PHF20	chr17	44171925	chr20	34515701	1516	DRB1-0131	TDIYKQIRANKCEEC	2	17
KANSL1-PHF20	chr17	44171925	chr20	34515701	1516	DRB1-0131	QQTDIYKQIRANKCE	0	15
KANSL1-PHF20	chr17	44171925	chr20	34515701	1516	DRB1-0447	QTDIYKQIRANKCEE	1	16
KANSL1-PHF20	chr17	44171925	chr20	34515701	1516	DRB1-1001	QTDIYKQIRANKCEE	1	16
KANSL1-PHF20	chr17	44171925	chr20	34515701	1516	DRB1-1003	QTDIYKQIRANKCEE	1	16
KANSL1-PHF20	chr17	44171925	chr20	34515701	1516	DRB1-1130	QTDIYKQIRANKCEE	1	16
KANSL1-PHF20	chr17	44171925	chr20	34515701	1516	DRB1-1446	QTDIYKQIRANKCEE	1	16
KANSL1-PHF20	chr17	44171925	chr20	34515701	1516	DRB1-1515	QTDIYKQIRANKCEE	1	16
KANSL1-PHF20	chr17	44171925	chr20	34515701	1516	DRB1-1527	QTDIYKQIRANKCEE	1	16
KANSL1-PHF20	chr17	44171925	chr20	34515701	1516	DRB1-1534	QTDIYKQIRANKCEE	1	16
KANSL1-PHF20	chr17	44171925	chr20	34515701	1516	DRB1-1601	QTDIYKQIRANKCEE	1	16
KANSL1-PHF20	chr17	44171925	chr20	34515701	1516	DRB1-1601	TDIYKQIRANKCEEC	2	17
KANSL1-PHF20	chr17	44171925	chr20	34515701	1516	DRB1-1601	QQTDIYKQIRANKCE	0	15
KANSL1-PHF20	chr17	44171925	chr20	34515701	1516	DRB1-1602	QTDIYKQIRANKCEE	1	16
KANSL1-PHF20	chr17	44171925	chr20	34515701	1516	DRB1-1603	QTDIYKQIRANKCEE	1	16
KANSL1-PHF20	chr17	44171925	chr20	34515701	1516	DRB1-1603	TDIYKQIRANKCEEC	2	17
KANSL1-PHF20	chr17	44171925	chr20	34515701	1516	DRB1-1603	QQTDIYKQIRANKCE	0	15
KANSL1-PHF20	chr17	44171925	chr20	34515701	1516	DRB1-1604	QTDIYKQIRANKCEE	1	16
KANSL1-PHF20	chr17	44171925	chr20	34515701	1516	DRB1-1604	TDIYKQIRANKCEEC	2	17
KANSL1-PHF20	chr17	44171925	chr20	34515701	1516	DRB1-1605	QTDIYKQIRANKCEE	1	16
KANSL1-PHF20	chr17	44171925	chr20	34515701	1516	DRB1-1607	QTDIYKQIRANKCEE	1	16
KANSL1-PHF20	chr17	44171925	chr20	34515701	1516	DRB1-1608	QTDIYKQIRANKCEE	1	16
KANSL1-PHF20	chr17	44171925	chr20	34515701	1516	DRB1-1608	TDIYKQIRANKCEEC	2	17
KANSL1-PHF20	chr17	44171925	chr20	34515701	1516	DRB1-1608	QQTDIYKQIRANKCE	0	15
KANSL1-PHF20	chr17	44171925	chr20	34515701	1516	DRB1-1609	QTDIYKQIRANKCEE	1	16
KANSL1-PHF20	chr17	44171925	chr20	34515701	1516	DRB1-1610	QTDIYKQIRANKCEE	1	16
KANSL1-PHF20	chr17	44171925	chr20	34515701	1516	DRB1-1611	QTDIYKQIRANKCEE	1	16
KANSL1-PHF20	chr17	44171925	chr20	34515701	1516	DRB1-1612	QTDIYKQIRANKCEE	1	16
KANSL1-PHF20	chr17	44171925	chr20	34515701	1516	DRB1-1614	QTDIYKQIRANKCEE	1	16
KANSL1-PHF20	chr17	44171925	chr20	34515701	1516	DRB1-1616	QTDIYKQIRANKCEE	1	16
KANSL1-PHF20	chr17	44171925	chr20	34515701	1516	DRB3-0217	QTDIYKQIRANKCEE	1	16
KANSL1-PHF20	chr17	44171925	chr20	34515701	1516	DRB5-0102	QTDIYKQIRANKCEE	1	16
KANSL1-PHF20	chr17	44171925	chr20	34515701	1516	DRB5-0108N	QTDIYKQIRANKCEE	1	16

Top

Fusion breakpoint peptide structures of KANSL1-PHF20

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of KANSL1-PHF20

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele

PDB ID

File name

BPseq

Docking score

Glide score

Top

Vaccine Design for the FusionNeoAntigens of KANSL1-PHF20

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide sequence

FusionNeoAntigen RNA sequence

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
KANSL1-PHF20	chr17	44171925	chr20	34515701	0	15	QQTDIYKQIRANKCE	CAGCAAACAGACATTTACAAACAGATACGTGCTAATAAGTGTGAA
KANSL1-PHF20	chr17	44171925	chr20	34515701	1	16	QTDIYKQIRANKCEE	CAAACAGACATTTACAAACAGATACGTGCTAATAAGTGTGAAGAG
KANSL1-PHF20	chr17	44171925	chr20	34515701	2	17	TDIYKQIRANKCEEC	ACAGACATTTACAAACAGATACGTGCTAATAAGTGTGAAGAGTGC

Top

Information of the samples that have these potential fusion neoantigens of KANSL1-PHF20

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type

Fusion gene

Hchr

Hbp

Henst

Tchr

Tbp

Tenst

Sample

Top

Potential target of CAR-T therapy development for KANSL1-PHF20

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to KANSL1-PHF20

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to KANSL1-PHF20

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)