Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:PDSS2-CDYL2

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: PDSS2-CDYL2
	FusionPDB ID: 64080
	FusionGDB2.0 ID: 64080
		Hgene	Tgene
	Gene symbol	PDSS2	CDYL2
	Gene ID	57107	124359
	Gene name	decaprenyl diphosphate synthase subunit 2	chromodomain Y like 2
	Synonyms	C6orf210\|COQ10D3\|COQ1B\|DLP1\|bA59I9.3\|hDLP1	PCCP1
	Cytomap	6q21	16q23.2
	Type of gene	protein-coding	protein-coding
	Description	decaprenyl-diphosphate synthase subunit 2all-trans-decaprenyl-diphosphate synthase subunit 2decaprenyl pyrophosphate synthase subunit 2decaprenyl pyrophosphate synthetase subunit 2prenyl (decaprenyl) diphosphate synthase, subunit 2subunit 2 of decapr	chromodomain Y-like protein 2CDY-like 2chromodomain protein, Y-like 2prostate cancer candidate protein 1, PCCP1
	Modification date	20200313	20200318
	UniProtAcc	.	Q8N8U2 Main function of 5'-partner protein:
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000369031, ENST00000369037, ENST00000453874,	ENST00000562753, ENST00000562812, ENST00000563890, ENST00000566173, ENST00000570137,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	11 X 8 X 6=528	9 X 9 X 3=243
	# samples	13	11
	** MAII score	log2(13/528*10)=-2.02202630633 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(11/243*10)=-1.14345279008112 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: PDSS2 [Title/Abstract] AND CDYL2 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: PDSS2 [Title/Abstract] AND CDYL2 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	PDSS2(107780193)-CDYL2(80654832), # samples:1
Anticipated loss of major functional domain due to fusion event.	PDSS2-CDYL2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. PDSS2-CDYL2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	PDSS2	GO:0006744	ubiquinone biosynthetic process	16262699
Hgene	PDSS2	GO:0008299	isoprenoid biosynthetic process	16262699

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr6:107780193/chr16:80654832)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across PDSS2 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across CDYL2 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000369037	PDSS2	chr6	107780193	-	ENST00000570137	CDYL2	chr16	80654832	-	7743	574	130	1260	376
ENST00000369037	PDSS2	chr6	107780193	-	ENST00000562812	CDYL2	chr16	80654832	-	1733	574	130	1260	376
ENST00000369037	PDSS2	chr6	107780193	-	ENST00000566173	CDYL2	chr16	80654832	-	1733	574	130	1260	376
ENST00000369037	PDSS2	chr6	107780193	-	ENST00000563890	CDYL2	chr16	80654832	-	1733	574	130	1260	376
ENST00000453874	PDSS2	chr6	107780193	-	ENST00000570137	CDYL2	chr16	80654832	-	7736	567	123	1253	376
ENST00000453874	PDSS2	chr6	107780193	-	ENST00000562812	CDYL2	chr16	80654832	-	1726	567	123	1253	376
ENST00000453874	PDSS2	chr6	107780193	-	ENST00000566173	CDYL2	chr16	80654832	-	1726	567	123	1253	376
ENST00000453874	PDSS2	chr6	107780193	-	ENST00000563890	CDYL2	chr16	80654832	-	1726	567	123	1253	376
ENST00000369031	PDSS2	chr6	107780193	-	ENST00000570137	CDYL2	chr16	80654832	-	7744	575	131	1261	376
ENST00000369031	PDSS2	chr6	107780193	-	ENST00000562812	CDYL2	chr16	80654832	-	1734	575	131	1261	376
ENST00000369031	PDSS2	chr6	107780193	-	ENST00000566173	CDYL2	chr16	80654832	-	1734	575	131	1261	376
ENST00000369031	PDSS2	chr6	107780193	-	ENST00000563890	CDYL2	chr16	80654832	-	1734	575	131	1261	376

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000369037	ENST00000570137	PDSS2	chr6	107780193	-	CDYL2	chr16	80654832	-	0.001347922	0.99865216
ENST00000369037	ENST00000562812	PDSS2	chr6	107780193	-	CDYL2	chr16	80654832	-	0.003944537	0.9960555
ENST00000369037	ENST00000566173	PDSS2	chr6	107780193	-	CDYL2	chr16	80654832	-	0.003944537	0.9960555
ENST00000369037	ENST00000563890	PDSS2	chr6	107780193	-	CDYL2	chr16	80654832	-	0.003944537	0.9960555
ENST00000453874	ENST00000570137	PDSS2	chr6	107780193	-	CDYL2	chr16	80654832	-	0.001343096	0.99865687
ENST00000453874	ENST00000562812	PDSS2	chr6	107780193	-	CDYL2	chr16	80654832	-	0.004319546	0.99568045
ENST00000453874	ENST00000566173	PDSS2	chr6	107780193	-	CDYL2	chr16	80654832	-	0.004319546	0.99568045
ENST00000453874	ENST00000563890	PDSS2	chr6	107780193	-	CDYL2	chr16	80654832	-	0.004319546	0.99568045
ENST00000369031	ENST00000570137	PDSS2	chr6	107780193	-	CDYL2	chr16	80654832	-	0.001349314	0.9986507
ENST00000369031	ENST00000562812	PDSS2	chr6	107780193	-	CDYL2	chr16	80654832	-	0.003992024	0.9960079
ENST00000369031	ENST00000566173	PDSS2	chr6	107780193	-	CDYL2	chr16	80654832	-	0.003992024	0.9960079
ENST00000369031	ENST00000563890	PDSS2	chr6	107780193	-	CDYL2	chr16	80654832	-	0.003992024	0.9960079

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for PDSS2-CDYL2

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
PDSS2	chr6	107780193	CDYL2	chr16	80654832	567	89	VPRHHLLGGLLAWSVLQVPGPLESGS
PDSS2	chr6	107780193	CDYL2	chr16	80654832	574	89	VPRHHLLGGLLAWSVLQVPGPLESGS
PDSS2	chr6	107780193	CDYL2	chr16	80654832	575	89	VPRHHLLGGLLAWSVLQVPGPLESGS

Top

Potential FusionNeoAntigen Information of PDSS2-CDYL2 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

PDSS2-CDYL2_107780193_80654832.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
PDSS2-CDYL2	chr6	107780193	chr16	80654832	575	HLA-B51:01	LAWSVLQV	0.9997	0.7939	10	18
PDSS2-CDYL2	chr6	107780193	chr16	80654832	575	HLA-B51:02	LAWSVLQV	0.9995	0.7491	10	18
PDSS2-CDYL2	chr6	107780193	chr16	80654832	575	HLA-A02:22	LLAWSVLQV	0.9978	0.7506	9	18
PDSS2-CDYL2	chr6	107780193	chr16	80654832	575	HLA-A02:11	LLAWSVLQV	0.9958	0.7416	9	18
PDSS2-CDYL2	chr6	107780193	chr16	80654832	575	HLA-A02:21	LLAWSVLQV	0.9957	0.8126	9	18
PDSS2-CDYL2	chr6	107780193	chr16	80654832	575	HLA-A02:24	LLAWSVLQV	0.9957	0.7252	9	18
PDSS2-CDYL2	chr6	107780193	chr16	80654832	575	HLA-A02:30	LLAWSVLQV	0.9957	0.7252	9	18
PDSS2-CDYL2	chr6	107780193	chr16	80654832	575	HLA-A02:67	LLAWSVLQV	0.9957	0.7252	9	18
PDSS2-CDYL2	chr6	107780193	chr16	80654832	575	HLA-A02:60	LLAWSVLQV	0.9956	0.7171	9	18
PDSS2-CDYL2	chr6	107780193	chr16	80654832	575	HLA-A02:16	LLAWSVLQV	0.9953	0.7129	9	18
PDSS2-CDYL2	chr6	107780193	chr16	80654832	575	HLA-A02:27	LLAWSVLQV	0.9952	0.7193	9	18
PDSS2-CDYL2	chr6	107780193	chr16	80654832	575	HLA-A02:13	LLAWSVLQV	0.995	0.7862	9	18
PDSS2-CDYL2	chr6	107780193	chr16	80654832	575	HLA-A02:38	LLAWSVLQV	0.9918	0.6509	9	18
PDSS2-CDYL2	chr6	107780193	chr16	80654832	575	HLA-A02:19	LLAWSVLQV	0.987	0.7543	9	18
PDSS2-CDYL2	chr6	107780193	chr16	80654832	575	HLA-A02:29	LLAWSVLQV	0.9855	0.7266	9	18
PDSS2-CDYL2	chr6	107780193	chr16	80654832	575	HLA-A02:35	LLAWSVLQV	0.9826	0.7434	9	18
PDSS2-CDYL2	chr6	107780193	chr16	80654832	575	HLA-A02:20	LLAWSVLQV	0.9796	0.7359	9	18
PDSS2-CDYL2	chr6	107780193	chr16	80654832	575	HLA-A02:04	LLAWSVLQV	0.9762	0.9052	9	18
PDSS2-CDYL2	chr6	107780193	chr16	80654832	575	HLA-A02:17	LLAWSVLQV	0.9543	0.8904	9	18
PDSS2-CDYL2	chr6	107780193	chr16	80654832	575	HLA-A02:16	GLLAWSVLQV	0.9975	0.7986	8	18
PDSS2-CDYL2	chr6	107780193	chr16	80654832	575	HLA-A02:11	GLLAWSVLQV	0.9969	0.8034	8	18
PDSS2-CDYL2	chr6	107780193	chr16	80654832	575	HLA-A02:30	GLLAWSVLQV	0.9967	0.8013	8	18
PDSS2-CDYL2	chr6	107780193	chr16	80654832	575	HLA-A02:24	GLLAWSVLQV	0.9967	0.8013	8	18
PDSS2-CDYL2	chr6	107780193	chr16	80654832	575	HLA-A02:67	GLLAWSVLQV	0.9967	0.8013	8	18
PDSS2-CDYL2	chr6	107780193	chr16	80654832	575	HLA-A02:60	GLLAWSVLQV	0.9965	0.8047	8	18
PDSS2-CDYL2	chr6	107780193	chr16	80654832	575	HLA-A02:35	GLLAWSVLQV	0.9209	0.8127	8	18
PDSS2-CDYL2	chr6	107780193	chr16	80654832	575	HLA-A02:29	GLLAWSVLQV	0.895	0.8007	8	18
PDSS2-CDYL2	chr6	107780193	chr16	80654832	575	HLA-A02:20	GLLAWSVLQV	0.8781	0.809	8	18
PDSS2-CDYL2	chr6	107780193	chr16	80654832	575	HLA-A02:11	HLLGGLLAWSV	0.9972	0.8096	4	15
PDSS2-CDYL2	chr6	107780193	chr16	80654832	575	HLA-A02:30	HLLGGLLAWSV	0.9971	0.8033	4	15
PDSS2-CDYL2	chr6	107780193	chr16	80654832	575	HLA-A02:67	HLLGGLLAWSV	0.9971	0.8033	4	15
PDSS2-CDYL2	chr6	107780193	chr16	80654832	575	HLA-A02:60	HLLGGLLAWSV	0.9971	0.827	4	15
PDSS2-CDYL2	chr6	107780193	chr16	80654832	575	HLA-A02:22	HLLGGLLAWSV	0.9971	0.844	4	15
PDSS2-CDYL2	chr6	107780193	chr16	80654832	575	HLA-A02:24	HLLGGLLAWSV	0.9971	0.8033	4	15
PDSS2-CDYL2	chr6	107780193	chr16	80654832	575	HLA-A02:27	HLLGGLLAWSV	0.9967	0.8793	4	15
PDSS2-CDYL2	chr6	107780193	chr16	80654832	575	HLA-A02:21	HLLGGLLAWSV	0.9965	0.8504	4	15
PDSS2-CDYL2	chr6	107780193	chr16	80654832	575	HLA-A02:16	HLLGGLLAWSV	0.9955	0.7887	4	15
PDSS2-CDYL2	chr6	107780193	chr16	80654832	575	HLA-A02:13	HLLGGLLAWSV	0.9954	0.9215	4	15
PDSS2-CDYL2	chr6	107780193	chr16	80654832	575	HLA-A02:38	HLLGGLLAWSV	0.989	0.8917	4	15
PDSS2-CDYL2	chr6	107780193	chr16	80654832	575	HLA-A02:04	HLLGGLLAWSV	0.9846	0.9555	4	15
PDSS2-CDYL2	chr6	107780193	chr16	80654832	575	HLA-A02:19	HLLGGLLAWSV	0.9746	0.8494	4	15
PDSS2-CDYL2	chr6	107780193	chr16	80654832	575	HLA-A02:17	HLLGGLLAWSV	0.9732	0.9624	4	15
PDSS2-CDYL2	chr6	107780193	chr16	80654832	575	HLA-A02:35	HLLGGLLAWSV	0.9526	0.826	4	15
PDSS2-CDYL2	chr6	107780193	chr16	80654832	575	HLA-A02:29	HLLGGLLAWSV	0.9161	0.8109	4	15
PDSS2-CDYL2	chr6	107780193	chr16	80654832	575	HLA-A02:20	HLLGGLLAWSV	0.8745	0.8139	4	15
PDSS2-CDYL2	chr6	107780193	chr16	80654832	575	HLA-B51:07	LAWSVLQV	0.9997	0.9924	10	18
PDSS2-CDYL2	chr6	107780193	chr16	80654832	575	HLA-A02:02	LLAWSVLQV	0.9977	0.6979	9	18
PDSS2-CDYL2	chr6	107780193	chr16	80654832	575	HLA-A02:05	LLAWSVLQV	0.9975	0.769	9	18
PDSS2-CDYL2	chr6	107780193	chr16	80654832	575	HLA-A02:01	LLAWSVLQV	0.9957	0.7252	9	18
PDSS2-CDYL2	chr6	107780193	chr16	80654832	575	HLA-A02:07	LLAWSVLQV	0.9955	0.7707	9	18
PDSS2-CDYL2	chr6	107780193	chr16	80654832	575	HLA-A02:01	GLLAWSVLQV	0.9967	0.8013	8	18
PDSS2-CDYL2	chr6	107780193	chr16	80654832	575	HLA-A02:02	HLLGGLLAWSV	0.9974	0.8513	4	15
PDSS2-CDYL2	chr6	107780193	chr16	80654832	575	HLA-A02:01	HLLGGLLAWSV	0.9971	0.8033	4	15
PDSS2-CDYL2	chr6	107780193	chr16	80654832	575	HLA-B51:13	LAWSVLQV	0.9998	0.6938	10	18
PDSS2-CDYL2	chr6	107780193	chr16	80654832	575	HLA-B51:14	LAWSVLQV	0.9997	0.8045	10	18
PDSS2-CDYL2	chr6	107780193	chr16	80654832	575	HLA-B51:09	LAWSVLQV	0.9993	0.8452	10	18
PDSS2-CDYL2	chr6	107780193	chr16	80654832	575	HLA-B51:21	LAWSVLQV	0.9993	0.7747	10	18
PDSS2-CDYL2	chr6	107780193	chr16	80654832	575	HLA-A02:03	LLAWSVLQV	0.9984	0.8347	9	18
PDSS2-CDYL2	chr6	107780193	chr16	80654832	575	HLA-A02:06	LLAWSVLQV	0.9957	0.8126	9	18
PDSS2-CDYL2	chr6	107780193	chr16	80654832	575	HLA-A02:14	LLAWSVLQV	0.9956	0.8265	9	18
PDSS2-CDYL2	chr6	107780193	chr16	80654832	575	HLA-A02:14	HLLGGLLAWSV	0.9966	0.8609	4	15
PDSS2-CDYL2	chr6	107780193	chr16	80654832	575	HLA-A02:06	HLLGGLLAWSV	0.9965	0.8504	4	15
PDSS2-CDYL2	chr6	107780193	chr16	80654832	575	HLA-A02:03	HLLGGLLAWSV	0.9959	0.9118	4	15

Top

Potential FusionNeoAntigen Information of PDSS2-CDYL2 in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of PDSS2-CDYL2

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
4997	LGGLLAWSVLQVPG	PDSS2	CDYL2	chr6	107780193	chr16	80654832	575

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of PDSS2-CDYL2

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	4997	LGGLLAWSVLQVPG	-7.9962	-8.1096
HLA-B14:02	3BVN	4997	LGGLLAWSVLQVPG	-5.70842	-6.74372
HLA-B52:01	3W39	4997	LGGLLAWSVLQVPG	-6.83737	-6.95077
HLA-B52:01	3W39	4997	LGGLLAWSVLQVPG	-4.4836	-5.5189
HLA-A11:01	4UQ2	4997	LGGLLAWSVLQVPG	-10.0067	-10.1201
HLA-A11:01	4UQ2	4997	LGGLLAWSVLQVPG	-9.03915	-10.0745
HLA-A24:02	5HGA	4997	LGGLLAWSVLQVPG	-6.56204	-6.67544
HLA-A24:02	5HGA	4997	LGGLLAWSVLQVPG	-5.42271	-6.45801
HLA-B44:05	3DX8	4997	LGGLLAWSVLQVPG	-7.85648	-8.89178
HLA-B44:05	3DX8	4997	LGGLLAWSVLQVPG	-5.3978	-5.5112
HLA-A02:01	6TDR	4997	LGGLLAWSVLQVPG	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of PDSS2-CDYL2

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
PDSS2-CDYL2	chr6	107780193	chr16	80654832	10	18	LAWSVLQV	CACAGCCAGATCATGAAAGAAGTC
PDSS2-CDYL2	chr6	107780193	chr16	80654832	4	15	HLLGGLLAWSV	TCAGCACCCTCTGCTTACCACAGCCAGATCATG
PDSS2-CDYL2	chr6	107780193	chr16	80654832	8	18	GLLAWSVLQV	GCTTACCACAGCCAGATCATGAAAGAAGTC
PDSS2-CDYL2	chr6	107780193	chr16	80654832	9	18	LLAWSVLQV	TACCACAGCCAGATCATGAAAGAAGTC

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of PDSS2-CDYL2

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
BRCA	PDSS2-CDYL2	chr6	107780193	ENST00000369031	chr16	80654832	ENST00000562812	TCGA-AR-A24L

Top

Potential target of CAR-T therapy development for PDSS2-CDYL2

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to PDSS2-CDYL2

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to PDSS2-CDYL2

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)