Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:KRAS-ETNK1

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: KRAS-ETNK1
	FusionPDB ID: 43430
	FusionGDB2.0 ID: 43430
		Hgene	Tgene
	Gene symbol	KRAS	ETNK1
	Gene ID	3845	55500
	Gene name	KRAS proto-oncogene, GTPase	ethanolamine kinase 1
	Synonyms	'C-K-RAS\|C-K-RAS\|CFC2\|K-RAS2A\|K-RAS2B\|K-RAS4A\|K-RAS4B\|K-Ras\|K-Ras 2\|KI-RAS\|KRAS1\|KRAS2\|NS\|NS3\|OES\|RALD\|RASK2\|c-Ki-ras\|c-Ki-ras2	EKI\|EKI 1\|EKI1\|Nbla10396
	Cytomap	12p12.1	12p12.1
	Type of gene	protein-coding	protein-coding
	Description	GTPase KRasK-ras p21 proteinKirsten rat sarcoma viral oncogene homologKirsten rat sarcoma viral proto-oncogenePR310 c-K-ras oncogenec-Kirsten-ras proteincellular c-Ki-ras2 proto-oncogenecellular transforming proto-oncogeneoncogene KRAS2transformi	ethanolamine kinase 1putative protein product of Nbla10396
	Modification date	20200329	20200313
	UniProtAcc	P01116 Main function of 5'-partner protein: FUNCTION: Ras proteins bind GDP/GTP and possess intrinsic GTPase activity (PubMed:20949621). Plays an important role in the regulation of cell proliferation (PubMed:23698361, PubMed:22711838). Plays a role in promoting oncogenic events by inducing transcriptional silencing of tumor suppressor genes (TSGs) in colorectal cancer (CRC) cells in a ZNF304-dependent manner (PubMed:24623306). {ECO:0000269\|PubMed:20949621, ECO:0000269\|PubMed:22711838, ECO:0000269\|PubMed:23698361, ECO:0000269\|PubMed:24623306, ECO:0000305}.	Q9HBU6 Main function of 5'-partner protein: FUNCTION: Highly specific for ethanolamine phosphorylation. May be a rate-controlling step in phosphatidylethanolamine biosynthesis. {ECO:0000269\|PubMed:11044454}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000556131, ENST00000256078, ENST00000311936, ENST00000557334,	ENST00000266517, ENST00000335148,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	6 X 2 X 5=60	7 X 8 X 3=168
	# samples	6	8
	** MAII score	log2(6/60*10)=0	log2(8/168*10)=-1.0703893278914 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: KRAS [Title/Abstract] AND ETNK1 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: KRAS [Title/Abstract] AND ETNK1 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	KRAS(25398207)-ETNK1(22796696), # samples:2
Anticipated loss of major functional domain due to fusion event.	KRAS-ETNK1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. KRAS-ETNK1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. KRAS-ETNK1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. KRAS-ETNK1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. KRAS-ETNK1 seems lost the major protein functional domain in Hgene partner, which is a CGC due to the frame-shifted ORF. KRAS-ETNK1 seems lost the major protein functional domain in Hgene partner, which is a IUPHAR drug target due to the frame-shifted ORF. KRAS-ETNK1 seems lost the major protein functional domain in Tgene partner, which is a cell metabolism gene due to the frame-shifted ORF. KRAS-ETNK1 seems lost the major protein functional domain in Tgene partner, which is a CGC due to the frame-shifted ORF. KRAS-ETNK1 seems lost the major protein functional domain in Tgene partner, which is a essential gene due to the frame-shifted ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Tgene	ETNK1	GO:0006646	phosphatidylethanolamine biosynthetic process	11044454

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr12:25398207/chr12:22796696)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across KRAS (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across ETNK1 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000311936	KRAS	chr12	25398207	-	ENST00000266517	ETNK1	chr12	22796696	+	6950	303	183	1238	351
ENST00000311936	KRAS	chr12	25398207	-	ENST00000335148	ETNK1	chr12	22796696	+	940	303	183	656	157
ENST00000557334	KRAS	chr12	25398207	-	ENST00000266517	ETNK1	chr12	22796696	+	6955	308	188	1243	351
ENST00000557334	KRAS	chr12	25398207	-	ENST00000335148	ETNK1	chr12	22796696	+	945	308	188	661	157
ENST00000256078	KRAS	chr12	25398207	-	ENST00000266517	ETNK1	chr12	22796696	+	6822	175	55	1110	351
ENST00000256078	KRAS	chr12	25398207	-	ENST00000335148	ETNK1	chr12	22796696	+	812	175	55	528	157

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000311936	ENST00000266517	KRAS	chr12	25398207	-	ETNK1	chr12	22796696	+	3.90E-05	0.999961
ENST00000311936	ENST00000335148	KRAS	chr12	25398207	-	ETNK1	chr12	22796696	+	0.003838934	0.9961611
ENST00000557334	ENST00000266517	KRAS	chr12	25398207	-	ETNK1	chr12	22796696	+	3.90E-05	0.999961
ENST00000557334	ENST00000335148	KRAS	chr12	25398207	-	ETNK1	chr12	22796696	+	0.002918022	0.99708194
ENST00000256078	ENST00000266517	KRAS	chr12	25398207	-	ETNK1	chr12	22796696	+	3.60E-05	0.999964
ENST00000256078	ENST00000335148	KRAS	chr12	25398207	-	ETNK1	chr12	22796696	+	0.003462653	0.9965373

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for KRAS-ETNK1

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
KRAS	chr12	25398207	ETNK1	chr12	22796696	175	40	QNHFVDEYDPTIELFTDGITNKLIGC
KRAS	chr12	25398207	ETNK1	chr12	22796696	303	40	QNHFVDEYDPTIELFTDGITNKLIGC
KRAS	chr12	25398207	ETNK1	chr12	22796696	308	40	QNHFVDEYDPTIELFTDGITNKLIGC

Top

Potential FusionNeoAntigen Information of KRAS-ETNK1 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

KRAS-ETNK1_25398207_22796696.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B39:13	EYDPTIEL	0.9731	0.756	6	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B18:01	DEYDPTIEL	0.9939	0.9113	5	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B13:01	DEYDPTIEL	0.9939	0.7033	5	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B14:01	DEYDPTIEL	0.9912	0.569	5	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B14:02	DEYDPTIEL	0.9912	0.569	5	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B44:03	DEYDPTIEL	0.9725	0.9153	5	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B45:01	DEYDPTIEL	0.9378	0.6892	5	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B35:08	EYDPTIELF	0.9291	0.5806	6	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B15:37	DEYDPTIEL	0.9041	0.6096	5	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B39:13	DEYDPTIEL	0.7301	0.8289	5	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B52:01	DEYDPTIEL	0.7039	0.6753	5	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B39:01	DEYDPTIEL	0.7023	0.845	5	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B38:01	DEYDPTIEL	0.6841	0.8547	5	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B38:02	DEYDPTIEL	0.6795	0.8683	5	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B35:04	DEYDPTIEL	0.6715	0.8601	5	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B35:02	DEYDPTIEL	0.6715	0.8601	5	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B39:06	DEYDPTIEL	0.5907	0.6696	5	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B15:18	EYDPTIELF	0.5696	0.6519	6	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B50:01	DEYDPTIEL	0.5692	0.5591	5	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B41:01	DEYDPTIEL	0.5261	0.7493	5	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B15:10	DEYDPTIEL	0.4678	0.5654	5	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B38:01	EYDPTIELF	0.4595	0.8047	6	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B38:02	EYDPTIELF	0.3675	0.8196	6	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B44:03	DEYDPTIELF	0.9986	0.8981	5	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B18:01	DEYDPTIELF	0.9975	0.9079	5	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B47:01	VDEYDPTIEL	0.842	0.5699	4	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B13:01	VDEYDPTIEL	0.8061	0.8492	4	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B50:01	VDEYDPTIEL	0.7567	0.6798	4	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B39:13	VDEYDPTIEL	0.6411	0.9029	4	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B41:01	VDEYDPTIEL	0.5131	0.8177	4	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B18:01	VDEYDPTIEL	0.3914	0.9306	4	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B18:01	DEYDPTIELFT	0.9923	0.8964	5	16
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-A02:13	FVDEYDPTIEL	0.9884	0.543	3	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B18:01	VDEYDPTIELF	0.9837	0.9334	4	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B39:13	FVDEYDPTIEL	0.9515	0.8612	3	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B47:01	FVDEYDPTIEL	0.9375	0.6139	3	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C04:07	EYDPTIEL	1	0.5927	6	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C04:10	EYDPTIEL	1	0.5924	6	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C05:09	YDPTIELF	0.9996	0.7882	7	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C04:07	YDPTIELF	0.9995	0.5909	7	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C04:10	YDPTIELF	0.9994	0.5856	7	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C07:29	EYDPTIEL	0.9986	0.9034	6	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C07:13	EYDPTIEL	0.998	0.9042	6	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C07:10	EYDPTIEL	0.9975	0.9541	6	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C07:67	EYDPTIEL	0.9972	0.9352	6	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C07:80	EYDPTIEL	0.9972	0.9352	6	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C07:27	EYDPTIEL	0.9971	0.9401	6	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C07:19	EYDPTIEL	0.9956	0.5578	6	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C04:14	YDPTIELF	0.991	0.562	7	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C04:14	EYDPTIEL	0.9892	0.5966	6	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B39:12	EYDPTIEL	0.9829	0.7683	6	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B14:03	EYDPTIEL	0.8773	0.5901	6	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B40:06	DEYDPTIEL	0.9989	0.5386	5	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C04:07	EYDPTIELF	0.996	0.6123	6	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C04:10	EYDPTIELF	0.9958	0.6017	6	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C05:09	EYDPTIELF	0.9944	0.8118	6	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C08:15	EYDPTIELF	0.9895	0.8442	6	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C07:29	EYDPTIELF	0.9714	0.9228	6	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C07:05	EYDPTIELF	0.9643	0.9521	6	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C07:10	EYDPTIELF	0.963	0.956	6	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C07:27	EYDPTIELF	0.9618	0.9381	6	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C07:13	EYDPTIELF	0.9587	0.9085	6	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C07:95	EYDPTIELF	0.9568	0.5696	6	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C07:67	EYDPTIELF	0.9487	0.9377	6	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C07:80	EYDPTIELF	0.9487	0.9377	6	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C07:19	EYDPTIELF	0.9357	0.5859	6	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B15:31	EYDPTIELF	0.9348	0.7815	6	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C07:46	EYDPTIELF	0.9284	0.8442	6	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B39:08	DEYDPTIEL	0.8559	0.5754	5	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B14:03	DEYDPTIEL	0.8073	0.6628	5	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B15:21	EYDPTIELF	0.8043	0.8839	6	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B39:10	DEYDPTIEL	0.7121	0.8144	5	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B39:05	DEYDPTIEL	0.6862	0.8097	5	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B35:12	DEYDPTIEL	0.6715	0.8601	5	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B39:12	DEYDPTIEL	0.649	0.8529	5	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B51:07	DEYDPTIEL	0.5656	0.5975	5	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C04:06	EYDPTIELF	0.5529	0.7763	6	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B39:12	EYDPTIELF	0.545	0.7825	6	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C04:14	EYDPTIELF	0.5044	0.5875	6	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B14:03	EYDPTIELF	0.3754	0.5933	6	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C12:16	EYDPTIELF	0.1177	0.9336	6	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C04:10	DEYDPTIELF	0.9992	0.5923	5	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C04:07	DEYDPTIELF	0.9991	0.6021	5	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B40:06	VDEYDPTIEL	0.9245	0.6721	4	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B39:08	VDEYDPTIEL	0.9203	0.6719	4	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B51:07	DEYDPTIELF	0.8858	0.6028	5	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C01:17	FVDEYDPTIEL	1	0.9211	3	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C05:09	FVDEYDPTIEL	1	0.9268	3	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C04:10	VDEYDPTIELF	1	0.6024	4	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C08:15	FVDEYDPTIEL	1	0.9376	3	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C04:07	VDEYDPTIELF	1	0.6187	4	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C04:10	FVDEYDPTIEL	1	0.6298	3	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C04:07	FVDEYDPTIEL	1	0.6692	3	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C03:07	FVDEYDPTIEL	1	0.9888	3	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C03:08	FVDEYDPTIEL	0.9999	0.9222	3	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C03:19	FVDEYDPTIEL	0.9999	0.9918	3	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C15:06	FVDEYDPTIEL	0.9999	0.9149	3	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C04:06	FVDEYDPTIEL	0.9999	0.8355	3	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C08:04	FVDEYDPTIEL	0.9997	0.9574	3	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C04:14	FVDEYDPTIEL	0.9997	0.6662	3	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C08:13	FVDEYDPTIEL	0.9997	0.9574	3	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C03:14	FVDEYDPTIEL	0.9995	0.9864	3	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C04:14	VDEYDPTIELF	0.9995	0.5865	4	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C08:03	FVDEYDPTIEL	0.9993	0.9622	3	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C02:06	FVDEYDPTIEL	0.9992	0.9797	3	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C07:29	FVDEYDPTIEL	0.999	0.9243	3	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C07:13	FVDEYDPTIEL	0.9989	0.938	3	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C07:10	VDEYDPTIELF	0.9966	0.9694	4	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C07:67	VDEYDPTIELF	0.9947	0.9628	4	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C07:80	VDEYDPTIELF	0.9947	0.9628	4	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B39:08	FVDEYDPTIEL	0.9917	0.6538	3	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B40:06	FVDEYDPTIEL	0.9876	0.7071	3	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C04:01	EYDPTIEL	1	0.5927	6	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C04:03	EYDPTIEL	1	0.6486	6	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C18:01	EYDPTIEL	0.9999	0.6111	6	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C05:01	YDPTIELF	0.9996	0.7882	7	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C04:03	YDPTIELF	0.9996	0.6337	7	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C04:01	YDPTIELF	0.9995	0.5909	7	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C18:01	YDPTIELF	0.9992	0.6052	7	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C04:04	YDPTIELF	0.9977	0.6415	7	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C03:67	EYDPTIEL	0.9973	0.9718	6	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C07:02	EYDPTIEL	0.9972	0.9352	6	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C07:17	EYDPTIEL	0.9968	0.958	6	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C04:04	EYDPTIEL	0.9961	0.7397	6	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C06:06	EYDPTIEL	0.9949	0.9752	6	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C14:03	EYDPTIEL	0.9911	0.9237	6	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C14:02	EYDPTIEL	0.9911	0.9237	6	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B39:02	EYDPTIEL	0.9883	0.7713	6	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C07:04	EYDPTIEL	0.9857	0.8362	6	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B40:04	EYDPTIEL	0.9243	0.5013	6	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B40:04	DEYDPTIEL	0.9985	0.5357	5	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B18:04	DEYDPTIEL	0.9965	0.921	5	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C04:01	EYDPTIELF	0.996	0.6123	6	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B18:07	DEYDPTIEL	0.9955	0.8876	5	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C04:03	EYDPTIELF	0.9946	0.6597	6	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C05:01	EYDPTIELF	0.9944	0.8118	6	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C18:01	EYDPTIELF	0.9941	0.6222	6	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B18:05	DEYDPTIEL	0.9939	0.9113	5	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B18:08	DEYDPTIEL	0.9933	0.8333	5	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B18:06	DEYDPTIEL	0.9913	0.9118	5	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B18:03	DEYDPTIEL	0.9909	0.905	5	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C08:02	EYDPTIELF	0.9895	0.8442	6	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B44:07	DEYDPTIEL	0.9725	0.9153	5	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B44:13	DEYDPTIEL	0.9725	0.9153	5	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B44:26	DEYDPTIEL	0.9725	0.9153	5	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C07:01	EYDPTIELF	0.9498	0.5528	6	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C07:02	EYDPTIELF	0.9487	0.9377	6	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B35:23	EYDPTIELF	0.9421	0.8038	6	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C07:17	EYDPTIELF	0.936	0.958	6	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B18:11	DEYDPTIEL	0.9255	0.8884	5	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B35:20	EYDPTIELF	0.9141	0.8657	6	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B18:04	EYDPTIELF	0.8943	0.9067	6	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C14:02	EYDPTIELF	0.847	0.9222	6	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C14:03	EYDPTIELF	0.847	0.9222	6	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B18:07	EYDPTIELF	0.8394	0.8574	6	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B39:11	DEYDPTIEL	0.8275	0.5062	5	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B18:03	EYDPTIELF	0.8123	0.8838	6	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B18:08	EYDPTIELF	0.8078	0.8127	6	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C03:67	EYDPTIELF	0.7661	0.9757	6	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B39:31	DEYDPTIEL	0.7302	0.8438	5	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B39:02	DEYDPTIEL	0.724	0.8426	5	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C07:22	EYDPTIELF	0.722	0.5747	6	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B38:05	DEYDPTIEL	0.6841	0.8547	5	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B35:09	DEYDPTIEL	0.6715	0.8601	5	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B15:13	EYDPTIELF	0.6699	0.5272	6	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C06:06	EYDPTIELF	0.6563	0.9787	6	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B35:20	DEYDPTIEL	0.584	0.8645	5	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B50:04	DEYDPTIEL	0.5692	0.5591	5	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B50:05	DEYDPTIEL	0.5692	0.5591	5	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C04:04	EYDPTIELF	0.5467	0.7491	6	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C07:04	EYDPTIELF	0.4963	0.8208	6	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B38:05	EYDPTIELF	0.4595	0.8047	6	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B15:09	DEYDPTIEL	0.3717	0.5326	5	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C04:01	DEYDPTIELF	0.9991	0.6021	5	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B18:04	DEYDPTIELF	0.9989	0.9171	5	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B44:26	DEYDPTIELF	0.9986	0.8981	5	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B44:07	DEYDPTIELF	0.9986	0.8981	5	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B44:13	DEYDPTIELF	0.9986	0.8981	5	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B18:07	DEYDPTIELF	0.9982	0.8836	5	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C18:01	DEYDPTIELF	0.9982	0.6104	5	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B18:08	DEYDPTIELF	0.9981	0.8234	5	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B18:06	DEYDPTIELF	0.9981	0.9069	5	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B18:05	DEYDPTIELF	0.9975	0.9079	5	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B18:03	DEYDPTIELF	0.9966	0.9012	5	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B18:11	DEYDPTIELF	0.988	0.8613	5	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B40:04	DEYDPTIELF	0.9741	0.5915	5	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B40:04	VDEYDPTIEL	0.938	0.6039	4	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B35:20	DEYDPTIELF	0.9212	0.8936	5	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B15:53	VDEYDPTIEL	0.9011	0.8772	4	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B50:05	VDEYDPTIEL	0.7567	0.6798	4	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B50:04	VDEYDPTIEL	0.7567	0.6798	4	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B39:02	VDEYDPTIEL	0.7072	0.9079	4	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B18:11	VDEYDPTIEL	0.5395	0.917	4	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B18:05	VDEYDPTIEL	0.3914	0.9306	4	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B18:03	VDEYDPTIEL	0.3459	0.9225	4	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C04:01	FVDEYDPTIEL	1	0.6692	3	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C04:01	VDEYDPTIELF	1	0.6187	4	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C18:01	FVDEYDPTIEL	1	0.6841	3	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C18:01	VDEYDPTIELF	1	0.6297	4	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C01:03	FVDEYDPTIEL	1	0.8973	3	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C04:03	FVDEYDPTIEL	1	0.7158	3	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C01:02	FVDEYDPTIEL	1	0.9176	3	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C05:01	FVDEYDPTIEL	1	0.9268	3	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C08:02	FVDEYDPTIEL	1	0.9376	3	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C03:04	FVDEYDPTIEL	0.9999	0.9915	3	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C03:03	FVDEYDPTIEL	0.9999	0.9915	3	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C15:05	FVDEYDPTIEL	0.9999	0.9392	3	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C15:02	FVDEYDPTIEL	0.9999	0.9168	3	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C04:04	FVDEYDPTIEL	0.9999	0.8432	3	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C03:67	FVDEYDPTIEL	0.9999	0.9846	3	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C03:05	FVDEYDPTIEL	0.9999	0.9372	3	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C03:02	FVDEYDPTIEL	0.9999	0.9811	3	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C03:06	FVDEYDPTIEL	0.9998	0.9911	3	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C02:02	FVDEYDPTIEL	0.9997	0.9836	3	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C02:10	FVDEYDPTIEL	0.9997	0.9836	3	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C03:17	FVDEYDPTIEL	0.9997	0.9787	3	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C08:01	FVDEYDPTIEL	0.9993	0.9622	3	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C17:01	FVDEYDPTIEL	0.9983	0.912	3	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C07:04	FVDEYDPTIEL	0.9957	0.9002	3	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C04:04	VDEYDPTIELF	0.9954	0.7671	4	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-C07:02	VDEYDPTIELF	0.9947	0.9628	4	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B18:05	DEYDPTIELFT	0.9923	0.8964	5	16
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B18:03	DEYDPTIELFT	0.9862	0.888	5	16
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-A69:01	FVDEYDPTIEL	0.9843	0.5864	3	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B07:13	FVDEYDPTIEL	0.9838	0.8237	3	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B18:05	VDEYDPTIELF	0.9837	0.9334	4	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B18:08	VDEYDPTIELF	0.9834	0.7703	4	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B18:03	VDEYDPTIELF	0.9779	0.9257	4	15
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B39:31	FVDEYDPTIEL	0.9741	0.8765	3	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B39:02	FVDEYDPTIEL	0.9721	0.8746	3	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B40:04	FVDEYDPTIEL	0.9684	0.7101	3	14
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	HLA-B18:03	FVDEYDPTIEL	0.8242	0.917	3	14

Top

Potential FusionNeoAntigen Information of KRAS-ETNK1 in HLA II

KRAS-ETNK1_25398207_22796696.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
KRAS-ETNK1	chr12	25398207	chr12	22796696	175	DRB1-1504	YDPTIELFTDGITNK	7	22

Top

Fusion breakpoint peptide structures of KRAS-ETNK1

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
2256	EYDPTIELFTDGIT	KRAS	ETNK1	chr12	25398207	chr12	22796696	175

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of KRAS-ETNK1

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	2256	EYDPTIELFTDGIT	-7.9962	-8.1096
HLA-B14:02	3BVN	2256	EYDPTIELFTDGIT	-5.70842	-6.74372
HLA-B52:01	3W39	2256	EYDPTIELFTDGIT	-6.83737	-6.95077
HLA-B52:01	3W39	2256	EYDPTIELFTDGIT	-4.4836	-5.5189
HLA-A11:01	4UQ2	2256	EYDPTIELFTDGIT	-10.0067	-10.1201
HLA-A11:01	4UQ2	2256	EYDPTIELFTDGIT	-9.03915	-10.0745
HLA-A24:02	5HGA	2256	EYDPTIELFTDGIT	-6.56204	-6.67544
HLA-A24:02	5HGA	2256	EYDPTIELFTDGIT	-5.42271	-6.45801
HLA-B44:05	3DX8	2256	EYDPTIELFTDGIT	-7.85648	-8.89178
HLA-B44:05	3DX8	2256	EYDPTIELFTDGIT	-5.3978	-5.5112
HLA-A02:01	6TDR	2256	EYDPTIELFTDGIT	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of KRAS-ETNK1

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
KRAS-ETNK1	chr12	25398207	chr12	22796696	3	14	FVDEYDPTIEL	TTTGTGGACGAATATGATCCAACAATAGAGCTC
KRAS-ETNK1	chr12	25398207	chr12	22796696	4	14	VDEYDPTIEL	GTGGACGAATATGATCCAACAATAGAGCTC
KRAS-ETNK1	chr12	25398207	chr12	22796696	4	15	VDEYDPTIELF	GTGGACGAATATGATCCAACAATAGAGCTCTTC
KRAS-ETNK1	chr12	25398207	chr12	22796696	5	14	DEYDPTIEL	GACGAATATGATCCAACAATAGAGCTC
KRAS-ETNK1	chr12	25398207	chr12	22796696	5	15	DEYDPTIELF	GACGAATATGATCCAACAATAGAGCTCTTC
KRAS-ETNK1	chr12	25398207	chr12	22796696	5	16	DEYDPTIELFT	GACGAATATGATCCAACAATAGAGCTCTTCACA
KRAS-ETNK1	chr12	25398207	chr12	22796696	6	14	EYDPTIEL	GAATATGATCCAACAATAGAGCTC
KRAS-ETNK1	chr12	25398207	chr12	22796696	6	15	EYDPTIELF	GAATATGATCCAACAATAGAGCTCTTC
KRAS-ETNK1	chr12	25398207	chr12	22796696	7	15	YDPTIELF	TATGATCCAACAATAGAGCTCTTC

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
KRAS-ETNK1	chr12	25398207	chr12	22796696	7	22	YDPTIELFTDGITNK	TATGATCCAACAATAGAGCTCTTCACAGATGGAATCACAAATAAA

Top

Information of the samples that have these potential fusion neoantigens of KRAS-ETNK1

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
ESCA	KRAS-ETNK1	chr12	25398207	ENST00000256078	chr12	22796696	ENST00000266517	TCGA-L5-A4ON

Top

Potential target of CAR-T therapy development for KRAS-ETNK1

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to KRAS-ETNK1

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to KRAS-ETNK1

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)