![]() |
|||||||
|
Fusion Protein:MIDN-ABCA7 |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: MIDN-ABCA7 | FusionPDB ID: 53600 | FusionGDB2.0 ID: 53600 | Hgene | Tgene | Gene symbol | MIDN | ABCA7 | Gene ID | 90007 | 10347 |
Gene name | midnolin | ATP binding cassette subfamily A member 7 | |
Synonyms | - | ABCA-SSN|ABCX|AD9 | |
Cytomap | 19p13.3 | 19p13.3 | |
Type of gene | protein-coding | protein-coding | |
Description | midnolinmidbrain nucleolar protein | phospholipid-transporting ATPase ABCA7ATP-binding cassette sub-family A member 7ATP-binding cassette, sub-family A (ABC1), member 7autoantigen SS-Nmacrophage ABC transporter | |
Modification date | 20200313 | 20200320 | |
UniProtAcc | Q504T8 Main function of 5'-partner protein: FUNCTION: Facilitates ubiquitin-independent proteasomal degradation of polycomb protein CBX4. Plays a role in inhibiting the activity of glucokinase GCK and both glucose-induced and basal insulin secretion. {ECO:0000250|UniProtKB:D4AE48, ECO:0000250|UniProtKB:Q3TPJ7}. | Q8IZY2 Main function of 5'-partner protein: FUNCTION: Catalyzes the translocation of specific phospholipids from the cytoplasmic to the extracellular/lumenal leaflet of membrane coupled to the hydrolysis of ATP (PubMed:24097981). Transports preferentially phosphatidylserine over phosphatidylcholine (PubMed:24097981). Plays a role in lipid homeostasis and macrophage-mediated phagocytosis (PubMed:14592415, PubMed:12917409, PubMed:12925201, PubMed:14570867). Binds APOA1 and may function in apolipoprotein-mediated phospholipid efflux from cells (PubMed:12917409, PubMed:14570867, PubMed:14592415). May also mediate cholesterol efflux (PubMed:14570867). May regulate cellular ceramide homeostasis during keratinocyte differentiation (PubMed:12925201). Involved in lipid raft organization and CD1D localization on thymocytes and antigen-presenting cells, which plays an important role in natural killer T-cell development and activation (By similarity). Plays a role in phagocytosis of apoptotic cells by macrophages (By similarity). Macrophage phagocytosis is stimulated by APOA1 or APOA2, probably by stabilization of ABCA7 (By similarity). Also involved in phagocytic clearance of amyloid-beta by microglia cells and macrophages (By similarity). Further limits amyloid-beta production by playing a role in the regulation of amyloid-beta A4 precursor protein (APP) endocytosis and/or processing (PubMed:26260791). Amyloid-beta is the main component of amyloid plaques found in the brains of Alzheimer patients (PubMed:26260791). {ECO:0000250|UniProtKB:Q91V24, ECO:0000269|PubMed:12917409, ECO:0000269|PubMed:12925201, ECO:0000269|PubMed:14570867, ECO:0000269|PubMed:14592415, ECO:0000269|PubMed:24097981, ECO:0000269|PubMed:26260791}. | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000300952, ENST00000591446, | ENST00000533574, ENST00000263094, ENST00000433129, ENST00000435683, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 9 X 7 X 6=378 | 5 X 4 X 4=80 |
# samples | 13 | 5 | |
** MAII score | log2(13/378*10)=-1.53987461119262 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(5/80*10)=-0.678071905112638 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
Fusion gene context | PubMed: MIDN [Title/Abstract] AND ABCA7 [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: MIDN [Title/Abstract] AND ABCA7 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | MIDN(1251900)-ABCA7(1061781), # samples:2 | ||
Anticipated loss of major functional domain due to fusion event. | MIDN-ABCA7 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. MIDN-ABCA7 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. MIDN-ABCA7 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. MIDN-ABCA7 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
Tgene | ABCA7 | GO:0033344 | cholesterol efflux | 14570867 |
Tgene | ABCA7 | GO:0033700 | phospholipid efflux | 14570867 |
Tgene | ABCA7 | GO:0034380 | high-density lipoprotein particle assembly | 14570867 |
Tgene | ABCA7 | GO:0038027 | apolipoprotein A-I-mediated signaling pathway | 14570867 |
Tgene | ABCA7 | GO:0045332 | phospholipid translocation | 24097981 |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr19:1251900/chr19:1061781) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000300952 | MIDN | chr19 | 1251900 | + | ENST00000263094 | ABCA7 | chr19 | 1061781 | + | 2021 | 899 | 341 | 1876 | 511 |
ENST00000300952 | MIDN | chr19 | 1251900 | + | ENST00000433129 | ABCA7 | chr19 | 1061781 | + | 2021 | 899 | 341 | 1876 | 511 |
ENST00000300952 | MIDN | chr19 | 1251900 | + | ENST00000435683 | ABCA7 | chr19 | 1061781 | + | 1877 | 899 | 341 | 1876 | 512 |
ENST00000591446 | MIDN | chr19 | 1251900 | + | ENST00000263094 | ABCA7 | chr19 | 1061781 | + | 1915 | 793 | 235 | 1770 | 511 |
ENST00000591446 | MIDN | chr19 | 1251900 | + | ENST00000433129 | ABCA7 | chr19 | 1061781 | + | 1915 | 793 | 235 | 1770 | 511 |
ENST00000591446 | MIDN | chr19 | 1251900 | + | ENST00000435683 | ABCA7 | chr19 | 1061781 | + | 1771 | 793 | 235 | 1770 | 512 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000300952 | ENST00000263094 | MIDN | chr19 | 1251900 | + | ABCA7 | chr19 | 1061781 | + | 0.069852434 | 0.9301475 |
ENST00000300952 | ENST00000433129 | MIDN | chr19 | 1251900 | + | ABCA7 | chr19 | 1061781 | + | 0.069852434 | 0.9301475 |
ENST00000300952 | ENST00000435683 | MIDN | chr19 | 1251900 | + | ABCA7 | chr19 | 1061781 | + | 0.060296644 | 0.9397034 |
ENST00000591446 | ENST00000263094 | MIDN | chr19 | 1251900 | + | ABCA7 | chr19 | 1061781 | + | 0.07410727 | 0.92589265 |
ENST00000591446 | ENST00000433129 | MIDN | chr19 | 1251900 | + | ABCA7 | chr19 | 1061781 | + | 0.07410727 | 0.92589265 |
ENST00000591446 | ENST00000435683 | MIDN | chr19 | 1251900 | + | ABCA7 | chr19 | 1061781 | + | 0.06453184 | 0.9354682 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for MIDN-ABCA7 |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
MIDN | chr19 | 1251900 | ABCA7 | chr19 | 1061781 | 793 | 24 | FLEEDARCSAPPSARRTRHPGSLSPL |
MIDN | chr19 | 1251900 | ABCA7 | chr19 | 1061781 | 899 | 24 | FLEEDARCSAPPSARRTRHPGSLSPL |
Top |
Potential FusionNeoAntigen Information of MIDN-ABCA7 in HLA I |
![]() |
MIDN-ABCA7_1251900_1061781.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
MIDN-ABCA7 | chr19 | 1251900 | chr19 | 1061781 | 899 | HLA-A68:24 | CSAPPSARR | 0.9975 | 0.566 | 7 | 16 |
MIDN-ABCA7 | chr19 | 1251900 | chr19 | 1061781 | 899 | HLA-A68:03 | CSAPPSARR | 0.9957 | 0.5462 | 7 | 16 |
MIDN-ABCA7 | chr19 | 1251900 | chr19 | 1061781 | 899 | HLA-A11:10 | CSAPPSARR | 0.9929 | 0.5197 | 7 | 16 |
MIDN-ABCA7 | chr19 | 1251900 | chr19 | 1061781 | 899 | HLA-A66:01 | CSAPPSARR | 0.9916 | 0.62 | 7 | 16 |
MIDN-ABCA7 | chr19 | 1251900 | chr19 | 1061781 | 899 | HLA-A68:08 | CSAPPSARR | 0.9885 | 0.5732 | 7 | 16 |
MIDN-ABCA7 | chr19 | 1251900 | chr19 | 1061781 | 899 | HLA-A68:06 | CSAPPSARR | 0.9847 | 0.5857 | 7 | 16 |
MIDN-ABCA7 | chr19 | 1251900 | chr19 | 1061781 | 899 | HLA-B39:06 | ARCSAPPSA | 0.984 | 0.8515 | 5 | 14 |
MIDN-ABCA7 | chr19 | 1251900 | chr19 | 1061781 | 899 | HLA-A74:03 | CSAPPSARR | 0.9779 | 0.8836 | 7 | 16 |
MIDN-ABCA7 | chr19 | 1251900 | chr19 | 1061781 | 899 | HLA-A74:11 | CSAPPSARR | 0.9779 | 0.8836 | 7 | 16 |
MIDN-ABCA7 | chr19 | 1251900 | chr19 | 1061781 | 899 | HLA-A74:09 | CSAPPSARR | 0.9779 | 0.8836 | 7 | 16 |
MIDN-ABCA7 | chr19 | 1251900 | chr19 | 1061781 | 899 | HLA-A31:06 | CSAPPSARR | 0.9775 | 0.7186 | 7 | 16 |
MIDN-ABCA7 | chr19 | 1251900 | chr19 | 1061781 | 899 | HLA-A68:05 | CSAPPSARR | 0.9768 | 0.5732 | 7 | 16 |
MIDN-ABCA7 | chr19 | 1251900 | chr19 | 1061781 | 899 | HLA-A34:05 | CSAPPSARR | 0.9728 | 0.6176 | 7 | 16 |
MIDN-ABCA7 | chr19 | 1251900 | chr19 | 1061781 | 899 | HLA-A34:01 | CSAPPSARR | 0.9728 | 0.6176 | 7 | 16 |
MIDN-ABCA7 | chr19 | 1251900 | chr19 | 1061781 | 899 | HLA-A31:02 | CSAPPSARR | 0.9683 | 0.8999 | 7 | 16 |
MIDN-ABCA7 | chr19 | 1251900 | chr19 | 1061781 | 899 | HLA-A34:02 | CSAPPSARR | 0.9464 | 0.5817 | 7 | 16 |
MIDN-ABCA7 | chr19 | 1251900 | chr19 | 1061781 | 899 | HLA-A66:03 | CSAPPSARR | 0.94 | 0.7036 | 7 | 16 |
MIDN-ABCA7 | chr19 | 1251900 | chr19 | 1061781 | 899 | HLA-A26:03 | CSAPPSARR | 0.8228 | 0.6665 | 7 | 16 |
MIDN-ABCA7 | chr19 | 1251900 | chr19 | 1061781 | 899 | HLA-A31:06 | RCSAPPSAR | 0.5047 | 0.5848 | 6 | 15 |
MIDN-ABCA7 | chr19 | 1251900 | chr19 | 1061781 | 899 | HLA-A74:03 | RCSAPPSARR | 0.9439 | 0.8474 | 6 | 16 |
MIDN-ABCA7 | chr19 | 1251900 | chr19 | 1061781 | 899 | HLA-A74:11 | RCSAPPSARR | 0.9439 | 0.8474 | 6 | 16 |
MIDN-ABCA7 | chr19 | 1251900 | chr19 | 1061781 | 899 | HLA-A74:09 | RCSAPPSARR | 0.9439 | 0.8474 | 6 | 16 |
MIDN-ABCA7 | chr19 | 1251900 | chr19 | 1061781 | 899 | HLA-A31:02 | RCSAPPSARR | 0.9316 | 0.8731 | 6 | 16 |
MIDN-ABCA7 | chr19 | 1251900 | chr19 | 1061781 | 899 | HLA-A31:06 | RCSAPPSARR | 0.5668 | 0.7058 | 6 | 16 |
MIDN-ABCA7 | chr19 | 1251900 | chr19 | 1061781 | 899 | HLA-A03:12 | RCSAPPSARR | 0.4111 | 0.5957 | 6 | 16 |
MIDN-ABCA7 | chr19 | 1251900 | chr19 | 1061781 | 899 | HLA-A03:25 | RCSAPPSARR | 0.3839 | 0.5699 | 6 | 16 |
MIDN-ABCA7 | chr19 | 1251900 | chr19 | 1061781 | 899 | HLA-A11:04 | RCSAPPSARR | 0.3833 | 0.5301 | 6 | 16 |
MIDN-ABCA7 | chr19 | 1251900 | chr19 | 1061781 | 899 | HLA-B27:05 | ARCSAPPSARR | 0.9991 | 0.6728 | 5 | 16 |
MIDN-ABCA7 | chr19 | 1251900 | chr19 | 1061781 | 899 | HLA-A33:05 | DARCSAPPSAR | 0.9983 | 0.7517 | 4 | 15 |
MIDN-ABCA7 | chr19 | 1251900 | chr19 | 1061781 | 899 | HLA-A33:01 | DARCSAPPSAR | 0.9983 | 0.7517 | 4 | 15 |
MIDN-ABCA7 | chr19 | 1251900 | chr19 | 1061781 | 899 | HLA-A68:24 | DARCSAPPSAR | 0.9965 | 0.8006 | 4 | 15 |
MIDN-ABCA7 | chr19 | 1251900 | chr19 | 1061781 | 899 | HLA-A68:03 | DARCSAPPSAR | 0.9953 | 0.7869 | 4 | 15 |
MIDN-ABCA7 | chr19 | 1251900 | chr19 | 1061781 | 899 | HLA-A68:05 | DARCSAPPSAR | 0.9852 | 0.7894 | 4 | 15 |
MIDN-ABCA7 | chr19 | 1251900 | chr19 | 1061781 | 899 | HLA-A31:06 | ARCSAPPSARR | 0.93 | 0.7005 | 5 | 16 |
MIDN-ABCA7 | chr19 | 1251900 | chr19 | 1061781 | 899 | HLA-A68:01 | CSAPPSARR | 0.9975 | 0.566 | 7 | 16 |
MIDN-ABCA7 | chr19 | 1251900 | chr19 | 1061781 | 899 | HLA-B27:14 | ARCSAPPSA | 0.9963 | 0.7817 | 5 | 14 |
MIDN-ABCA7 | chr19 | 1251900 | chr19 | 1061781 | 899 | HLA-A31:01 | CSAPPSARR | 0.984 | 0.8634 | 7 | 16 |
MIDN-ABCA7 | chr19 | 1251900 | chr19 | 1061781 | 899 | HLA-B73:01 | ARCSAPPSA | 0.981 | 0.8645 | 5 | 14 |
MIDN-ABCA7 | chr19 | 1251900 | chr19 | 1061781 | 899 | HLA-A31:01 | RCSAPPSAR | 0.9297 | 0.7767 | 6 | 15 |
MIDN-ABCA7 | chr19 | 1251900 | chr19 | 1061781 | 899 | HLA-A31:01 | RCSAPPSARR | 0.9567 | 0.8261 | 6 | 16 |
MIDN-ABCA7 | chr19 | 1251900 | chr19 | 1061781 | 899 | HLA-B73:01 | DARCSAPPSA | 0.8721 | 0.8627 | 4 | 14 |
MIDN-ABCA7 | chr19 | 1251900 | chr19 | 1061781 | 899 | HLA-A03:01 | RCSAPPSARR | 0.3839 | 0.5699 | 6 | 16 |
MIDN-ABCA7 | chr19 | 1251900 | chr19 | 1061781 | 899 | HLA-A68:01 | DARCSAPPSAR | 0.9965 | 0.8006 | 4 | 15 |
MIDN-ABCA7 | chr19 | 1251900 | chr19 | 1061781 | 899 | HLA-A31:01 | ARCSAPPSARR | 0.9879 | 0.8307 | 5 | 16 |
MIDN-ABCA7 | chr19 | 1251900 | chr19 | 1061781 | 899 | HLA-A11:01 | ARCSAPPSARR | 0.8702 | 0.5079 | 5 | 16 |
MIDN-ABCA7 | chr19 | 1251900 | chr19 | 1061781 | 899 | HLA-A74:01 | CSAPPSARR | 0.9779 | 0.8836 | 7 | 16 |
MIDN-ABCA7 | chr19 | 1251900 | chr19 | 1061781 | 899 | HLA-A66:02 | CSAPPSARR | 0.9398 | 0.722 | 7 | 16 |
MIDN-ABCA7 | chr19 | 1251900 | chr19 | 1061781 | 899 | HLA-A74:01 | RCSAPPSARR | 0.9439 | 0.8474 | 6 | 16 |
MIDN-ABCA7 | chr19 | 1251900 | chr19 | 1061781 | 899 | HLA-B27:10 | ARCSAPPSARR | 0.9986 | 0.8577 | 5 | 16 |
MIDN-ABCA7 | chr19 | 1251900 | chr19 | 1061781 | 899 | HLA-A11:02 | ARCSAPPSARR | 0.8702 | 0.5079 | 5 | 16 |
Top |
Potential FusionNeoAntigen Information of MIDN-ABCA7 in HLA II |
![]() |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of MIDN-ABCA7 |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
7724 | RCSAPPSARRTRHP | MIDN | ABCA7 | chr19 | 1251900 | chr19 | 1061781 | 899 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of MIDN-ABCA7 |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 7724 | RCSAPPSARRTRHP | -7.9962 | -8.1096 |
HLA-B14:02 | 3BVN | 7724 | RCSAPPSARRTRHP | -5.70842 | -6.74372 |
HLA-B52:01 | 3W39 | 7724 | RCSAPPSARRTRHP | -6.83737 | -6.95077 |
HLA-B52:01 | 3W39 | 7724 | RCSAPPSARRTRHP | -4.4836 | -5.5189 |
HLA-A11:01 | 4UQ2 | 7724 | RCSAPPSARRTRHP | -10.0067 | -10.1201 |
HLA-A11:01 | 4UQ2 | 7724 | RCSAPPSARRTRHP | -9.03915 | -10.0745 |
HLA-A24:02 | 5HGA | 7724 | RCSAPPSARRTRHP | -6.56204 | -6.67544 |
HLA-A24:02 | 5HGA | 7724 | RCSAPPSARRTRHP | -5.42271 | -6.45801 |
HLA-B44:05 | 3DX8 | 7724 | RCSAPPSARRTRHP | -7.85648 | -8.89178 |
HLA-B44:05 | 3DX8 | 7724 | RCSAPPSARRTRHP | -5.3978 | -5.5112 |
HLA-A02:01 | 6TDR | 7724 | RCSAPPSARRTRHP | -3.37154 | -4.40684 |
Top |
Vaccine Design for the FusionNeoAntigens of MIDN-ABCA7 |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
MIDN-ABCA7 | chr19 | 1251900 | chr19 | 1061781 | 4 | 14 | DARCSAPPSA | GCTCTCGAGAGTCTCACGGAGACGCAGTGT |
MIDN-ABCA7 | chr19 | 1251900 | chr19 | 1061781 | 4 | 15 | DARCSAPPSAR | GCTCTCGAGAGTCTCACGGAGACGCAGTGTTTT |
MIDN-ABCA7 | chr19 | 1251900 | chr19 | 1061781 | 5 | 14 | ARCSAPPSA | CTCGAGAGTCTCACGGAGACGCAGTGT |
MIDN-ABCA7 | chr19 | 1251900 | chr19 | 1061781 | 5 | 16 | ARCSAPPSARR | CTCGAGAGTCTCACGGAGACGCAGTGTTTTGGG |
MIDN-ABCA7 | chr19 | 1251900 | chr19 | 1061781 | 6 | 15 | RCSAPPSAR | GAGAGTCTCACGGAGACGCAGTGTTTT |
MIDN-ABCA7 | chr19 | 1251900 | chr19 | 1061781 | 6 | 16 | RCSAPPSARR | GAGAGTCTCACGGAGACGCAGTGTTTTGGG |
MIDN-ABCA7 | chr19 | 1251900 | chr19 | 1061781 | 7 | 16 | CSAPPSARR | AGTCTCACGGAGACGCAGTGTTTTGGG |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of MIDN-ABCA7 |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
LUAD | MIDN-ABCA7 | chr19 | 1251900 | ENST00000300952 | chr19 | 1061781 | ENST00000263094 | TCGA-05-4418-01A |
Top |
Potential target of CAR-T therapy development for MIDN-ABCA7 |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
Tgene | ABCA7 | chr19:1251900 | chr19:1061781 | ENST00000435683 | 33 | 41 | 1683_1703 | 0 | 2009.0 | Transmembrane | Helical | |
Tgene | ABCA7 | chr19:1251900 | chr19:1061781 | ENST00000435683 | 33 | 41 | 1729_1749 | 0 | 2009.0 | Transmembrane | Helical |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to MIDN-ABCA7 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to MIDN-ABCA7 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |