Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:KAZN-MTOR

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: KAZN-MTOR
	FusionPDB ID: 41285
	FusionGDB2.0 ID: 41285
		Hgene	Tgene
	Gene symbol	KAZN	MTOR
	Gene ID	23254	2475
	Gene name	kazrin, periplakin interacting protein	mechanistic target of rapamycin kinase
	Synonyms	C1orf196\|KAZ	FRAP\|FRAP1\|FRAP2\|RAFT1\|RAPT1\|SKS
	Cytomap	1p36.21	1p36.22
	Type of gene	protein-coding	protein-coding
	Description	kazrin	serine/threonine-protein kinase mTORFK506 binding protein 12-rapamycin associated protein 2FK506-binding protein 12-rapamycin complex-associated protein 1FKBP-rapamycin associated proteinFKBP12-rapamycin complex-associated protein 1mammalian target o
	Modification date	20200313	20200329
	UniProtAcc	Q674X7 Main function of 5'-partner protein: FUNCTION: Component of the cornified envelope of keratinocytes. May be involved in the interplay between adherens junctions and desmosomes. The function in the nucleus is not known. {ECO:0000269\|PubMed:15337775}.	TLDC1 Main function of 5'-partner protein: 456
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000361144, ENST00000376030, ENST00000400797, ENST00000400798, ENST00000422387, ENST00000503743,	ENST00000376838, ENST00000495435, ENST00000361445,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	15 X 11 X 8=1320	12 X 11 X 8=1056
	# samples	18	19
	** MAII score	log2(18/1320*10)=-2.87446911791614 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(19/1056*10)=-2.47453851102751 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: KAZN [Title/Abstract] AND MTOR [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: KAZN [Title/Abstract] AND MTOR [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	KAZN(15251068)-MTOR(11206848), # samples:3
Anticipated loss of major functional domain due to fusion event.	KAZN-MTOR seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. KAZN-MTOR seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. KAZN-MTOR seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. KAZN-MTOR seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Tgene	MTOR	GO:0001558	regulation of cell growth	18762023
Tgene	MTOR	GO:0001934	positive regulation of protein phosphorylation	20233713
Tgene	MTOR	GO:0006468	protein phosphorylation	12150926\|15467718\|18925875
Tgene	MTOR	GO:0009267	cellular response to starvation	28223137
Tgene	MTOR	GO:0010507	negative regulation of autophagy	30704899
Tgene	MTOR	GO:0016242	negative regulation of macroautophagy	25327288
Tgene	MTOR	GO:0016310	phosphorylation	11853878\|25327288
Tgene	MTOR	GO:0031667	response to nutrient levels	29750193
Tgene	MTOR	GO:0034198	cellular response to amino acid starvation	22424946
Tgene	MTOR	GO:0038202	TORC1 signaling	28223137
Tgene	MTOR	GO:0043200	response to amino acid	18497260
Tgene	MTOR	GO:0045727	positive regulation of translation	18762023
Tgene	MTOR	GO:0046777	protein autophosphorylation	15467718
Tgene	MTOR	GO:0071230	cellular response to amino acid stimulus	22424946
Tgene	MTOR	GO:0071233	cellular response to leucine	22424946
Tgene	MTOR	GO:1990253	cellular response to leucine starvation	22424946

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr1:15251068/chr1:11206848)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across KAZN (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across MTOR (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst

Tenst

Hgene

Hchr

Hbp

Hstrand

Tgene

Tchr

Tbp

Tstrand

Seq length
(transcript)

BP loci
(transcript)

Predicted start
(transcript)

Predicted stop
(transcript)

Seq length
(amino acids)

ENST00000361144

KAZN

chr1

15251068

ENST00000361445

MTOR

chr1

11206848

4473

443

208

3522

1104

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000361144	ENST00000361445	KAZN	chr1	15251068	+	MTOR	chr1	11206848	-	0.003426151	0.9965739

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for KAZN-MTOR

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
KAZN	chr1	15251068	MTOR	chr1	11206848	443	78	VPRVRADGDCSQPGQWDSMEEYTCMI

Top

Potential FusionNeoAntigen Information of KAZN-MTOR in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

KAZN-MTOR_15251068_11206848.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
KAZN-MTOR	chr1	15251068	chr1	11206848	443	HLA-B15:01	QPGQWDSMEEY	0.9893	0.8151	11	22
KAZN-MTOR	chr1	15251068	chr1	11206848	443	HLA-B35:01	QPGQWDSMEEY	0.9763	0.7751	11	22
KAZN-MTOR	chr1	15251068	chr1	11206848	443	HLA-B35:08	QPGQWDSMEEY	0.9684	0.7794	11	22
KAZN-MTOR	chr1	15251068	chr1	11206848	443	HLA-B35:05	QPGQWDSMEEY	0.8712	0.6483	11	22
KAZN-MTOR	chr1	15251068	chr1	11206848	443	HLA-B53:01	QPGQWDSMEEY	0.7915	0.5884	11	22
KAZN-MTOR	chr1	15251068	chr1	11206848	443	HLA-B39:09	SQPGQWDSM	0.7317	0.7221	10	19
KAZN-MTOR	chr1	15251068	chr1	11206848	443	HLA-B48:03	SQPGQWDSM	0.3934	0.6144	10	19
KAZN-MTOR	chr1	15251068	chr1	11206848	443	HLA-B15:05	QPGQWDSMEEY	0.9797	0.7689	11	22
KAZN-MTOR	chr1	15251068	chr1	11206848	443	HLA-B15:31	QPGQWDSMEEY	0.9759	0.7888	11	22
KAZN-MTOR	chr1	15251068	chr1	11206848	443	HLA-C01:02	SQPGQWDSM	0.9535	0.9501	10	19
KAZN-MTOR	chr1	15251068	chr1	11206848	443	HLA-B15:30	SQPGQWDSM	0.7858	0.9457	10	19
KAZN-MTOR	chr1	15251068	chr1	11206848	443	HLA-B40:12	SQPGQWDSM	0.3934	0.6144	10	19
KAZN-MTOR	chr1	15251068	chr1	11206848	443	HLA-B15:11	QPGQWDSMEEY	0.9901	0.8014	11	22
KAZN-MTOR	chr1	15251068	chr1	11206848	443	HLA-B15:125	QPGQWDSMEEY	0.9893	0.8151	11	22
KAZN-MTOR	chr1	15251068	chr1	11206848	443	HLA-B15:34	QPGQWDSMEEY	0.9893	0.8151	11	22
KAZN-MTOR	chr1	15251068	chr1	11206848	443	HLA-B15:33	QPGQWDSMEEY	0.9893	0.8151	11	22
KAZN-MTOR	chr1	15251068	chr1	11206848	443	HLA-B15:08	QPGQWDSMEEY	0.9892	0.7937	11	22
KAZN-MTOR	chr1	15251068	chr1	11206848	443	HLA-B15:135	QPGQWDSMEEY	0.9876	0.8204	11	22
KAZN-MTOR	chr1	15251068	chr1	11206848	443	HLA-B15:50	QPGQWDSMEEY	0.9853	0.8355	11	22
KAZN-MTOR	chr1	15251068	chr1	11206848	443	HLA-B15:53	QPGQWDSMEEY	0.9813	0.8093	11	22
KAZN-MTOR	chr1	15251068	chr1	11206848	443	HLA-B15:20	QPGQWDSMEEY	0.9803	0.8079	11	22
KAZN-MTOR	chr1	15251068	chr1	11206848	443	HLA-B35:28	QPGQWDSMEEY	0.9779	0.8209	11	22
KAZN-MTOR	chr1	15251068	chr1	11206848	443	HLA-B35:77	QPGQWDSMEEY	0.9763	0.7751	11	22
KAZN-MTOR	chr1	15251068	chr1	11206848	443	HLA-B35:20	QPGQWDSMEEY	0.9743	0.8296	11	22
KAZN-MTOR	chr1	15251068	chr1	11206848	443	HLA-B35:24	QPGQWDSMEEY	0.974	0.7409	11	22
KAZN-MTOR	chr1	15251068	chr1	11206848	443	HLA-B35:23	QPGQWDSMEEY	0.9739	0.8099	11	22
KAZN-MTOR	chr1	15251068	chr1	11206848	443	HLA-B35:11	QPGQWDSMEEY	0.9675	0.8476	11	22
KAZN-MTOR	chr1	15251068	chr1	11206848	443	HLA-B15:12	QPGQWDSMEEY	0.9672	0.8153	11	22
KAZN-MTOR	chr1	15251068	chr1	11206848	443	HLA-B35:30	QPGQWDSMEEY	0.9097	0.7526	11	22
KAZN-MTOR	chr1	15251068	chr1	11206848	443	HLA-B35:17	QPGQWDSMEEY	0.9097	0.7526	11	22
KAZN-MTOR	chr1	15251068	chr1	11206848	443	HLA-B48:02	QPGQWDSMEEY	0.7569	0.7866	11	22

Top

Potential FusionNeoAntigen Information of KAZN-MTOR in HLA II

KAZN-MTOR_15251068_11206848.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
KAZN-MTOR	chr1	15251068	chr1	11206848	443	DRB1-0422	VPRVRADGDCSQPGQ	0	15

Top

Fusion breakpoint peptide structures of KAZN-MTOR

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
1108	DGDCSQPGQWDSME	KAZN	MTOR	chr1	15251068	chr1	11206848	443

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of KAZN-MTOR

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	1108	DGDCSQPGQWDSME	-7.15543	-7.26883
HLA-B14:02	3BVN	1108	DGDCSQPGQWDSME	-4.77435	-5.80965
HLA-B52:01	3W39	1108	DGDCSQPGQWDSME	-6.80875	-6.92215
HLA-B52:01	3W39	1108	DGDCSQPGQWDSME	-4.20386	-5.23916
HLA-A11:01	4UQ2	1108	DGDCSQPGQWDSME	-7.5194	-8.5547
HLA-A11:01	4UQ2	1108	DGDCSQPGQWDSME	-6.9601	-7.0735
HLA-A24:02	5HGA	1108	DGDCSQPGQWDSME	-7.52403	-7.63743
HLA-A24:02	5HGA	1108	DGDCSQPGQWDSME	-5.82433	-6.85963
HLA-B27:05	6PYJ	1108	DGDCSQPGQWDSME	-3.28285	-4.31815
HLA-B44:05	3DX8	1108	DGDCSQPGQWDSME	-5.91172	-6.94702
HLA-B44:05	3DX8	1108	DGDCSQPGQWDSME	-4.24346	-4.35686

Top

Vaccine Design for the FusionNeoAntigens of KAZN-MTOR

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
KAZN-MTOR	chr1	15251068	chr1	11206848	10	19	SQPGQWDSM	GCCAGCCCGGTCAGTGGGACAGCATGG
KAZN-MTOR	chr1	15251068	chr1	11206848	11	22	QPGQWDSMEEY	AGCCCGGTCAGTGGGACAGCATGGAAGAATACA

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
KAZN-MTOR	chr1	15251068	chr1	11206848	0	15	VPRVRADGDCSQPGQ	TTCCCCGGGTCCGAGCGGATGGCGACTGCAGCCAGCCCGGTCAGT

Top

Information of the samples that have these potential fusion neoantigens of KAZN-MTOR

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
UCEC	KAZN-MTOR	chr1	15251068	ENST00000361144	chr1	11206848	ENST00000361445	TCGA-D1-A3JQ-01A

Top

Potential target of CAR-T therapy development for KAZN-MTOR

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to KAZN-MTOR

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to KAZN-MTOR

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)