![]() |
|||||||
|
Fusion Protein:KDM6A-NDUFB11 |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: KDM6A-NDUFB11 | FusionPDB ID: 41907 | FusionGDB2.0 ID: 41907 | Hgene | Tgene | Gene symbol | KDM6A | NDUFB11 | Gene ID | 7403 | 54539 |
Gene name | lysine demethylase 6A | NADH:ubiquinone oxidoreductase subunit B11 | |
Synonyms | KABUK2|UTX|bA386N14.2 | CI-ESSS|ESSS|MC1DN30|NP17.3|Np15|P17.3 | |
Cytomap | Xp11.3 | Xp11.3 | |
Type of gene | protein-coding | protein-coding | |
Description | lysine-specific demethylase 6AbA386N14.2 (ubiquitously transcribed X chromosome tetratricopeptide repeat protein (UTX))histone demethylase UTXlysine (K)-specific demethylase 6Aubiquitously transcribed tetratricopeptide repeat protein X-linkedubiquito | NADH dehydrogenase [ubiquinone] 1 beta subcomplex subunit 11, mitochondrialNADH dehydrogenase (ubiquinone) 1 beta subcomplex, 11, 17.3kDaNADH-ubiquinone oxidoreductase ESSS subunitcomplex I NP17.3 subunitcomplex I-ESSSneuronal protein 17.3 | |
Modification date | 20200313 | 20200328 | |
UniProtAcc | O15550 Main function of 5'-partner protein: FUNCTION: Histone demethylase that specifically demethylates 'Lys-27' of histone H3, thereby playing a central role in histone code (PubMed:17851529, PubMed:17713478, PubMed:17761849). Demethylates trimethylated and dimethylated but not monomethylated H3 'Lys-27' (PubMed:17851529, PubMed:17713478, PubMed:17761849). Plays a central role in regulation of posterior development, by regulating HOX gene expression (PubMed:17851529). Demethylation of 'Lys-27' of histone H3 is concomitant with methylation of 'Lys-4' of histone H3, and regulates the recruitment of the PRC1 complex and monoubiquitination of histone H2A (PubMed:17761849). Plays a demethylase-independent role in chromatin remodeling to regulate T-box family member-dependent gene expression (By similarity). {ECO:0000250|UniProtKB:O70546, ECO:0000269|PubMed:17713478, ECO:0000269|PubMed:17761849, ECO:0000269|PubMed:17851529, ECO:0000269|PubMed:18003914}. | Q9NX14 Main function of 5'-partner protein: FUNCTION: Accessory subunit of the mitochondrial membrane respiratory chain NADH dehydrogenase (Complex I), that is believed not to be involved in catalysis. Complex I functions in the transfer of electrons from NADH to the respiratory chain. The immediate electron acceptor for the enzyme is believed to be ubiquinone. {ECO:0000269|PubMed:27626371}. | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000377967, ENST00000382899, ENST00000536777, ENST00000543216, ENST00000479423, | ENST00000276062, ENST00000377811, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 19 X 9 X 11=1881 | 3 X 3 X 2=18 |
# samples | 20 | 3 | |
** MAII score | log2(20/1881*10)=-3.23342794374847 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(3/18*10)=0.736965594166206 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0 | |
Fusion gene context | PubMed: KDM6A [Title/Abstract] AND NDUFB11 [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: KDM6A [Title/Abstract] AND NDUFB11 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | KDM6A(44733233)-NDUFB11(47002143), # samples:1 | ||
Anticipated loss of major functional domain due to fusion event. | KDM6A-NDUFB11 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. KDM6A-NDUFB11 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. KDM6A-NDUFB11 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. KDM6A-NDUFB11 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chrX:44733233/chrX:47002143) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000377967 | KDM6A | chrX | 44733233 | + | ENST00000377811 | NDUFB11 | chrX | 47002143 | - | 622 | 266 | 41 | 520 | 159 |
ENST00000377967 | KDM6A | chrX | 44733233 | + | ENST00000276062 | NDUFB11 | chrX | 47002143 | - | 648 | 266 | 41 | 550 | 169 |
ENST00000382899 | KDM6A | chrX | 44733233 | + | ENST00000377811 | NDUFB11 | chrX | 47002143 | - | 598 | 242 | 17 | 496 | 159 |
ENST00000382899 | KDM6A | chrX | 44733233 | + | ENST00000276062 | NDUFB11 | chrX | 47002143 | - | 624 | 242 | 17 | 526 | 169 |
ENST00000536777 | KDM6A | chrX | 44733233 | + | ENST00000377811 | NDUFB11 | chrX | 47002143 | - | 598 | 242 | 17 | 496 | 159 |
ENST00000536777 | KDM6A | chrX | 44733233 | + | ENST00000276062 | NDUFB11 | chrX | 47002143 | - | 624 | 242 | 17 | 526 | 169 |
ENST00000543216 | KDM6A | chrX | 44733233 | + | ENST00000377811 | NDUFB11 | chrX | 47002143 | - | 581 | 225 | 0 | 479 | 159 |
ENST00000543216 | KDM6A | chrX | 44733233 | + | ENST00000276062 | NDUFB11 | chrX | 47002143 | - | 607 | 225 | 0 | 509 | 169 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000377967 | ENST00000377811 | KDM6A | chrX | 44733233 | + | NDUFB11 | chrX | 47002143 | - | 0.005633528 | 0.99436647 |
ENST00000377967 | ENST00000276062 | KDM6A | chrX | 44733233 | + | NDUFB11 | chrX | 47002143 | - | 0.008609315 | 0.9913907 |
ENST00000382899 | ENST00000377811 | KDM6A | chrX | 44733233 | + | NDUFB11 | chrX | 47002143 | - | 0.005791825 | 0.9942082 |
ENST00000382899 | ENST00000276062 | KDM6A | chrX | 44733233 | + | NDUFB11 | chrX | 47002143 | - | 0.009859869 | 0.99014014 |
ENST00000536777 | ENST00000377811 | KDM6A | chrX | 44733233 | + | NDUFB11 | chrX | 47002143 | - | 0.005791825 | 0.9942082 |
ENST00000536777 | ENST00000276062 | KDM6A | chrX | 44733233 | + | NDUFB11 | chrX | 47002143 | - | 0.009859869 | 0.99014014 |
ENST00000543216 | ENST00000377811 | KDM6A | chrX | 44733233 | + | NDUFB11 | chrX | 47002143 | - | 0.004845445 | 0.9951546 |
ENST00000543216 | ENST00000276062 | KDM6A | chrX | 44733233 | + | NDUFB11 | chrX | 47002143 | - | 0.009004407 | 0.9909956 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for KDM6A-NDUFB11 |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
KDM6A | chrX | 44733233 | NDUFB11 | chrX | 47002143 | 225 | 75 | HEDGARTKALLGKNPDSHGYDKDPVL |
KDM6A | chrX | 44733233 | NDUFB11 | chrX | 47002143 | 242 | 75 | HEDGARTKALLGKNPDSHGYDKDPVL |
KDM6A | chrX | 44733233 | NDUFB11 | chrX | 47002143 | 266 | 75 | HEDGARTKALLGKNPDSHGYDKDPVL |
Top |
Potential FusionNeoAntigen Information of KDM6A-NDUFB11 in HLA I |
![]() |
KDM6A-NDUFB11_44733233_47002143.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
KDM6A-NDUFB11 | chrX | 44733233 | chrX | 47002143 | 266 | HLA-B15:03 | GKNPDSHGY | 0.228 | 0.5445 | 11 | 20 |
KDM6A-NDUFB11 | chrX | 44733233 | chrX | 47002143 | 266 | HLA-B48:02 | GKNPDSHGY | 0.2204 | 0.7918 | 11 | 20 |
KDM6A-NDUFB11 | chrX | 44733233 | chrX | 47002143 | 266 | HLA-B15:53 | GKNPDSHGY | 0.0357 | 0.7098 | 11 | 20 |
KDM6A-NDUFB11 | chrX | 44733233 | chrX | 47002143 | 266 | HLA-B15:54 | GKNPDSHGY | 0.0118 | 0.6792 | 11 | 20 |
KDM6A-NDUFB11 | chrX | 44733233 | chrX | 47002143 | 266 | HLA-B15:54 | LGKNPDSHGY | 0.9898 | 0.5338 | 10 | 20 |
Top |
Potential FusionNeoAntigen Information of KDM6A-NDUFB11 in HLA II |
![]() |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of KDM6A-NDUFB11 |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
9424 | TKALLGKNPDSHGY | KDM6A | NDUFB11 | chrX | 44733233 | chrX | 47002143 | 266 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of KDM6A-NDUFB11 |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 9424 | TKALLGKNPDSHGY | -6.44495 | -6.55835 |
HLA-B14:02 | 3BVN | 9424 | TKALLGKNPDSHGY | -4.99634 | -6.03164 |
HLA-B52:01 | 3W39 | 9424 | TKALLGKNPDSHGY | -4.20701 | -5.24231 |
HLA-B52:01 | 3W39 | 9424 | TKALLGKNPDSHGY | -3.71661 | -3.83001 |
HLA-A24:02 | 5HGA | 9424 | TKALLGKNPDSHGY | -6.53818 | -6.65158 |
HLA-A24:02 | 5HGA | 9424 | TKALLGKNPDSHGY | -4.37882 | -5.41412 |
HLA-B44:05 | 3DX8 | 9424 | TKALLGKNPDSHGY | -4.88113 | -4.99453 |
HLA-B44:05 | 3DX8 | 9424 | TKALLGKNPDSHGY | -3.29255 | -4.32785 |
Top |
Vaccine Design for the FusionNeoAntigens of KDM6A-NDUFB11 |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
KDM6A-NDUFB11 | chrX | 44733233 | chrX | 47002143 | 10 | 20 | LGKNPDSHGY | CTGGGCAAGAACCCAGACTCCCATGGTTAT |
KDM6A-NDUFB11 | chrX | 44733233 | chrX | 47002143 | 11 | 20 | GKNPDSHGY | GGCAAGAACCCAGACTCCCATGGTTAT |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of KDM6A-NDUFB11 |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
BRCA | KDM6A-NDUFB11 | chrX | 44733233 | ENST00000377967 | chrX | 47002143 | ENST00000276062 | TCGA-AC-A2QJ-01A |
Top |
Potential target of CAR-T therapy development for KDM6A-NDUFB11 |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
Tgene | NDUFB11 | chrX:44733233 | chrX:47002143 | ENST00000276062 | 0 | 3 | 89_109 | 0 | 164.0 | Transmembrane | Helical | |
Tgene | NDUFB11 | chrX:44733233 | chrX:47002143 | ENST00000377811 | 0 | 3 | 89_109 | 0 | 154.0 | Transmembrane | Helical |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to KDM6A-NDUFB11 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to KDM6A-NDUFB11 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |