FusionNeoAntigen Logo

Home

Download

Statistics

Examples

Help

Contact

Terms of Use

Center for Computational Systems Medicine
leaf

Fusion Gene and Fusion Protein Summary

leaf

Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)

leaf

Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)

leaf

Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)

leaf

Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)

leaf

Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)

leaf

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)

leaf

Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)

leaf

Potential target of CAR-T therapy development

leaf

Information on the samples that have these potential fusion neoantigens

leaf

Fusion Protein Targeting Drugs - (Manual Curation)

leaf

Fusion Protein Related diseases - (Manual Curation)

Fusion Protein:ARNT-CBLB

Fusion Gene and Fusion Protein Summary

check button Fusion gene summary
Fusion partner gene informationFusion gene name: ARNT-CBLB
FusionPDB ID: 6734
FusionGDB2.0 ID: 6734
HgeneTgene
Gene symbol

ARNT

CBLB

Gene ID

375056

868

Gene nameMIA SH3 domain ER export factor 3Cbl proto-oncogene B
SynonymsARNT|D320|TANGO|TANGO1|UNQ6077Cbl-b|Nbla00127|RNF56
Cytomap

1q41

3q13.11

Type of geneprotein-codingprotein-coding
Descriptiontransport and Golgi organization protein 1 homologC219-reactive peptideMIA family member 3, ER export factormelanoma inhibitory activity family, member 3melanoma inhibitory activity protein 3transport and Golgi organization protein 1E3 ubiquitin-protein ligase CBL-BCas-Br-M (murine) ecotropic retroviral transforming sequence bCbl proto-oncogene B, E3 ubiquitin protein ligaseCbl proto-oncogene, E3 ubiquitin protein ligase BRING finger protein 56RING-type E3 ubiquitin transferase
Modification date2020031320200327
UniProtAcc

Q8WYA1

Main function of 5'-partner protein: FUNCTION: Transcriptional activator which forms a core component of the circadian clock. The circadian clock, an internal time-keeping system, regulates various physiological processes through the generation of approximately 24 hour circadian rhythms in gene expression, which are translated into rhythms in metabolism and behavior. It is derived from the Latin roots 'circa' (about) and 'diem' (day) and acts as an important regulator of a wide array of physiological functions including metabolism, sleep, body temperature, blood pressure, endocrine, immune, cardiovascular, and renal function. Consists of two major components: the central clock, residing in the suprachiasmatic nucleus (SCN) of the brain, and the peripheral clocks that are present in nearly every tissue and organ system. Both the central and peripheral clocks can be reset by environmental cues, also known as Zeitgebers (German for 'timegivers'). The predominant Zeitgeber for the central clock is light, which is sensed by retina and signals directly to the SCN. The central clock entrains the peripheral clocks through neuronal and hormonal signals, body temperature and feeding-related cues, aligning all clocks with the external light/dark cycle. Circadian rhythms allow an organism to achieve temporal homeostasis with its environment at the molecular level by regulating gene expression to create a peak of protein expression once every 24 hours to control when a particular physiological process is most active with respect to the solar day. Transcription and translation of core clock components (CLOCK, NPAS2, ARNTL/BMAL1, ARNTL2/BMAL2, PER1, PER2, PER3, CRY1 and CRY2) plays a critical role in rhythm generation, whereas delays imposed by post-translational modifications (PTMs) are important for determining the period (tau) of the rhythms (tau refers to the period of a rhythm and is the length, in time, of one complete cycle). A diurnal rhythm is synchronized with the day/night cycle, while the ultradian and infradian rhythms have a period shorter and longer than 24 hours, respectively. Disruptions in the circadian rhythms contribute to the pathology of cardiovascular diseases, cancer, metabolic syndromes and aging. A transcription/translation feedback loop (TTFL) forms the core of the molecular circadian clock mechanism. Transcription factors, CLOCK or NPAS2 and ARNTL/BMAL1 or ARNTL2/BMAL2, form the positive limb of the feedback loop, act in the form of a heterodimer and activate the transcription of core clock genes and clock-controlled genes (involved in key metabolic processes), harboring E-box elements (5'-CACGTG-3') within their promoters. The core clock genes: PER1/2/3 and CRY1/2 which are transcriptional repressors form the negative limb of the feedback loop and interact with the CLOCK|NPAS2-ARNTL/BMAL1|ARNTL2/BMAL2 heterodimer inhibiting its activity and thereby negatively regulating their own expression. This heterodimer also activates nuclear receptors NR1D1/2 and RORA/B/G, which form a second feedback loop and which activate and repress ARNTL/BMAL1 transcription, respectively. The CLOCK-ARNTL2/BMAL2 heterodimer activates the transcription of SERPINE1/PAI1 and BHLHE40/DEC1. {ECO:0000269|PubMed:11018023, ECO:0000269|PubMed:12738229, ECO:0000269|PubMed:14672706}.

Q13191

Main function of 5'-partner protein: FUNCTION: E3 ubiquitin-protein ligase which accepts ubiquitin from specific E2 ubiquitin-conjugating enzymes, and transfers it to substrates, generally promoting their degradation by the proteasome. Negatively regulates TCR (T-cell receptor), BCR (B-cell receptor) and FCER1 (high affinity immunoglobulin epsilon receptor) signal transduction pathways. In naive T-cells, inhibits VAV1 activation upon TCR engagement and imposes a requirement for CD28 costimulation for proliferation and IL-2 production. Also acts by promoting PIK3R1/p85 ubiquitination, which impairs its recruitment to the TCR and subsequent activation. In activated T-cells, inhibits PLCG1 activation and calcium mobilization upon restimulation and promotes anergy. In B-cells, acts by ubiquitinating SYK and promoting its proteasomal degradation. Slightly promotes SRC ubiquitination. May be involved in EGFR ubiquitination and internalization. May be functionally coupled with the E2 ubiquitin-protein ligase UB2D3. In association with CBL, required for proper feedback inhibition of ciliary platelet-derived growth factor receptor-alpha (PDGFRA) signaling pathway via ubiquitination and internalization of PDGFRA (By similarity). {ECO:0000250|UniProtKB:Q3TTA7, ECO:0000269|PubMed:10022120, ECO:0000269|PubMed:10086340, ECO:0000269|PubMed:11087752, ECO:0000269|PubMed:11526404, ECO:0000269|PubMed:14661060, ECO:0000269|PubMed:20525694}.
Ensembl transtripts involved in fusion geneENST idsENST00000354396, ENST00000358595, 
ENST00000505755, ENST00000515192, 
ENST00000468970, 
ENST00000545639, 
ENST00000394027, ENST00000403724, 
ENST00000405772, ENST00000407712, 
ENST00000264122, 
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)* DoF score18 X 16 X 9=259213 X 14 X 7=1274
# samples 1816
** MAII scorelog2(18/2592*10)=-3.84799690655495
possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs).
DoF>8 and MAII<0
log2(16/1274*10)=-2.99322146736894
possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs).
DoF>8 and MAII<0
Fusion gene context

PubMed: ARNT [Title/Abstract] AND CBLB [Title/Abstract] AND fusion [Title/Abstract]

Fusion neoantigen context

PubMed: ARNT [Title/Abstract] AND CBLB [Title/Abstract] AND neoantigen [Title/Abstract]

Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)ARNT(150849019)-CBLB(105439094), # samples:1
Anticipated loss of major functional domain due to fusion event.ARNT-CBLB seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF.
ARNT-CBLB seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF.
ARNT-CBLB seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.
ARNT-CBLB seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

check button Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez
PartnerGeneGO IDGO termPubMed ID
HgeneARNT

GO:0002687

positive regulation of leukocyte migration

17726152

HgeneARNT

GO:0007162

negative regulation of cell adhesion

17726152

HgeneARNT

GO:0030336

negative regulation of cell migration

17044017

HgeneARNT

GO:0042060

wound healing

17044017



check button Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr1:150849019/chr3:105439094)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.
FGviewer

check buttonRetention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

check buttonFusion gene breakpoints across ARNT (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.
all structure

check buttonFusion gene breakpoints across CBLB (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.
all structure


Top

Fusion Amino Acid Sequences


check buttonFusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.
HenstTenstHgeneHchrHbpHstrandTgeneTchrTbpTstrandSeq length
(transcript)
BP loci
(transcript)
Predicted start
(transcript)
Predicted stop
(transcript)
Seq length
(amino acids)
ENST00000358595ARNTchr1150849019-ENST00000264122CBLBchr3105439094-5481226341971645
ENST00000354396ARNTchr1150849019-ENST00000264122CBLBchr3105439094-52923741782592
ENST00000505755ARNTchr1150849019-ENST00000264122CBLBchr3105439094-53226711812603

check buttonDeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.
HenstTenstHgeneHchrHbpHstrandTgeneTchrTbpTstrandNo-coding scoreCoding score
ENST00000358595ENST00000264122ARNTchr1150849019-CBLBchr3105439094-0.0010839710.99891603
ENST00000354396ENST00000264122ARNTchr1150849019-CBLBchr3105439094-0.001043410.99895656
ENST00000505755ENST00000264122ARNTchr1150849019-CBLBchr3105439094-0.0010346570.9989654

check button Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for ARNT-CBLB

check button +/-13 AA sequence from the breakpoints of the fusion protein sequences.
HgeneHchrHbpTgeneTchrTbpLength(fusion protein)BP in fusion proteinPeptide
ARNTchr1150849019CBLBchr310543909422664WHLRPWRRLLPTPESDGQGCPFCRCE
ARNTchr1150849019CBLBchr31054390946722WHLRPWRRLLPTPESDGQGCPFCRCE

Top

Potential FusionNeoAntigen Information of ARNT-CBLB in HLA I

check button Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.
ARNT-CBLB_150849019_105439094.msa

check button Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)
Fusion geneHchrHbpTgeneTchrTbpHLA IFusionNeoAntigen peptideBinding scoreImmunogenic scoreNeoantigen start (at BP 13)Neoantigen end (at BP 13)
ARNT-CBLBchr1150849019chr3105439094226HLA-B35:08TPESDGQGCPF0.95590.6011122
ARNT-CBLBchr1150849019chr3105439094226HLA-B27:14RRLLPTPES0.99870.7166615
ARNT-CBLBchr1150849019chr3105439094226HLA-B73:01RRLLPTPES0.95460.9126615

Top

Potential FusionNeoAntigen Information of ARNT-CBLB in HLA II

check button Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

check button Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).
Fusion geneHchrHbpTgeneTchrTbpHLA IIFusionNeoAntigen peptideNeoantigen start (at BP 13)Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of ARNT-CBLB

check button3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.
File nameBPseqHgeneTgeneHchrHbpTchrTbpAAlen
8174RRLLPTPESDGQGCARNTCBLBchr1150849019chr3105439094226

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of ARNT-CBLB

check buttonVirtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.
HLA allelePDB IDFile nameBPseqDocking scoreGlide score
HLA-B14:023BVN8174RRLLPTPESDGQGC-7.15543-7.26883
HLA-B14:023BVN8174RRLLPTPESDGQGC-4.77435-5.80965
HLA-B52:013W398174RRLLPTPESDGQGC-6.80875-6.92215
HLA-B52:013W398174RRLLPTPESDGQGC-4.20386-5.23916
HLA-A11:014UQ28174RRLLPTPESDGQGC-7.5194-8.5547
HLA-A11:014UQ28174RRLLPTPESDGQGC-6.9601-7.0735
HLA-A24:025HGA8174RRLLPTPESDGQGC-7.52403-7.63743
HLA-A24:025HGA8174RRLLPTPESDGQGC-5.82433-6.85963
HLA-B27:056PYJ8174RRLLPTPESDGQGC-3.28285-4.31815
HLA-B44:053DX88174RRLLPTPESDGQGC-5.91172-6.94702
HLA-B44:053DX88174RRLLPTPESDGQGC-4.24346-4.35686

Top

Vaccine Design for the FusionNeoAntigens of ARNT-CBLB

check button mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.
Fusion geneHchrHbpTchrTbpStart in +/-13AAEnd in +/-13AAFusionNeoAntigen peptide sequenceFusionNeoAntigen RNA sequence
ARNT-CBLBchr1150849019chr31054390941122TPESDGQGCPFACCCCGGAGTCGGATGGTCAGGGCTGCCCTTTC
ARNT-CBLBchr1150849019chr3105439094615RRLLPTPESCGGCGACTACTGCCAACCCCGGAGTCG

check button mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.
Fusion geneHchrHbpTchrTbpStart in +/-13AAEnd in +/-13AAFusionNeoAntigen peptideFusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of ARNT-CBLB

check button These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.
Cancer typeFusion geneHchrHbpHenstTchrTbpTenstSample
LUADARNT-CBLBchr1150849019ENST00000358595chr3105439094ENST00000264122TCGA-O1-A52J-01A

Top

Potential target of CAR-T therapy development for ARNT-CBLB

check button Predicted 3D structure. We used RoseTTAFold.

check buttonRetention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features


* Minus value of BPloci means that the break point is located before the CDS.
- In-frame and retained 'Transmembrane'.
PartnerGeneHbpTbpENSTStrandBPexonTotalExonProtein feature loci*BPlociTotalLenProtein featureProtein feature note

check button Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.
HgeneHchrHbpHenstTgeneTchrTbpTenstDeepLoc result

Top

Related Drugs to ARNT-CBLB

check button Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)
HgeneTgeneDrugSourcePMID

Top

Related Diseases to ARNT-CBLB

check button Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)
HgeneTgeneDiseaseSourcePMID

check button Diseases associated with fusion partners.
(DisGeNet 4.0)
PartnerGeneDisease IDDisease name# pubmedsSource