![]() |
|||||||
|
Fusion Protein:MSH2-M1AP |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: MSH2-M1AP | FusionPDB ID: 55270 | FusionGDB2.0 ID: 55270 | Hgene | Tgene | Gene symbol | MSH2 | M1AP | Gene ID | 4436 | 130951 |
Gene name | mutS homolog 2 | meiosis 1 associated protein | |
Synonyms | COCA1|FCC1|HNPCC|HNPCC1|LCFS2|hMSH2 | C2orf65|D6Mm5e|SPATA37 | |
Cytomap | 2p21-p16.3 | 2p13.1 | |
Type of gene | protein-coding | protein-coding | |
Description | DNA mismatch repair protein Msh2DNA mismatch repair protein Msh2 transcriptmutS homolog 2, colon cancer, nonpolyposis type 1 | meiosis 1 arrest proteinmeiosis 1 arresting proteinspermatogenesis associated 37 | |
Modification date | 20200322 | 20200320 | |
UniProtAcc | P43246 Main function of 5'-partner protein: FUNCTION: Component of the post-replicative DNA mismatch repair system (MMR). Forms two different heterodimers: MutS alpha (MSH2-MSH6 heterodimer) and MutS beta (MSH2-MSH3 heterodimer) which binds to DNA mismatches thereby initiating DNA repair. When bound, heterodimers bend the DNA helix and shields approximately 20 base pairs. MutS alpha recognizes single base mismatches and dinucleotide insertion-deletion loops (IDL) in the DNA. MutS beta recognizes larger insertion-deletion loops up to 13 nucleotides long. After mismatch binding, MutS alpha or beta forms a ternary complex with the MutL alpha heterodimer, which is thought to be responsible for directing the downstream MMR events, including strand discrimination, excision, and resynthesis. Recruits DNA helicase MCM9 to chromatin which unwinds the mismatch containing DNA strand (PubMed:26300262). ATP binding and hydrolysis play a pivotal role in mismatch repair functions. The ATPase activity associated with MutS alpha regulates binding similar to a molecular switch: mismatched DNA provokes ADP-->ATP exchange, resulting in a discernible conformational transition that converts MutS alpha into a sliding clamp capable of hydrolysis-independent diffusion along the DNA backbone. This transition is crucial for mismatch repair. MutS alpha may also play a role in DNA homologous recombination repair. In melanocytes may modulate both UV-B-induced cell cycle regulation and apoptosis. {ECO:0000269|PubMed:10078208, ECO:0000269|PubMed:10660545, ECO:0000269|PubMed:15064730, ECO:0000269|PubMed:17611581, ECO:0000269|PubMed:21120944, ECO:0000269|PubMed:26300262, ECO:0000269|PubMed:9564049, ECO:0000269|PubMed:9822679, ECO:0000269|PubMed:9822680}. | . | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000233146, ENST00000406134, ENST00000543555, ENST00000461394, | ENST00000464686, ENST00000290536, ENST00000358434, ENST00000409585, ENST00000536235, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 15 X 12 X 10=1800 | 6 X 6 X 5=180 |
# samples | 23 | 7 | |
** MAII score | log2(23/1800*10)=-2.96829114027266 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(7/180*10)=-1.36257007938471 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
Fusion gene context | PubMed: MSH2 [Title/Abstract] AND M1AP [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: MSH2 [Title/Abstract] AND M1AP [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | MSH2(47672796)-M1AP(74787418), # samples:1 | ||
Anticipated loss of major functional domain due to fusion event. | MSH2-M1AP seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. MSH2-M1AP seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
Hgene | MSH2 | GO:0006281 | DNA repair | 8942985 |
Hgene | MSH2 | GO:0006298 | mismatch repair | 7923193|11555625 |
Hgene | MSH2 | GO:0006301 | postreplication repair | 7923193 |
Hgene | MSH2 | GO:0045910 | negative regulation of DNA recombination | 17715146 |
Hgene | MSH2 | GO:0051096 | positive regulation of helicase activity | 17715146 |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr2:47672796/chr2:74787418) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000233146 | MSH2 | chr2 | 47672796 | + | ENST00000290536 | M1AP | chr2 | 74787418 | - | 2754 | 1609 | 223 | 1920 | 565 |
ENST00000233146 | MSH2 | chr2 | 47672796 | + | ENST00000409585 | M1AP | chr2 | 74787418 | - | 2733 | 1609 | 223 | 1908 | 561 |
ENST00000233146 | MSH2 | chr2 | 47672796 | + | ENST00000536235 | M1AP | chr2 | 74787418 | - | 2287 | 1609 | 223 | 1908 | 561 |
ENST00000233146 | MSH2 | chr2 | 47672796 | + | ENST00000358434 | M1AP | chr2 | 74787418 | - | 1921 | 1609 | 223 | 1920 | 566 |
ENST00000543555 | MSH2 | chr2 | 47672796 | + | ENST00000290536 | M1AP | chr2 | 74787418 | - | 2472 | 1327 | 7 | 1638 | 543 |
ENST00000543555 | MSH2 | chr2 | 47672796 | + | ENST00000409585 | M1AP | chr2 | 74787418 | - | 2451 | 1327 | 7 | 1626 | 539 |
ENST00000543555 | MSH2 | chr2 | 47672796 | + | ENST00000536235 | M1AP | chr2 | 74787418 | - | 2005 | 1327 | 7 | 1626 | 539 |
ENST00000543555 | MSH2 | chr2 | 47672796 | + | ENST00000358434 | M1AP | chr2 | 74787418 | - | 1639 | 1327 | 7 | 1638 | 544 |
ENST00000406134 | MSH2 | chr2 | 47672796 | + | ENST00000290536 | M1AP | chr2 | 74787418 | - | 2593 | 1448 | 62 | 1759 | 565 |
ENST00000406134 | MSH2 | chr2 | 47672796 | + | ENST00000409585 | M1AP | chr2 | 74787418 | - | 2572 | 1448 | 62 | 1747 | 561 |
ENST00000406134 | MSH2 | chr2 | 47672796 | + | ENST00000536235 | M1AP | chr2 | 74787418 | - | 2126 | 1448 | 62 | 1747 | 561 |
ENST00000406134 | MSH2 | chr2 | 47672796 | + | ENST00000358434 | M1AP | chr2 | 74787418 | - | 1760 | 1448 | 62 | 1759 | 566 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000233146 | ENST00000290536 | MSH2 | chr2 | 47672796 | + | M1AP | chr2 | 74787418 | - | 0.001630987 | 0.99836904 |
ENST00000233146 | ENST00000409585 | MSH2 | chr2 | 47672796 | + | M1AP | chr2 | 74787418 | - | 0.001611827 | 0.9983882 |
ENST00000233146 | ENST00000536235 | MSH2 | chr2 | 47672796 | + | M1AP | chr2 | 74787418 | - | 0.002606605 | 0.99739337 |
ENST00000233146 | ENST00000358434 | MSH2 | chr2 | 47672796 | + | M1AP | chr2 | 74787418 | - | 0.0032819 | 0.9967181 |
ENST00000543555 | ENST00000290536 | MSH2 | chr2 | 47672796 | + | M1AP | chr2 | 74787418 | - | 0.001091435 | 0.9989085 |
ENST00000543555 | ENST00000409585 | MSH2 | chr2 | 47672796 | + | M1AP | chr2 | 74787418 | - | 0.001012516 | 0.9989875 |
ENST00000543555 | ENST00000536235 | MSH2 | chr2 | 47672796 | + | M1AP | chr2 | 74787418 | - | 0.001296486 | 0.9987035 |
ENST00000543555 | ENST00000358434 | MSH2 | chr2 | 47672796 | + | M1AP | chr2 | 74787418 | - | 0.001710473 | 0.9982895 |
ENST00000406134 | ENST00000290536 | MSH2 | chr2 | 47672796 | + | M1AP | chr2 | 74787418 | - | 0.00154556 | 0.99845445 |
ENST00000406134 | ENST00000409585 | MSH2 | chr2 | 47672796 | + | M1AP | chr2 | 74787418 | - | 0.001541565 | 0.9984584 |
ENST00000406134 | ENST00000536235 | MSH2 | chr2 | 47672796 | + | M1AP | chr2 | 74787418 | - | 0.0022651 | 0.9977349 |
ENST00000406134 | ENST00000358434 | MSH2 | chr2 | 47672796 | + | M1AP | chr2 | 74787418 | - | 0.002970646 | 0.9970293 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for MSH2-M1AP |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
MSH2 | chr2 | 47672796 | M1AP | chr2 | 74787418 | 1327 | 439 | KFQEMIETTLDMDQSMLDSLELEPTY |
MSH2 | chr2 | 47672796 | M1AP | chr2 | 74787418 | 1448 | 461 | KFQEMIETTLDMDQSMLDSLELEPTY |
MSH2 | chr2 | 47672796 | M1AP | chr2 | 74787418 | 1609 | 461 | KFQEMIETTLDMDQSMLDSLELEPTY |
Top |
Potential FusionNeoAntigen Information of MSH2-M1AP in HLA I |
![]() |
MSH2-M1AP_47672796_74787418.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
MSH2-M1AP | chr2 | 47672796 | chr2 | 74787418 | 1609 | HLA-A02:38 | TLDMDQSML | 0.9246 | 0.7326 | 8 | 17 |
MSH2-M1AP | chr2 | 47672796 | chr2 | 74787418 | 1609 | HLA-A02:19 | TLDMDQSML | 0.7003 | 0.505 | 8 | 17 |
MSH2-M1AP | chr2 | 47672796 | chr2 | 74787418 | 1609 | HLA-C05:09 | TLDMDQSM | 1 | 0.9747 | 8 | 16 |
MSH2-M1AP | chr2 | 47672796 | chr2 | 74787418 | 1609 | HLA-C08:15 | TLDMDQSM | 0.9999 | 0.9794 | 8 | 16 |
MSH2-M1AP | chr2 | 47672796 | chr2 | 74787418 | 1609 | HLA-C04:10 | TLDMDQSML | 0.9998 | 0.7932 | 8 | 17 |
MSH2-M1AP | chr2 | 47672796 | chr2 | 74787418 | 1609 | HLA-C05:09 | TLDMDQSML | 0.9998 | 0.9658 | 8 | 17 |
MSH2-M1AP | chr2 | 47672796 | chr2 | 74787418 | 1609 | HLA-C04:07 | TLDMDQSML | 0.9997 | 0.8258 | 8 | 17 |
MSH2-M1AP | chr2 | 47672796 | chr2 | 74787418 | 1609 | HLA-C08:15 | TLDMDQSML | 0.9996 | 0.972 | 8 | 17 |
MSH2-M1AP | chr2 | 47672796 | chr2 | 74787418 | 1609 | HLA-A02:07 | TLDMDQSML | 0.9349 | 0.6921 | 8 | 17 |
MSH2-M1AP | chr2 | 47672796 | chr2 | 74787418 | 1609 | HLA-C04:06 | TLDMDQSML | 0.9338 | 0.9337 | 8 | 17 |
MSH2-M1AP | chr2 | 47672796 | chr2 | 74787418 | 1609 | HLA-C05:01 | TLDMDQSM | 1 | 0.9747 | 8 | 16 |
MSH2-M1AP | chr2 | 47672796 | chr2 | 74787418 | 1609 | HLA-C04:03 | TLDMDQSM | 1 | 0.8634 | 8 | 16 |
MSH2-M1AP | chr2 | 47672796 | chr2 | 74787418 | 1609 | HLA-C08:02 | TLDMDQSM | 0.9999 | 0.9794 | 8 | 16 |
MSH2-M1AP | chr2 | 47672796 | chr2 | 74787418 | 1609 | HLA-C05:01 | TLDMDQSML | 0.9998 | 0.9658 | 8 | 17 |
MSH2-M1AP | chr2 | 47672796 | chr2 | 74787418 | 1609 | HLA-C04:03 | TLDMDQSML | 0.9998 | 0.8684 | 8 | 17 |
MSH2-M1AP | chr2 | 47672796 | chr2 | 74787418 | 1609 | HLA-C18:01 | TLDMDQSML | 0.9997 | 0.8328 | 8 | 17 |
MSH2-M1AP | chr2 | 47672796 | chr2 | 74787418 | 1609 | HLA-C04:01 | TLDMDQSML | 0.9997 | 0.8258 | 8 | 17 |
MSH2-M1AP | chr2 | 47672796 | chr2 | 74787418 | 1609 | HLA-C01:03 | TLDMDQSML | 0.9996 | 0.9377 | 8 | 17 |
MSH2-M1AP | chr2 | 47672796 | chr2 | 74787418 | 1609 | HLA-C08:02 | TLDMDQSML | 0.9996 | 0.972 | 8 | 17 |
MSH2-M1AP | chr2 | 47672796 | chr2 | 74787418 | 1609 | HLA-C03:06 | TTLDMDQSM | 0.8546 | 0.9902 | 7 | 16 |
MSH2-M1AP | chr2 | 47672796 | chr2 | 74787418 | 1609 | HLA-B35:13 | TTLDMDQSM | 0.7341 | 0.9572 | 7 | 16 |
Top |
Potential FusionNeoAntigen Information of MSH2-M1AP in HLA II |
![]() |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of MSH2-M1AP |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
2192 | ETTLDMDQSMLDSL | MSH2 | M1AP | chr2 | 47672796 | chr2 | 74787418 | 1609 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of MSH2-M1AP |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 2192 | ETTLDMDQSMLDSL | -6.73939 | -6.85279 |
HLA-B14:02 | 3BVN | 2192 | ETTLDMDQSMLDSL | -5.8572 | -6.8925 |
HLA-B52:01 | 3W39 | 2192 | ETTLDMDQSMLDSL | -6.06811 | -6.18151 |
HLA-B52:01 | 3W39 | 2192 | ETTLDMDQSMLDSL | -4.01521 | -5.05051 |
HLA-A24:02 | 5HGA | 2192 | ETTLDMDQSMLDSL | -6.11611 | -7.15141 |
HLA-A24:02 | 5HGA | 2192 | ETTLDMDQSMLDSL | -5.72969 | -5.84309 |
HLA-B27:05 | 6PYJ | 2192 | ETTLDMDQSMLDSL | -6.42433 | -7.45963 |
HLA-B44:05 | 3DX8 | 2192 | ETTLDMDQSMLDSL | -5.79012 | -5.90352 |
HLA-B44:05 | 3DX8 | 2192 | ETTLDMDQSMLDSL | -3.82099 | -4.85629 |
Top |
Vaccine Design for the FusionNeoAntigens of MSH2-M1AP |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
MSH2-M1AP | chr2 | 47672796 | chr2 | 74787418 | 7 | 16 | TTLDMDQSM | ACTTTAGATATGGATCAGAGCATGCTG |
MSH2-M1AP | chr2 | 47672796 | chr2 | 74787418 | 8 | 16 | TLDMDQSM | TTAGATATGGATCAGAGCATGCTG |
MSH2-M1AP | chr2 | 47672796 | chr2 | 74787418 | 8 | 17 | TLDMDQSML | TTAGATATGGATCAGAGCATGCTGGAC |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of MSH2-M1AP |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
UCEC | MSH2-M1AP | chr2 | 47672796 | ENST00000233146 | chr2 | 74787418 | ENST00000290536 | TCGA-AJ-A23M-01A |
Top |
Potential target of CAR-T therapy development for MSH2-M1AP |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to MSH2-M1AP |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to MSH2-M1AP |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |