Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:NFIX-CALR

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: NFIX-CALR
	FusionPDB ID: 58938
	FusionGDB2.0 ID: 58938
		Hgene	Tgene
	Gene symbol	NFIX	CALR
	Gene ID	4784	811
	Gene name	nuclear factor I X	calreticulin
	Synonyms	CTF\|MRSHSS\|NF-I/X\|NF1-X\|NF1A\|SOTOS2	CRT\|HEL-S-99n\|RO\|SSA\|cC1qR
	Cytomap	19p13.13	19p13.13
	Type of gene	protein-coding	protein-coding
	Description	nuclear factor 1 X-typeCCAAT-box-binding transcription factorTGGCA-binding proteinnuclear factor 1/X	calreticulinCRP55ERp60HACBPSicca syndrome antigen A (autoantigen Ro; calreticulin)calregulinendoplasmic reticulum resident protein 60epididymis secretory sperm binding protein Li 99ngrp60
	Modification date	20200329	20200329
	UniProtAcc	Q14938 Main function of 5'-partner protein: FUNCTION: Recognizes and binds the palindromic sequence 5'-TTGGCNNNNNGCCAA-3' present in viral and cellular promoters and in the origin of replication of adenovirus type 2. These proteins are individually capable of activating transcription and replication.	Q96L12 Main function of 5'-partner protein: FUNCTION: During spermatogenesis, may act as a lectin-independent chaperone for specific client proteins such as ADAM3. Required for sperm fertility (By similarity). CALR3 capacity for calcium-binding may be absent or much lower than that of CALR. {ECO:0000250, ECO:0000269\|PubMed:21590275}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000397661, ENST00000585575, ENST00000587260, ENST00000587760, ENST00000588228, ENST00000592199, ENST00000358552, ENST00000360105, ENST00000588680,	ENST00000316448,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	27 X 14 X 16=6048	24 X 30 X 7=5040
	# samples	42	38
	** MAII score	log2(42/6048*10)=-3.84799690655495 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(38/5040*10)=-3.72935241005633 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: NFIX [Title/Abstract] AND CALR [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: NFIX [Title/Abstract] AND CALR [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	NFIX(13136366)-CALR(13050866), # samples:1 NFIX(13136366)-CALR(13049947), # samples:1 NFIX(13192669)-CALR(13054350), # samples:1 NFIX(13189549)-CALR(13055026), # samples:1 NFIX(13136366)-CALR(13049948), # samples:1 NFIX(13136366)-CALR(13050242), # samples:1 NFIX(13192669)-CALR(13054351), # samples:1
Anticipated loss of major functional domain due to fusion event.	NFIX-CALR seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. NFIX-CALR seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. NFIX-CALR seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. NFIX-CALR seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	NFIX	GO:0000122	negative regulation of transcription by RNA polymerase II	19706729
Hgene	NFIX	GO:0045944	positive regulation of transcription by RNA polymerase II	19706729
Tgene	CALR	GO:0000122	negative regulation of transcription by RNA polymerase II	8107809
Tgene	CALR	GO:0006611	protein export from nucleus	11149926
Tgene	CALR	GO:0017148	negative regulation of translation	14726956
Tgene	CALR	GO:0033144	negative regulation of intracellular steroid hormone receptor signaling pathway	8107809
Tgene	CALR	GO:0034504	protein localization to nucleus	15998798
Tgene	CALR	GO:0045665	negative regulation of neuron differentiation	8107809
Tgene	CALR	GO:0045892	negative regulation of transcription, DNA-templated	8107809
Tgene	CALR	GO:0048387	negative regulation of retinoic acid receptor signaling pathway	8107809

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr19:13136366/chr19:13050866)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across NFIX (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across CALR (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000397661	NFIX	chr19	13192669	+	ENST00000316448	CALR	chr19	13054350	+	2354	1484	173	1777	534
ENST00000592199	NFIX	chr19	13192669	+	ENST00000316448	CALR	chr19	13054350	+	2124	1254	0	1547	515
ENST00000587760	NFIX	chr19	13192669	+	ENST00000316448	CALR	chr19	13054350	+	2141	1271	14	1564	516
ENST00000585575	NFIX	chr19	13192669	+	ENST00000316448	CALR	chr19	13054350	+	2100	1230	0	1523	507
ENST00000360105	NFIX	chr19	13192669	+	ENST00000316448	CALR	chr19	13054350	+	2075	1205	65	1498	477
ENST00000588228	NFIX	chr19	13192669	+	ENST00000316448	CALR	chr19	13054350	+	2201	1331	53	1624	523
ENST00000587260	NFIX	chr19	13192669	+	ENST00000316448	CALR	chr19	13054350	+	2179	1309	58	1602	514
ENST00000358552	NFIX	chr19	13192669	+	ENST00000316448	CALR	chr19	13054350	+	1998	1128	0	1421	473
ENST00000397661	NFIX	chr19	13192669	+	ENST00000316448	CALR	chr19	13054351	+	2354	1484	173	1777	534
ENST00000592199	NFIX	chr19	13192669	+	ENST00000316448	CALR	chr19	13054351	+	2124	1254	0	1547	515
ENST00000587760	NFIX	chr19	13192669	+	ENST00000316448	CALR	chr19	13054351	+	2141	1271	14	1564	516
ENST00000585575	NFIX	chr19	13192669	+	ENST00000316448	CALR	chr19	13054351	+	2100	1230	0	1523	507
ENST00000360105	NFIX	chr19	13192669	+	ENST00000316448	CALR	chr19	13054351	+	2075	1205	65	1498	477
ENST00000588228	NFIX	chr19	13192669	+	ENST00000316448	CALR	chr19	13054351	+	2201	1331	53	1624	523
ENST00000587260	NFIX	chr19	13192669	+	ENST00000316448	CALR	chr19	13054351	+	2179	1309	58	1602	514
ENST00000358552	NFIX	chr19	13192669	+	ENST00000316448	CALR	chr19	13054351	+	1998	1128	0	1421	473

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000397661	ENST00000316448	NFIX	chr19	13192669	+	CALR	chr19	13054350	+	0.00724521	0.99275476
ENST00000592199	ENST00000316448	NFIX	chr19	13192669	+	CALR	chr19	13054350	+	0.005153251	0.9948467
ENST00000587760	ENST00000316448	NFIX	chr19	13192669	+	CALR	chr19	13054350	+	0.003311834	0.9966882
ENST00000585575	ENST00000316448	NFIX	chr19	13192669	+	CALR	chr19	13054350	+	0.003115225	0.99688476
ENST00000360105	ENST00000316448	NFIX	chr19	13192669	+	CALR	chr19	13054350	+	0.004845465	0.9951545
ENST00000588228	ENST00000316448	NFIX	chr19	13192669	+	CALR	chr19	13054350	+	0.005771936	0.994228
ENST00000587260	ENST00000316448	NFIX	chr19	13192669	+	CALR	chr19	13054350	+	0.005929697	0.99407023
ENST00000358552	ENST00000316448	NFIX	chr19	13192669	+	CALR	chr19	13054350	+	0.003557034	0.996443
ENST00000397661	ENST00000316448	NFIX	chr19	13192669	+	CALR	chr19	13054351	+	0.00724521	0.99275476
ENST00000592199	ENST00000316448	NFIX	chr19	13192669	+	CALR	chr19	13054351	+	0.005153251	0.9948467
ENST00000587760	ENST00000316448	NFIX	chr19	13192669	+	CALR	chr19	13054351	+	0.003311834	0.9966882
ENST00000585575	ENST00000316448	NFIX	chr19	13192669	+	CALR	chr19	13054351	+	0.003115225	0.99688476
ENST00000360105	ENST00000316448	NFIX	chr19	13192669	+	CALR	chr19	13054351	+	0.004845465	0.9951545
ENST00000588228	ENST00000316448	NFIX	chr19	13192669	+	CALR	chr19	13054351	+	0.005771936	0.994228
ENST00000587260	ENST00000316448	NFIX	chr19	13192669	+	CALR	chr19	13054351	+	0.005929697	0.99407023
ENST00000358552	ENST00000316448	NFIX	chr19	13192669	+	CALR	chr19	13054351	+	0.003557034	0.996443

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for NFIX-CALR

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
NFIX	chr19	13192669	CALR	chr19	13054350	1128	375	QFVCSDGSGQATGQVKSGTIFDNFLI
NFIX	chr19	13192669	CALR	chr19	13054350	1205	379	QFVCSDGSGQATGQVKSGTIFDNFLI
NFIX	chr19	13192669	CALR	chr19	13054350	1230	409	QFVCSDGSGQATGQVKSGTIFDNFLI
NFIX	chr19	13192669	CALR	chr19	13054350	1254	417	QFVCSDGSGQATGQVKSGTIFDNFLI
NFIX	chr19	13192669	CALR	chr19	13054350	1271	418	QFVCSDGSGQATGQVKSGTIFDNFLI
NFIX	chr19	13192669	CALR	chr19	13054350	1309	416	QFVCSDGSGQATGQVKSGTIFDNFLI
NFIX	chr19	13192669	CALR	chr19	13054350	1331	425	QFVCSDGSGQATGQVKSGTIFDNFLI
NFIX	chr19	13192669	CALR	chr19	13054350	1484	436	QFVCSDGSGQATGQVKSGTIFDNFLI
NFIX	chr19	13192669	CALR	chr19	13054351	1128	375	QFVCSDGSGQATGQVKSGTIFDNFLI
NFIX	chr19	13192669	CALR	chr19	13054351	1205	379	QFVCSDGSGQATGQVKSGTIFDNFLI
NFIX	chr19	13192669	CALR	chr19	13054351	1230	409	QFVCSDGSGQATGQVKSGTIFDNFLI
NFIX	chr19	13192669	CALR	chr19	13054351	1254	417	QFVCSDGSGQATGQVKSGTIFDNFLI
NFIX	chr19	13192669	CALR	chr19	13054351	1271	418	QFVCSDGSGQATGQVKSGTIFDNFLI
NFIX	chr19	13192669	CALR	chr19	13054351	1309	416	QFVCSDGSGQATGQVKSGTIFDNFLI
NFIX	chr19	13192669	CALR	chr19	13054351	1331	425	QFVCSDGSGQATGQVKSGTIFDNFLI
NFIX	chr19	13192669	CALR	chr19	13054351	1484	436	QFVCSDGSGQATGQVKSGTIFDNFLI

Top

Potential FusionNeoAntigen Information of NFIX-CALR in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

NFIX-CALR_13192669_13054350.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
NFIX-CALR	chr19	13192669	chr19	13054350	1128	HLA-B15:01	GQVKSGTIF	0.9981	0.7299	12	21
NFIX-CALR	chr19	13192669	chr19	13054350	1128	HLA-B15:25	GQVKSGTIF	0.7768	0.7778	12	21
NFIX-CALR	chr19	13192669	chr19	13054350	1128	HLA-B15:03	GQVKSGTIF	0.443	0.6536	12	21
NFIX-CALR	chr19	13192669	chr19	13054350	1128	HLA-B15:18	GQVKSGTIF	0.3757	0.5724	12	21
NFIX-CALR	chr19	13192669	chr19	13054350	1128	HLA-B13:01	GQVKSGTIF	0.3654	0.861	12	21
NFIX-CALR	chr19	13192669	chr19	13054350	1128	HLA-B39:13	GQVKSGTIF	0.255	0.6904	12	21
NFIX-CALR	chr19	13192669	chr19	13054350	1128	HLA-B15:01	TGQVKSGTIF	0.9858	0.729	11	21
NFIX-CALR	chr19	13192669	chr19	13054350	1128	HLA-B15:03	TGQVKSGTIF	0.9529	0.6414	11	21
NFIX-CALR	chr19	13192669	chr19	13054350	1128	HLA-B15:25	TGQVKSGTIF	0.9222	0.7586	11	21
NFIX-CALR	chr19	13192669	chr19	13054350	1128	HLA-B15:01	ATGQVKSGTIF	0.9964	0.7432	10	21
NFIX-CALR	chr19	13192669	chr19	13054350	1128	HLA-B15:25	ATGQVKSGTIF	0.9864	0.7669	10	21
NFIX-CALR	chr19	13192669	chr19	13054350	1128	HLA-B15:03	ATGQVKSGTIF	0.9693	0.6953	10	21
NFIX-CALR	chr19	13192669	chr19	13054350	1128	HLA-B15:04	GQVKSGTIF	0.9686	0.7711	12	21
NFIX-CALR	chr19	13192669	chr19	13054350	1128	HLA-B15:05	GQVKSGTIF	0.3269	0.7136	12	21
NFIX-CALR	chr19	13192669	chr19	13054350	1128	HLA-B15:05	TGQVKSGTIF	0.8285	0.7017	11	21
NFIX-CALR	chr19	13192669	chr19	13054350	1128	HLA-B15:07	ATGQVKSGTIF	0.9969	0.5164	10	21
NFIX-CALR	chr19	13192669	chr19	13054350	1128	HLA-B15:34	GQVKSGTIF	0.9981	0.7299	12	21
NFIX-CALR	chr19	13192669	chr19	13054350	1128	HLA-B15:125	GQVKSGTIF	0.9981	0.7299	12	21
NFIX-CALR	chr19	13192669	chr19	13054350	1128	HLA-B15:33	GQVKSGTIF	0.9981	0.7299	12	21
NFIX-CALR	chr19	13192669	chr19	13054350	1128	HLA-B15:135	GQVKSGTIF	0.998	0.7514	12	21
NFIX-CALR	chr19	13192669	chr19	13054350	1128	HLA-B15:27	GQVKSGTIF	0.998	0.7755	12	21
NFIX-CALR	chr19	13192669	chr19	13054350	1128	HLA-B15:24	GQVKSGTIF	0.9955	0.7702	12	21
NFIX-CALR	chr19	13192669	chr19	13054350	1128	HLA-B15:50	GQVKSGTIF	0.9943	0.7555	12	21
NFIX-CALR	chr19	13192669	chr19	13054350	1128	HLA-B15:35	GQVKSGTIF	0.974	0.6599	12	21
NFIX-CALR	chr19	13192669	chr19	13054350	1128	HLA-B15:53	GQVKSGTIF	0.9657	0.7193	12	21
NFIX-CALR	chr19	13192669	chr19	13054350	1128	HLA-B15:12	GQVKSGTIF	0.9473	0.7292	12	21
NFIX-CALR	chr19	13192669	chr19	13054350	1128	HLA-B15:54	GQVKSGTIF	0.8458	0.6888	12	21
NFIX-CALR	chr19	13192669	chr19	13054350	1128	HLA-B15:73	GQVKSGTIF	0.8226	0.7027	12	21
NFIX-CALR	chr19	13192669	chr19	13054350	1128	HLA-B15:39	GQVKSGTIF	0.8103	0.7005	12	21
NFIX-CALR	chr19	13192669	chr19	13054350	1128	HLA-B15:30	GQVKSGTIF	0.6355	0.6579	12	21
NFIX-CALR	chr19	13192669	chr19	13054350	1128	HLA-B15:20	GQVKSGTIF	0.3363	0.7601	12	21
NFIX-CALR	chr19	13192669	chr19	13054350	1128	HLA-B35:28	GQVKSGTIF	0.2891	0.7681	12	21
NFIX-CALR	chr19	13192669	chr19	13054350	1128	HLA-B48:02	GQVKSGTIF	0.2566	0.7453	12	21
NFIX-CALR	chr19	13192669	chr19	13054350	1128	HLA-B15:54	TGQVKSGTIF	0.9922	0.6853	11	21
NFIX-CALR	chr19	13192669	chr19	13054350	1128	HLA-B15:53	TGQVKSGTIF	0.9902	0.7103	11	21
NFIX-CALR	chr19	13192669	chr19	13054350	1128	HLA-B15:135	TGQVKSGTIF	0.9872	0.7451	11	21
NFIX-CALR	chr19	13192669	chr19	13054350	1128	HLA-B15:27	TGQVKSGTIF	0.9862	0.758	11	21
NFIX-CALR	chr19	13192669	chr19	13054350	1128	HLA-B15:125	TGQVKSGTIF	0.9858	0.729	11	21
NFIX-CALR	chr19	13192669	chr19	13054350	1128	HLA-B15:33	TGQVKSGTIF	0.9858	0.729	11	21
NFIX-CALR	chr19	13192669	chr19	13054350	1128	HLA-B15:34	TGQVKSGTIF	0.9858	0.729	11	21
NFIX-CALR	chr19	13192669	chr19	13054350	1128	HLA-B15:24	TGQVKSGTIF	0.9847	0.7758	11	21
NFIX-CALR	chr19	13192669	chr19	13054350	1128	HLA-B15:50	TGQVKSGTIF	0.9744	0.7465	11	21
NFIX-CALR	chr19	13192669	chr19	13054350	1128	HLA-B15:12	TGQVKSGTIF	0.9263	0.7075	11	21
NFIX-CALR	chr19	13192669	chr19	13054350	1128	HLA-B15:39	TGQVKSGTIF	0.9236	0.6924	11	21
NFIX-CALR	chr19	13192669	chr19	13054350	1128	HLA-B15:20	TGQVKSGTIF	0.8222	0.7454	11	21
NFIX-CALR	chr19	13192669	chr19	13054350	1128	HLA-B15:35	ATGQVKSGTIF	0.9975	0.659	10	21
NFIX-CALR	chr19	13192669	chr19	13054350	1128	HLA-B15:27	ATGQVKSGTIF	0.9965	0.7624	10	21
NFIX-CALR	chr19	13192669	chr19	13054350	1128	HLA-B15:33	ATGQVKSGTIF	0.9964	0.7432	10	21
NFIX-CALR	chr19	13192669	chr19	13054350	1128	HLA-B15:34	ATGQVKSGTIF	0.9964	0.7432	10	21
NFIX-CALR	chr19	13192669	chr19	13054350	1128	HLA-B15:125	ATGQVKSGTIF	0.9964	0.7432	10	21
NFIX-CALR	chr19	13192669	chr19	13054350	1128	HLA-B15:135	ATGQVKSGTIF	0.9964	0.755	10	21
NFIX-CALR	chr19	13192669	chr19	13054350	1128	HLA-B15:24	ATGQVKSGTIF	0.994	0.772	10	21
NFIX-CALR	chr19	13192669	chr19	13054350	1128	HLA-B15:50	ATGQVKSGTIF	0.9919	0.7657	10	21
NFIX-CALR	chr19	13192669	chr19	13054350	1128	HLA-B15:12	ATGQVKSGTIF	0.9912	0.7123	10	21
NFIX-CALR	chr19	13192669	chr19	13054350	1128	HLA-B15:53	ATGQVKSGTIF	0.9898	0.7191	10	21
NFIX-CALR	chr19	13192669	chr19	13054350	1128	HLA-B15:54	ATGQVKSGTIF	0.9876	0.701	10	21
NFIX-CALR	chr19	13192669	chr19	13054350	1128	HLA-B15:39	ATGQVKSGTIF	0.9861	0.7266	10	21

Top

Potential FusionNeoAntigen Information of NFIX-CALR in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of NFIX-CALR

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
3122	GSGQATGQVKSGTI	NFIX	CALR	chr19	13192669	chr19	13054350	1128

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of NFIX-CALR

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	3122	GSGQATGQVKSGTI	-7.15543	-7.26883
HLA-B14:02	3BVN	3122	GSGQATGQVKSGTI	-4.77435	-5.80965
HLA-B52:01	3W39	3122	GSGQATGQVKSGTI	-6.80875	-6.92215
HLA-B52:01	3W39	3122	GSGQATGQVKSGTI	-4.20386	-5.23916
HLA-A11:01	4UQ2	3122	GSGQATGQVKSGTI	-7.5194	-8.5547
HLA-A11:01	4UQ2	3122	GSGQATGQVKSGTI	-6.9601	-7.0735
HLA-A24:02	5HGA	3122	GSGQATGQVKSGTI	-7.52403	-7.63743
HLA-A24:02	5HGA	3122	GSGQATGQVKSGTI	-5.82433	-6.85963
HLA-B27:05	6PYJ	3122	GSGQATGQVKSGTI	-3.28285	-4.31815
HLA-B44:05	3DX8	3122	GSGQATGQVKSGTI	-5.91172	-6.94702
HLA-B44:05	3DX8	3122	GSGQATGQVKSGTI	-4.24346	-4.35686

Top

Vaccine Design for the FusionNeoAntigens of NFIX-CALR

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
NFIX-CALR	chr19	13192669	chr19	13054350	10	21	ATGQVKSGTIF	ACCGGACAGGTCAAGTCTGGCACCATCTTTGAC
NFIX-CALR	chr19	13192669	chr19	13054350	11	21	TGQVKSGTIF	GGACAGGTCAAGTCTGGCACCATCTTTGAC
NFIX-CALR	chr19	13192669	chr19	13054350	12	21	GQVKSGTIF	CAGGTCAAGTCTGGCACCATCTTTGAC

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of NFIX-CALR

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
OV	NFIX-CALR	chr19	13192669	ENST00000358552	chr19	13054350	ENST00000316448	TCGA-36-1577

Top

Potential target of CAR-T therapy development for NFIX-CALR

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to NFIX-CALR

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to NFIX-CALR

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)