![]() |
|||||||
|
Fusion Protein:LIMD1-LARS2 |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: LIMD1-LARS2 | FusionPDB ID: 44708 | FusionGDB2.0 ID: 44708 | Hgene | Tgene | Gene symbol | LIMD1 | LARS2 | Gene ID | 8994 | 23395 |
Gene name | LIM domains containing 1 | leucyl-tRNA synthetase 2, mitochondrial | |
Synonyms | - | HLASA|LEURS|PRLTS4|mtLeuRS | |
Cytomap | 3p21.31 | 3p21.31 | |
Type of gene | protein-coding | protein-coding | |
Description | LIM domain-containing protein 1 | probable leucine--tRNA ligase, mitochondrialleucine tRNA ligase 2, mitochondrialleucine tRNA ligase 2, mitocondrialleucine translaseprobable leucyl-tRNA synthetase, mitochondrial | |
Modification date | 20200313 | 20200313 | |
UniProtAcc | Q9UGP4 Main function of 5'-partner protein: FUNCTION: Adapter or scaffold protein which participates in the assembly of numerous protein complexes and is involved in several cellular processes such as cell fate determination, cytoskeletal organization, repression of gene transcription, cell-cell adhesion, cell differentiation, proliferation and migration. Positively regulates microRNA (miRNA)-mediated gene silencing and is essential for P-body formation and integrity. Acts as a hypoxic regulator by bridging an association between the prolyl hydroxylases and VHL enabling efficient degradation of HIF1A. Acts as a transcriptional corepressor for SNAI1- and SNAI2/SLUG-dependent repression of E-cadherin transcription. Negatively regulates the Hippo signaling pathway and antagonizes phosphorylation of YAP1. Inhibits E2F-mediated transcription, and suppresses the expression of the majority of genes with E2F1-responsive elements. Regulates osteoblast development, function, differentiation and stress osteoclastogenesis. Enhances the ability of TRAF6 to activate adapter protein complex 1 (AP-1) and negatively regulates the canonical Wnt receptor signaling pathway in osteoblasts. May act as a tumor suppressor by inhibiting cell proliferation. {ECO:0000269|PubMed:15542589, ECO:0000269|PubMed:20303269, ECO:0000269|PubMed:20616046, ECO:0000269|PubMed:21834987, ECO:0000269|PubMed:22286099}. | Q15031 Main function of 5'-partner protein: | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000465039, ENST00000273317, ENST00000440097, | ENST00000265537, ENST00000414984, ENST00000415258, ENST00000467936, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 3 X 4 X 4=48 | 5 X 7 X 6=210 |
# samples | 5 | 7 | |
** MAII score | log2(5/48*10)=0.0588936890535686 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0 | log2(7/210*10)=-1.58496250072116 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
Fusion gene context | PubMed: LIMD1 [Title/Abstract] AND LARS2 [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: LIMD1 [Title/Abstract] AND LARS2 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | LARS2(45565600)-LIMD1(45677642), # samples:2 LIMD1(45707209)-LARS2(45565489), # samples:2 | ||
Anticipated loss of major functional domain due to fusion event. | LIMD1-LARS2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. LIMD1-LARS2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. LIMD1-LARS2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. LIMD1-LARS2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. LIMD1-LARS2 seems lost the major protein functional domain in Hgene partner, which is a tumor suppressor due to the frame-shifted ORF. LIMD1-LARS2 seems lost the major protein functional domain in Tgene partner, which is a essential gene due to the frame-shifted ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
Hgene | LIMD1 | GO:0001666 | response to hypoxia | 22286099 |
Hgene | LIMD1 | GO:0016310 | phosphorylation | 18439753 |
Hgene | LIMD1 | GO:0035331 | negative regulation of hippo signaling | 20303269 |
Hgene | LIMD1 | GO:0045892 | negative regulation of transcription, DNA-templated | 15542589 |
Tgene | LARS2 | GO:0006429 | leucyl-tRNA aminoacylation | 10684970 |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr3:45565600/chr3:45677642) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000440097 | LIMD1 | chr3 | 45707209 | + | ENST00000265537 | LARS2 | chr3 | 45565489 | + | 3861 | 2134 | 556 | 2553 | 665 |
ENST00000440097 | LIMD1 | chr3 | 45707209 | + | ENST00000415258 | LARS2 | chr3 | 45565489 | + | 4445 | 2134 | 556 | 2553 | 665 |
ENST00000440097 | LIMD1 | chr3 | 45707209 | + | ENST00000414984 | LARS2 | chr3 | 45565489 | + | 2633 | 2134 | 556 | 2553 | 665 |
ENST00000273317 | LIMD1 | chr3 | 45707209 | + | ENST00000265537 | LARS2 | chr3 | 45565489 | + | 3326 | 1599 | 21 | 2018 | 665 |
ENST00000273317 | LIMD1 | chr3 | 45707209 | + | ENST00000415258 | LARS2 | chr3 | 45565489 | + | 3910 | 1599 | 21 | 2018 | 665 |
ENST00000273317 | LIMD1 | chr3 | 45707209 | + | ENST00000414984 | LARS2 | chr3 | 45565489 | + | 2098 | 1599 | 21 | 2018 | 665 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000440097 | ENST00000265537 | LIMD1 | chr3 | 45707209 | + | LARS2 | chr3 | 45565489 | + | 0.016651342 | 0.98334867 |
ENST00000440097 | ENST00000415258 | LIMD1 | chr3 | 45707209 | + | LARS2 | chr3 | 45565489 | + | 0.013260135 | 0.9867399 |
ENST00000440097 | ENST00000414984 | LIMD1 | chr3 | 45707209 | + | LARS2 | chr3 | 45565489 | + | 0.016491702 | 0.98350835 |
ENST00000273317 | ENST00000265537 | LIMD1 | chr3 | 45707209 | + | LARS2 | chr3 | 45565489 | + | 0.021313116 | 0.97868687 |
ENST00000273317 | ENST00000415258 | LIMD1 | chr3 | 45707209 | + | LARS2 | chr3 | 45565489 | + | 0.015787838 | 0.9842122 |
ENST00000273317 | ENST00000414984 | LIMD1 | chr3 | 45707209 | + | LARS2 | chr3 | 45565489 | + | 0.02617225 | 0.9738278 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for LIMD1-LARS2 |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
LIMD1 | chr3 | 45707209 | LARS2 | chr3 | 45565489 | 1599 | 526 | FVNGKVFCEEDFLQASQSVILHSPEF |
LIMD1 | chr3 | 45707209 | LARS2 | chr3 | 45565489 | 2134 | 526 | FVNGKVFCEEDFLQASQSVILHSPEF |
Top |
Potential FusionNeoAntigen Information of LIMD1-LARS2 in HLA I |
![]() |
LIMD1-LARS2_45707209_45565489.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | HLA-B52:01 | LQASQSVI | 0.937 | 0.9806 | 12 | 20 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | HLA-B15:01 | LQASQSVIL | 0.9895 | 0.8403 | 12 | 21 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | HLA-B48:01 | LQASQSVIL | 0.9767 | 0.64 | 12 | 21 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | HLA-A02:27 | FLQASQSVI | 0.9667 | 0.6122 | 11 | 20 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | HLA-A02:13 | FLQASQSVI | 0.9591 | 0.6937 | 11 | 20 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | HLA-A02:38 | FLQASQSVI | 0.8638 | 0.7109 | 11 | 20 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | HLA-B39:01 | LQASQSVIL | 0.8362 | 0.9212 | 12 | 21 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | HLA-B39:13 | LQASQSVIL | 0.7516 | 0.94 | 12 | 21 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | HLA-B15:03 | LQASQSVIL | 0.7357 | 0.7274 | 12 | 21 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | HLA-B13:02 | LQASQSVIL | 0.6221 | 0.7302 | 12 | 21 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | HLA-B13:01 | LQASQSVIL | 0.5756 | 0.9763 | 12 | 21 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | HLA-B52:01 | LQASQSVIL | 0.0946 | 0.9756 | 12 | 21 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | HLA-A02:21 | KVFCEEDFLQA | 0.9852 | 0.8992 | 4 | 15 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | HLA-B15:04 | LQASQSVIL | 0.9313 | 0.8902 | 12 | 21 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | HLA-B39:09 | LQASQSVIL | 0.8348 | 0.632 | 12 | 21 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | HLA-B39:08 | LQASQSVIL | 0.7947 | 0.8765 | 12 | 21 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | HLA-B39:05 | LQASQSVIL | 0.691 | 0.9102 | 12 | 21 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | HLA-B15:05 | LQASQSVIL | 0.3001 | 0.8666 | 12 | 21 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | HLA-B15:125 | LQASQSVIL | 0.9895 | 0.8403 | 12 | 21 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | HLA-B15:34 | LQASQSVIL | 0.9895 | 0.8403 | 12 | 21 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | HLA-B15:33 | LQASQSVIL | 0.9895 | 0.8403 | 12 | 21 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | HLA-B15:27 | LQASQSVIL | 0.9893 | 0.8607 | 12 | 21 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | HLA-B15:50 | LQASQSVIL | 0.9833 | 0.8787 | 12 | 21 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | HLA-B15:73 | LQASQSVIL | 0.9723 | 0.8869 | 12 | 21 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | HLA-B15:30 | LQASQSVIL | 0.9319 | 0.8347 | 12 | 21 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | HLA-B15:53 | LQASQSVIL | 0.9257 | 0.8143 | 12 | 21 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | HLA-B15:54 | LQASQSVIL | 0.8938 | 0.7849 | 12 | 21 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | HLA-B39:02 | LQASQSVIL | 0.8819 | 0.9381 | 12 | 21 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | HLA-B39:31 | LQASQSVIL | 0.856 | 0.9215 | 12 | 21 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | HLA-B15:12 | LQASQSVIL | 0.8131 | 0.8968 | 12 | 21 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | HLA-B39:11 | LQASQSVIL | 0.6886 | 0.8471 | 12 | 21 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | HLA-B40:21 | LQASQSVIL | 0.6407 | 0.5176 | 12 | 21 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | HLA-B48:02 | LQASQSVIL | 0.5598 | 0.9061 | 12 | 21 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | HLA-B35:13 | LQASQSVIL | 0.5028 | 0.8905 | 12 | 21 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | HLA-B15:09 | LQASQSVIL | 0.4914 | 0.7478 | 12 | 21 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | HLA-B15:20 | LQASQSVIL | 0.2913 | 0.9151 | 12 | 21 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | HLA-B35:28 | LQASQSVIL | 0.2772 | 0.9228 | 12 | 21 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | HLA-B15:73 | FLQASQSVIL | 0.9723 | 0.9501 | 11 | 21 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | HLA-B15:30 | FLQASQSVIL | 0.9361 | 0.9489 | 11 | 21 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | HLA-B40:21 | FLQASQSVIL | 0.3325 | 0.6023 | 11 | 21 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | HLA-A02:06 | KVFCEEDFLQA | 0.9852 | 0.8992 | 4 | 15 |
Top |
Potential FusionNeoAntigen Information of LIMD1-LARS2 in HLA II |
![]() |
LIMD1-LARS2_45707209_45565489.msa |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | DRB1-0701 | EDFLQASQSVILHSP | 9 | 24 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | DRB1-0701 | EEDFLQASQSVILHS | 8 | 23 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | DRB1-0703 | EDFLQASQSVILHSP | 9 | 24 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | DRB1-0703 | EEDFLQASQSVILHS | 8 | 23 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | DRB1-0704 | EDFLQASQSVILHSP | 9 | 24 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | DRB1-0704 | EEDFLQASQSVILHS | 8 | 23 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | DRB1-0705 | EDFLQASQSVILHSP | 9 | 24 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | DRB1-0705 | EEDFLQASQSVILHS | 8 | 23 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | DRB1-0706 | EDFLQASQSVILHSP | 9 | 24 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | DRB1-0706 | EEDFLQASQSVILHS | 8 | 23 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | DRB1-0707 | EDFLQASQSVILHSP | 9 | 24 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | DRB1-0707 | EEDFLQASQSVILHS | 8 | 23 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | DRB1-0708 | EDFLQASQSVILHSP | 9 | 24 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | DRB1-0708 | EEDFLQASQSVILHS | 8 | 23 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | DRB1-0709 | EDFLQASQSVILHSP | 9 | 24 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | DRB1-0709 | EEDFLQASQSVILHS | 8 | 23 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | DRB1-0711 | EDFLQASQSVILHSP | 9 | 24 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | DRB1-0711 | EEDFLQASQSVILHS | 8 | 23 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | DRB1-0712 | EDFLQASQSVILHSP | 9 | 24 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | DRB1-0712 | EEDFLQASQSVILHS | 8 | 23 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | DRB1-0713 | EDFLQASQSVILHSP | 9 | 24 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | DRB1-0713 | EEDFLQASQSVILHS | 8 | 23 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | DRB1-0714 | EDFLQASQSVILHSP | 9 | 24 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | DRB1-0714 | EEDFLQASQSVILHS | 8 | 23 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | DRB1-0715 | EDFLQASQSVILHSP | 9 | 24 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | DRB1-0715 | EEDFLQASQSVILHS | 8 | 23 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | DRB1-0716 | EDFLQASQSVILHSP | 9 | 24 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | DRB1-0716 | EEDFLQASQSVILHS | 8 | 23 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | DRB1-0717 | EDFLQASQSVILHSP | 9 | 24 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | DRB1-0717 | EEDFLQASQSVILHS | 8 | 23 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | DRB1-0719 | EDFLQASQSVILHSP | 9 | 24 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | DRB1-0719 | EEDFLQASQSVILHS | 8 | 23 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | DRB1-0901 | EEDFLQASQSVILHS | 8 | 23 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | DRB1-0901 | CEEDFLQASQSVILH | 7 | 22 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | DRB1-0901 | EDFLQASQSVILHSP | 9 | 24 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | DRB1-0901 | FCEEDFLQASQSVIL | 6 | 21 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | DRB1-0903 | EEDFLQASQSVILHS | 8 | 23 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | DRB1-0904 | EEDFLQASQSVILHS | 8 | 23 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | DRB1-0904 | CEEDFLQASQSVILH | 7 | 22 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | DRB1-0904 | EDFLQASQSVILHSP | 9 | 24 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | DRB1-0904 | FCEEDFLQASQSVIL | 6 | 21 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | DRB1-0905 | EEDFLQASQSVILHS | 8 | 23 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | DRB1-0905 | CEEDFLQASQSVILH | 7 | 22 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | DRB1-0905 | EDFLQASQSVILHSP | 9 | 24 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | DRB1-0905 | FCEEDFLQASQSVIL | 6 | 21 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | DRB1-0906 | EDFLQASQSVILHSP | 9 | 24 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | DRB1-0906 | EEDFLQASQSVILHS | 8 | 23 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | DRB1-0907 | EEDFLQASQSVILHS | 8 | 23 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | DRB1-0907 | CEEDFLQASQSVILH | 7 | 22 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | DRB1-0907 | EDFLQASQSVILHSP | 9 | 24 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | DRB1-0907 | FCEEDFLQASQSVIL | 6 | 21 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | DRB1-0908 | EEDFLQASQSVILHS | 8 | 23 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | DRB1-0909 | EEDFLQASQSVILHS | 8 | 23 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | DRB1-0909 | CEEDFLQASQSVILH | 7 | 22 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | DRB1-0909 | EDFLQASQSVILHSP | 9 | 24 |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 | DRB1-0909 | FCEEDFLQASQSVIL | 6 | 21 |
Top |
Fusion breakpoint peptide structures of LIMD1-LARS2 |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
2305 | FCEEDFLQASQSVI | LIMD1 | LARS2 | chr3 | 45707209 | chr3 | 45565489 | 1599 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of LIMD1-LARS2 |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 2305 | FCEEDFLQASQSVI | -5.42908 | -5.54248 |
HLA-B14:02 | 3BVN | 2305 | FCEEDFLQASQSVI | -5.06008 | -6.09538 |
HLA-B52:01 | 3W39 | 2305 | FCEEDFLQASQSVI | -9.1987 | -9.3121 |
HLA-B52:01 | 3W39 | 2305 | FCEEDFLQASQSVI | -7.53083 | -8.56613 |
HLA-A11:01 | 4UQ2 | 2305 | FCEEDFLQASQSVI | -8.87547 | -8.98887 |
HLA-A24:02 | 5HGA | 2305 | FCEEDFLQASQSVI | -7.78065 | -7.89405 |
HLA-A24:02 | 5HGA | 2305 | FCEEDFLQASQSVI | -7.11918 | -8.15448 |
HLA-B27:05 | 6PYJ | 2305 | FCEEDFLQASQSVI | -7.64943 | -7.76283 |
HLA-B27:05 | 6PYJ | 2305 | FCEEDFLQASQSVI | -6.50173 | -7.53703 |
HLA-B44:05 | 3DX8 | 2305 | FCEEDFLQASQSVI | -7.26947 | -7.38287 |
HLA-B44:05 | 3DX8 | 2305 | FCEEDFLQASQSVI | -6.09544 | -7.13074 |
Top |
Vaccine Design for the FusionNeoAntigens of LIMD1-LARS2 |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 11 | 20 | FLQASQSVI | TTCCTGCAAGCCTCTCAGAGCGTCATT |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 11 | 21 | FLQASQSVIL | TTCCTGCAAGCCTCTCAGAGCGTCATTCTC |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 12 | 20 | LQASQSVI | CTGCAAGCCTCTCAGAGCGTCATT |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 12 | 21 | LQASQSVIL | CTGCAAGCCTCTCAGAGCGTCATTCTC |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 4 | 15 | KVFCEEDFLQA | AAAGTGTTTTGTGAAGAAGACTTCCTGCAAGCC |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 6 | 21 | FCEEDFLQASQSVIL | TTTTGTGAAGAAGACTTCCTGCAAGCCTCTCAGAGCGTCATTCTC |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 7 | 22 | CEEDFLQASQSVILH | TGTGAAGAAGACTTCCTGCAAGCCTCTCAGAGCGTCATTCTCCAC |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 8 | 23 | EEDFLQASQSVILHS | GAAGAAGACTTCCTGCAAGCCTCTCAGAGCGTCATTCTCCACAGC |
LIMD1-LARS2 | chr3 | 45707209 | chr3 | 45565489 | 9 | 24 | EDFLQASQSVILHSP | GAAGACTTCCTGCAAGCCTCTCAGAGCGTCATTCTCCACAGCCCC |
Top |
Information of the samples that have these potential fusion neoantigens of LIMD1-LARS2 |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
LUAD | LIMD1-LARS2 | chr3 | 45707209 | ENST00000273317 | chr3 | 45565489 | ENST00000265537 | TCGA-78-7147-01A |
Top |
Potential target of CAR-T therapy development for LIMD1-LARS2 |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to LIMD1-LARS2 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to LIMD1-LARS2 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |