Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:NECAP2-EPHA2

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: NECAP2-EPHA2
	FusionPDB ID: 58376
	FusionGDB2.0 ID: 58376
		Hgene	Tgene
	Gene symbol	NECAP2	EPHA2
	Gene ID	55707	1969
	Gene name	NECAP endocytosis associated 2	EPH receptor A2
	Synonyms	-	ARCC2\|CTPA\|CTPP1\|CTRCT6\|ECK
	Cytomap	1p36.13	1p36.13
	Type of gene	protein-coding	protein-coding
	Description	adaptin ear-binding coat-associated protein 2adaptin-ear-binding coat-associated protein 2	ephrin type-A receptor 2epithelial cell receptor protein tyrosine kinasesoluble EPHA2 variant 1tyrosine-protein kinase receptor ECK
	Modification date	20200313	20200313
	UniProtAcc	Q9NVZ3 Main function of 5'-partner protein: FUNCTION: Involved in endocytosis. {ECO:0000250}.	P29317 Main function of 5'-partner protein: FUNCTION: Receptor tyrosine kinase which binds promiscuously membrane-bound ephrin-A family ligands residing on adjacent cells, leading to contact-dependent bidirectional signaling into neighboring cells. The signaling pathway downstream of the receptor is referred to as forward signaling while the signaling pathway downstream of the ephrin ligand is referred to as reverse signaling. Activated by the ligand ephrin-A1/EFNA1 regulates migration, integrin-mediated adhesion, proliferation and differentiation of cells. Regulates cell adhesion and differentiation through DSG1/desmoglein-1 and inhibition of the ERK1/ERK2 (MAPK3/MAPK1, respectively) signaling pathway. May also participate in UV radiation-induced apoptosis and have a ligand-independent stimulatory effect on chemotactic cell migration. During development, may function in distinctive aspects of pattern formation and subsequently in development of several fetal tissues. Involved for instance in angiogenesis, in early hindbrain development and epithelial proliferation and branching morphogenesis during mammary gland development. Engaged by the ligand ephrin-A5/EFNA5 may regulate lens fiber cells shape and interactions and be important for lens transparency development and maintenance. With ephrin-A2/EFNA2 may play a role in bone remodeling through regulation of osteoclastogenesis and osteoblastogenesis. {ECO:0000269\|PubMed:10655584, ECO:0000269\|PubMed:16236711, ECO:0000269\|PubMed:18339848, ECO:0000269\|PubMed:19573808, ECO:0000269\|PubMed:20679435, ECO:0000269\|PubMed:20861311, ECO:0000269\|PubMed:23358419, ECO:0000269\|PubMed:26158630, ECO:0000269\|PubMed:27385333}.; FUNCTION: (Microbial infection) Acts as a receptor for hepatitis C virus (HCV) in hepatocytes and facilitates its cell entry. Mediates HCV entry by promoting the formation of the CD81-CLDN1 receptor complexes that are essential for HCV entry and by enhancing membrane fusion of cells expressing HCV envelope glycoproteins. {ECO:0000269\|PubMed:21516087}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000337132, ENST00000406746, ENST00000443980, ENST00000457722, ENST00000504551, ENST00000486390,	ENST00000461614, ENST00000358432,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	3 X 4 X 2=24	5 X 4 X 5=100
	# samples	4	5
	** MAII score	log2(4/24*10)=0.736965594166206 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0	log2(5/100*10)=-1 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: NECAP2 [Title/Abstract] AND EPHA2 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: NECAP2 [Title/Abstract] AND EPHA2 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	NECAP2(16775696)-EPHA2(16456914), # samples:3
Anticipated loss of major functional domain due to fusion event.	NECAP2-EPHA2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. NECAP2-EPHA2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. NECAP2-EPHA2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. NECAP2-EPHA2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Tgene	EPHA2	GO:0008630	intrinsic apoptotic signaling pathway in response to DNA damage	18339848
Tgene	EPHA2	GO:0033628	regulation of cell adhesion mediated by integrin	10655584
Tgene	EPHA2	GO:0043491	protein kinase B signaling	19573808
Tgene	EPHA2	GO:0048013	ephrin receptor signaling pathway	10655584\|20861311
Tgene	EPHA2	GO:0051898	negative regulation of protein kinase B signaling	19573808

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr1:16775696/chr1:16456914)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across NECAP2 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across EPHA2 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000337132	NECAP2	chr1	16775696	+	ENST00000358432	EPHA2	chr1	16456914	-	1913	579	90	1034	314
ENST00000504551	NECAP2	chr1	16775696	+	ENST00000358432	EPHA2	chr1	16456914	-	1681	347	41	802	253
ENST00000457722	NECAP2	chr1	16775696	+	ENST00000358432	EPHA2	chr1	16456914	-	1783	449	38	904	288
ENST00000406746	NECAP2	chr1	16775696	+	ENST00000358432	EPHA2	chr1	16456914	-	1861	527	38	982	314
ENST00000443980	NECAP2	chr1	16775696	+	ENST00000358432	EPHA2	chr1	16456914	-	1849	515	26	970	314

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000337132	ENST00000358432	NECAP2	chr1	16775696	+	EPHA2	chr1	16456914	-	0.006604009	0.993396
ENST00000504551	ENST00000358432	NECAP2	chr1	16775696	+	EPHA2	chr1	16456914	-	0.03838489	0.9616151
ENST00000457722	ENST00000358432	NECAP2	chr1	16775696	+	EPHA2	chr1	16456914	-	0.00744091	0.9925591
ENST00000406746	ENST00000358432	NECAP2	chr1	16775696	+	EPHA2	chr1	16456914	-	0.00651518	0.9934848
ENST00000443980	ENST00000358432	NECAP2	chr1	16775696	+	EPHA2	chr1	16456914	-	0.006608509	0.9933915

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for NECAP2-EPHA2

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
NECAP2	chr1	16775696	EPHA2	chr1	16456914	347	102	GFKEGQTIKLNIAVMKAINDGFRLPT
NECAP2	chr1	16775696	EPHA2	chr1	16456914	449	137	GFKEGQTIKLNIAVMKAINDGFRLPT
NECAP2	chr1	16775696	EPHA2	chr1	16456914	515	163	GFKEGQTIKLNIAVMKAINDGFRLPT
NECAP2	chr1	16775696	EPHA2	chr1	16456914	527	163	GFKEGQTIKLNIAVMKAINDGFRLPT
NECAP2	chr1	16775696	EPHA2	chr1	16456914	579	163	GFKEGQTIKLNIAVMKAINDGFRLPT

Top

Potential FusionNeoAntigen Information of NECAP2-EPHA2 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

NECAP2-EPHA2_16775696_16456914.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
NECAP2-EPHA2	chr1	16775696	chr1	16456914	579	HLA-A02:13	KLNIAVMKA	0.9829	0.8008	8	17
NECAP2-EPHA2	chr1	16775696	chr1	16456914	579	HLA-B13:02	GQTIKLNIAV	0.8545	0.7421	4	14
NECAP2-EPHA2	chr1	16775696	chr1	16456914	579	HLA-A68:02	QTIKLNIAV	0.9964	0.6552	5	14
NECAP2-EPHA2	chr1	16775696	chr1	16456914	579	HLA-B15:08	TIKLNIAVM	0.9942	0.7411	6	15
NECAP2-EPHA2	chr1	16775696	chr1	16456914	579	HLA-A69:01	QTIKLNIAV	0.9925	0.6329	5	14
NECAP2-EPHA2	chr1	16775696	chr1	16456914	579	HLA-A02:03	KLNIAVMKA	0.991	0.8253	8	17

Top

Potential FusionNeoAntigen Information of NECAP2-EPHA2 in HLA II

NECAP2-EPHA2_16775696_16456914.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
NECAP2-EPHA2	chr1	16775696	chr1	16456914	579	DRB1-0303	GQTIKLNIAVMKAIN	4	19
NECAP2-EPHA2	chr1	16775696	chr1	16456914	579	DRB1-0403	KLNIAVMKAINDGFR	8	23
NECAP2-EPHA2	chr1	16775696	chr1	16456914	579	DRB1-0405	KLNIAVMKAINDGFR	8	23
NECAP2-EPHA2	chr1	16775696	chr1	16456914	579	DRB1-0411	KLNIAVMKAINDGFR	8	23
NECAP2-EPHA2	chr1	16775696	chr1	16456914	579	DRB1-0411	IKLNIAVMKAINDGF	7	22
NECAP2-EPHA2	chr1	16775696	chr1	16456914	579	DRB1-0411	TIKLNIAVMKAINDG	6	21
NECAP2-EPHA2	chr1	16775696	chr1	16456914	579	DRB1-0415	KLNIAVMKAINDGFR	8	23
NECAP2-EPHA2	chr1	16775696	chr1	16456914	579	DRB1-0415	IKLNIAVMKAINDGF	7	22
NECAP2-EPHA2	chr1	16775696	chr1	16456914	579	DRB1-0424	KLNIAVMKAINDGFR	8	23
NECAP2-EPHA2	chr1	16775696	chr1	16456914	579	DRB1-0427	KLNIAVMKAINDGFR	8	23
NECAP2-EPHA2	chr1	16775696	chr1	16456914	579	DRB1-0429	KLNIAVMKAINDGFR	8	23
NECAP2-EPHA2	chr1	16775696	chr1	16456914	579	DRB1-0430	KLNIAVMKAINDGFR	8	23
NECAP2-EPHA2	chr1	16775696	chr1	16456914	579	DRB1-0436	KLNIAVMKAINDGFR	8	23
NECAP2-EPHA2	chr1	16775696	chr1	16456914	579	DRB1-0436	IKLNIAVMKAINDGF	7	22
NECAP2-EPHA2	chr1	16775696	chr1	16456914	579	DRB1-0439	KLNIAVMKAINDGFR	8	23
NECAP2-EPHA2	chr1	16775696	chr1	16456914	579	DRB1-0441	KLNIAVMKAINDGFR	8	23
NECAP2-EPHA2	chr1	16775696	chr1	16456914	579	DRB1-0445	KLNIAVMKAINDGFR	8	23
NECAP2-EPHA2	chr1	16775696	chr1	16456914	579	DRB1-0446	KLNIAVMKAINDGFR	8	23
NECAP2-EPHA2	chr1	16775696	chr1	16456914	579	DRB1-0447	KLNIAVMKAINDGFR	8	23
NECAP2-EPHA2	chr1	16775696	chr1	16456914	579	DRB1-0448	KLNIAVMKAINDGFR	8	23
NECAP2-EPHA2	chr1	16775696	chr1	16456914	579	DRB1-0449	KLNIAVMKAINDGFR	8	23
NECAP2-EPHA2	chr1	16775696	chr1	16456914	579	DRB1-0450	KLNIAVMKAINDGFR	8	23
NECAP2-EPHA2	chr1	16775696	chr1	16456914	579	DRB1-0451	KLNIAVMKAINDGFR	8	23
NECAP2-EPHA2	chr1	16775696	chr1	16456914	579	DRB1-0452	KLNIAVMKAINDGFR	8	23
NECAP2-EPHA2	chr1	16775696	chr1	16456914	579	DRB1-0453	KLNIAVMKAINDGFR	8	23
NECAP2-EPHA2	chr1	16775696	chr1	16456914	579	DRB1-0457	KLNIAVMKAINDGFR	8	23
NECAP2-EPHA2	chr1	16775696	chr1	16456914	579	DRB1-0458	KLNIAVMKAINDGFR	8	23
NECAP2-EPHA2	chr1	16775696	chr1	16456914	579	DRB1-0459	KLNIAVMKAINDGFR	8	23
NECAP2-EPHA2	chr1	16775696	chr1	16456914	579	DRB1-0460	KLNIAVMKAINDGFR	8	23
NECAP2-EPHA2	chr1	16775696	chr1	16456914	579	DRB1-0465	KLNIAVMKAINDGFR	8	23
NECAP2-EPHA2	chr1	16775696	chr1	16456914	579	DRB1-0467	KLNIAVMKAINDGFR	8	23
NECAP2-EPHA2	chr1	16775696	chr1	16456914	579	DRB1-0471	KLNIAVMKAINDGFR	8	23
NECAP2-EPHA2	chr1	16775696	chr1	16456914	579	DRB1-0477	KLNIAVMKAINDGFR	8	23
NECAP2-EPHA2	chr1	16775696	chr1	16456914	579	DRB1-0478	KLNIAVMKAINDGFR	8	23
NECAP2-EPHA2	chr1	16775696	chr1	16456914	579	DRB1-0479	KLNIAVMKAINDGFR	8	23
NECAP2-EPHA2	chr1	16775696	chr1	16456914	579	DRB1-0480	KLNIAVMKAINDGFR	8	23
NECAP2-EPHA2	chr1	16775696	chr1	16456914	579	DRB1-0480	IKLNIAVMKAINDGF	7	22
NECAP2-EPHA2	chr1	16775696	chr1	16456914	579	DRB1-0483	KLNIAVMKAINDGFR	8	23
NECAP2-EPHA2	chr1	16775696	chr1	16456914	579	DRB1-0484	KLNIAVMKAINDGFR	8	23
NECAP2-EPHA2	chr1	16775696	chr1	16456914	579	DRB1-0485	KLNIAVMKAINDGFR	8	23
NECAP2-EPHA2	chr1	16775696	chr1	16456914	579	DRB1-0486	KLNIAVMKAINDGFR	8	23
NECAP2-EPHA2	chr1	16775696	chr1	16456914	579	DRB1-0487	KLNIAVMKAINDGFR	8	23
NECAP2-EPHA2	chr1	16775696	chr1	16456914	579	DRB1-0488	KLNIAVMKAINDGFR	8	23
NECAP2-EPHA2	chr1	16775696	chr1	16456914	579	DRB1-0489	KLNIAVMKAINDGFR	8	23
NECAP2-EPHA2	chr1	16775696	chr1	16456914	579	DRB1-0491	KLNIAVMKAINDGFR	8	23
NECAP2-EPHA2	chr1	16775696	chr1	16456914	579	DRB1-0491	IKLNIAVMKAINDGF	7	22
NECAP2-EPHA2	chr1	16775696	chr1	16456914	579	DRB1-0491	TIKLNIAVMKAINDG	6	21
NECAP2-EPHA2	chr1	16775696	chr1	16456914	579	DRB1-0810	KLNIAVMKAINDGFR	8	23
NECAP2-EPHA2	chr1	16775696	chr1	16456914	579	DRB1-0810	IKLNIAVMKAINDGF	7	22
NECAP2-EPHA2	chr1	16775696	chr1	16456914	579	DRB1-0812	KLNIAVMKAINDGFR	8	23
NECAP2-EPHA2	chr1	16775696	chr1	16456914	579	DRB1-0812	IKLNIAVMKAINDGF	7	22
NECAP2-EPHA2	chr1	16775696	chr1	16456914	579	DRB1-0812	TIKLNIAVMKAINDG	6	21
NECAP2-EPHA2	chr1	16775696	chr1	16456914	579	DRB1-0822	KLNIAVMKAINDGFR	8	23
NECAP2-EPHA2	chr1	16775696	chr1	16456914	579	DRB1-0832	KLNIAVMKAINDGFR	8	23
NECAP2-EPHA2	chr1	16775696	chr1	16456914	579	DRB1-0832	IKLNIAVMKAINDGF	7	22
NECAP2-EPHA2	chr1	16775696	chr1	16456914	579	DRB1-0832	TIKLNIAVMKAINDG	6	21
NECAP2-EPHA2	chr1	16775696	chr1	16456914	579	DRB1-1002	KLNIAVMKAINDGFR	8	23
NECAP2-EPHA2	chr1	16775696	chr1	16456914	579	DRB1-1002	IKLNIAVMKAINDGF	7	22
NECAP2-EPHA2	chr1	16775696	chr1	16456914	579	DRB1-1002	TIKLNIAVMKAINDG	6	21
NECAP2-EPHA2	chr1	16775696	chr1	16456914	579	DRB1-1204	KLNIAVMKAINDGFR	8	23
NECAP2-EPHA2	chr1	16775696	chr1	16456914	579	DRB1-1209	KLNIAVMKAINDGFR	8	23
NECAP2-EPHA2	chr1	16775696	chr1	16456914	579	DRB1-1219	KLNIAVMKAINDGFR	8	23
NECAP2-EPHA2	chr1	16775696	chr1	16456914	579	DRB1-1221	KLNIAVMKAINDGFR	8	23
NECAP2-EPHA2	chr1	16775696	chr1	16456914	579	DRB1-1358	KLNIAVMKAINDGFR	8	23
NECAP2-EPHA2	chr1	16775696	chr1	16456914	579	DRB1-1410	KLNIAVMKAINDGFR	8	23
NECAP2-EPHA2	chr1	16775696	chr1	16456914	579	DRB1-1447	GQTIKLNIAVMKAIN	4	19
NECAP2-EPHA2	chr1	16775696	chr1	16456914	579	DRB1-1457	KLNIAVMKAINDGFR	8	23
NECAP2-EPHA2	chr1	16775696	chr1	16456914	579	DRB1-1478	KLNIAVMKAINDGFR	8	23
NECAP2-EPHA2	chr1	16775696	chr1	16456914	579	DRB3-0204	GQTIKLNIAVMKAIN	4	19

Top

Fusion breakpoint peptide structures of NECAP2-EPHA2

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
9403	TIKLNIAVMKAIND	NECAP2	EPHA2	chr1	16775696	chr1	16456914	579

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of NECAP2-EPHA2

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B52:01	3W39	9403	TIKLNIAVMKAIND	-6.65674	-6.65674
HLA-B44:05	3DX8	9403	TIKLNIAVMKAIND	-6.36866	-6.36866

Top

Vaccine Design for the FusionNeoAntigens of NECAP2-EPHA2

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
NECAP2-EPHA2	chr1	16775696	chr1	16456914	4	14	GQTIKLNIAV	GGCCAGACCATCAAGCTCAACATCGCAGTG
NECAP2-EPHA2	chr1	16775696	chr1	16456914	5	14	QTIKLNIAV	CAGACCATCAAGCTCAACATCGCAGTG
NECAP2-EPHA2	chr1	16775696	chr1	16456914	6	15	TIKLNIAVM	ACCATCAAGCTCAACATCGCAGTGATG
NECAP2-EPHA2	chr1	16775696	chr1	16456914	8	17	KLNIAVMKA	AAGCTCAACATCGCAGTGATGAAAGCC

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
NECAP2-EPHA2	chr1	16775696	chr1	16456914	4	19	GQTIKLNIAVMKAIN	GGCCAGACCATCAAGCTCAACATCGCAGTGATGAAAGCCATCAAT
NECAP2-EPHA2	chr1	16775696	chr1	16456914	6	21	TIKLNIAVMKAINDG	ACCATCAAGCTCAACATCGCAGTGATGAAAGCCATCAATGATGGC
NECAP2-EPHA2	chr1	16775696	chr1	16456914	7	22	IKLNIAVMKAINDGF	ATCAAGCTCAACATCGCAGTGATGAAAGCCATCAATGATGGCTTC
NECAP2-EPHA2	chr1	16775696	chr1	16456914	8	23	KLNIAVMKAINDGFR	AAGCTCAACATCGCAGTGATGAAAGCCATCAATGATGGCTTCCGG

Top

Information of the samples that have these potential fusion neoantigens of NECAP2-EPHA2

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
OV	NECAP2-EPHA2	chr1	16775696	ENST00000337132	chr1	16456914	ENST00000358432	TCGA-25-2400-01A

Top

Potential target of CAR-T therapy development for NECAP2-EPHA2

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to NECAP2-EPHA2

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to NECAP2-EPHA2

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)