|
|||||||
|
Fusion Protein:PPARG-CRYBA4 |
Fusion Gene and Fusion Protein Summary |
 Fusion gene summary |
| Fusion partner gene information | Fusion gene name: PPARG-CRYBA4 | FusionPDB ID: 67349 | FusionGDB2.0 ID: 67349 | Hgene | Tgene | Gene symbol | PPARG | CRYBA4 | Gene ID | 5468 | 1413 |
| Gene name | peroxisome proliferator activated receptor gamma | crystallin beta A4 | |
| Synonyms | CIMT1|GLM1|NR1C3|PPARG1|PPARG2|PPARgamma | CTRCT23|CYRBA4|MCOPCT4 | |
| Cytomap | 3p25.2 | 22q12.1 | |
| Type of gene | protein-coding | protein-coding | |
| Description | peroxisome proliferator-activated receptor gammaPPAR-gammanuclear receptor subfamily 1 group C member 3peroxisome proliferator-activated nuclear receptor gamma variant 1 | beta-crystallin A4beta crystallin A4 chain transcript PSbeta crystallin alpha 4 chainbeta-A4 crystallincrystallin, beta polypeptide A4eye lens structural protein | |
| Modification date | 20200329 | 20200328 | |
| UniProtAcc | P37231 Main function of 5'-partner protein: FUNCTION: Nuclear receptor that binds peroxisome proliferators such as hypolipidemic drugs and fatty acids. Once activated by a ligand, the nuclear receptor binds to DNA specific PPAR response elements (PPRE) and modulates the transcription of its target genes, such as acyl-CoA oxidase. It therefore controls the peroxisomal beta-oxidation pathway of fatty acids. Key regulator of adipocyte differentiation and glucose homeostasis. ARF6 acts as a key regulator of the tissue-specific adipocyte P2 (aP2) enhancer. Acts as a critical regulator of gut homeostasis by suppressing NF-kappa-B-mediated proinflammatory responses. Plays a role in the regulation of cardiovascular circadian rhythms by regulating the transcription of ARNTL/BMAL1 in the blood vessels (By similarity). {ECO:0000250|UniProtKB:P37238, ECO:0000269|PubMed:16150867, ECO:0000269|PubMed:20829347, ECO:0000269|PubMed:23525231, ECO:0000269|PubMed:9065481}.; FUNCTION: (Microbial infection) Upon treatment with M.tuberculosis or its lipoprotein LpqH, phosphorylation of MAPK p38 and IL-6 production are modulated, probably via this protein. {ECO:0000269|PubMed:25504154}. | P53673 Main function of 5'-partner protein: FUNCTION: Crystallins are the dominant structural components of the vertebrate eye lens. | |
| Ensembl transtripts involved in fusion gene | ENST ids | ENST00000287820, ENST00000309576, ENST00000397000, ENST00000397010, ENST00000397012, ENST00000397015, ENST00000397026, ENST00000539812, | ENST00000466315, ENST00000354760, |
| Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 7 X 9 X 5=315 | 3 X 3 X 3=27 |
| # samples | 13 | 3 | |
| ** MAII score | log2(13/315*10)=-1.27684020535882 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(3/27*10)=0.15200309344505 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0 | |
| Fusion gene context | PubMed: PPARG [Title/Abstract] AND CRYBA4 [Title/Abstract] AND fusion [Title/Abstract] | ||
| Fusion neoantigen context | PubMed: PPARG [Title/Abstract] AND CRYBA4 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
| Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | PPARG(12422990)-CRYBA4(27019198), # samples:1 | ||
| Anticipated loss of major functional domain due to fusion event. | PPARG-CRYBA4 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. PPARG-CRYBA4 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. PPARG-CRYBA4 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. PPARG-CRYBA4 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. | ||
| * DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
| Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Partner | Gene | GO ID | GO term | PubMed ID |
| Hgene | PPARG | GO:0000122 | negative regulation of transcription by RNA polymerase II | 12700342 |
| Hgene | PPARG | GO:0006919 | activation of cysteine-type endopeptidase activity involved in apoptotic process | 18293083 |
| Hgene | PPARG | GO:0007165 | signal transduction | 9568716 |
| Hgene | PPARG | GO:0010742 | macrophage derived foam cell differentiation | 26504087 |
| Hgene | PPARG | GO:0010745 | negative regulation of macrophage derived foam cell differentiation | 19114110 |
| Hgene | PPARG | GO:0010871 | negative regulation of receptor biosynthetic process | 12700342 |
| Hgene | PPARG | GO:0010887 | negative regulation of cholesterol storage | 19114110 |
| Hgene | PPARG | GO:0010891 | negative regulation of sequestering of triglyceride | 12700342 |
| Hgene | PPARG | GO:0016525 | negative regulation of angiogenesis | 28566713 |
| Hgene | PPARG | GO:0030224 | monocyte differentiation | 9568716 |
| Hgene | PPARG | GO:0032526 | response to retinoic acid | 16239304 |
| Hgene | PPARG | GO:0042953 | lipoprotein transport | 9568716 |
| Hgene | PPARG | GO:0043537 | negative regulation of blood vessel endothelial cell migration | 28566713 |
| Hgene | PPARG | GO:0045713 | low-density lipoprotein particle receptor biosynthetic process | 9568716 |
| Hgene | PPARG | GO:0045944 | positive regulation of transcription by RNA polymerase II | 9568715|12700342|16239304|17611579 |
| Hgene | PPARG | GO:0048469 | cell maturation | 9568716 |
| Hgene | PPARG | GO:0048662 | negative regulation of smooth muscle cell proliferation | 20622039 |
| Hgene | PPARG | GO:0051091 | positive regulation of DNA-binding transcription factor activity | 18293083 |
| Hgene | PPARG | GO:0061614 | pri-miRNA transcription by RNA polymerase II | 28566713 |
| Hgene | PPARG | GO:0071404 | cellular response to low-density lipoprotein particle stimulus | 9568716 |
| Hgene | PPARG | GO:1904706 | negative regulation of vascular smooth muscle cell proliferation | 28522568 |
| Four levels of functional features of fusion genes Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr3:12422990/chr22:27019198) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
 |
| Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here. |
| Fusion gene breakpoints across PPARG (5'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
| Fusion gene breakpoints across CRYBA4 (3'-gene) * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
Top |
Fusion Amino Acid Sequences |
| Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
| ENST00000397010 | PPARG | chr3 | 12422990 | + | ENST00000354760 | CRYBA4 | chr22 | 27019198 | + | 1517 | 780 | 1358 | 369 | 329 |
| ENST00000309576 | PPARG | chr3 | 12422990 | + | ENST00000354760 | CRYBA4 | chr22 | 27019198 | + | 1370 | 633 | 1211 | 222 | 329 |
| ENST00000397015 | PPARG | chr3 | 12422990 | + | ENST00000354760 | CRYBA4 | chr22 | 27019198 | + | 1255 | 518 | 122 | 1069 | 315 |
| ENST00000397012 | PPARG | chr3 | 12422990 | + | ENST00000354760 | CRYBA4 | chr22 | 27019198 | + | 1506 | 769 | 1347 | 358 | 329 |
| ENST00000397026 | PPARG | chr3 | 12422990 | + | ENST00000354760 | CRYBA4 | chr22 | 27019198 | + | 1534 | 797 | 1375 | 395 | 326 |
| ENST00000397000 | PPARG | chr3 | 12422990 | + | ENST00000354760 | CRYBA4 | chr22 | 27019198 | + | 1201 | 464 | 68 | 1015 | 315 |
| ENST00000539812 | PPARG | chr3 | 12422990 | + | ENST00000354760 | CRYBA4 | chr22 | 27019198 | + | 1201 | 464 | 68 | 1015 | 315 |
| ENST00000287820 | PPARG | chr3 | 12422990 | + | ENST00000354760 | CRYBA4 | chr22 | 27019198 | + | 1338 | 601 | 121 | 1152 | 343 |
| DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated. |
| Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
| ENST00000397010 | ENST00000354760 | PPARG | chr3 | 12422990 | + | CRYBA4 | chr22 | 27019198 | + | 0.010919459 | 0.98908055 |
| ENST00000309576 | ENST00000354760 | PPARG | chr3 | 12422990 | + | CRYBA4 | chr22 | 27019198 | + | 0.009764364 | 0.9902356 |
| ENST00000397015 | ENST00000354760 | PPARG | chr3 | 12422990 | + | CRYBA4 | chr22 | 27019198 | + | 0.009794493 | 0.99020547 |
| ENST00000397012 | ENST00000354760 | PPARG | chr3 | 12422990 | + | CRYBA4 | chr22 | 27019198 | + | 0.005357375 | 0.9946426 |
| ENST00000397026 | ENST00000354760 | PPARG | chr3 | 12422990 | + | CRYBA4 | chr22 | 27019198 | + | 0.003373044 | 0.996627 |
| ENST00000397000 | ENST00000354760 | PPARG | chr3 | 12422990 | + | CRYBA4 | chr22 | 27019198 | + | 0.009976292 | 0.9900238 |
| ENST00000539812 | ENST00000354760 | PPARG | chr3 | 12422990 | + | CRYBA4 | chr22 | 27019198 | + | 0.009976292 | 0.9900238 |
| ENST00000287820 | ENST00000354760 | PPARG | chr3 | 12422990 | + | CRYBA4 | chr22 | 27019198 | + | 0.003349697 | 0.9966503 |
| Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones. |
Get the fusion protein sequences from here. |
| Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for PPARG-CRYBA4 |
| +/-13 AA sequence from the breakpoints of the fusion protein sequences. |
| Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
| PPARG | chr3 | 12422990 | CRYBA4 | chr22 | 27019198 | 464 | 132 | GFHYGVHACEGCKMVVWDEDGFQGRR |
| PPARG | chr3 | 12422990 | CRYBA4 | chr22 | 27019198 | 518 | 132 | GFHYGVHACEGCKMVVWDEDGFQGRR |
| PPARG | chr3 | 12422990 | CRYBA4 | chr22 | 27019198 | 601 | 160 | GFHYGVHACEGCKMVVWDEDGFQGRR |
Top |
Potential FusionNeoAntigen Information of PPARG-CRYBA4 in HLA I |
| Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| PPARG-CRYBA4_12422990_27019198.msa |
| Potential FusionNeoAntigen Information * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
| PPARG-CRYBA4 | chr3 | 12422990 | chr22 | 27019198 | 601 | HLA-B38:01 | VHACEGCKM | 0.9296 | 0.9877 | 5 | 14 |
| PPARG-CRYBA4 | chr3 | 12422990 | chr22 | 27019198 | 601 | HLA-B15:10 | VHACEGCKM | 0.625 | 0.6613 | 5 | 14 |
| PPARG-CRYBA4 | chr3 | 12422990 | chr22 | 27019198 | 601 | HLA-B57:01 | HACEGCKMVVW | 1 | 0.9933 | 6 | 17 |
| PPARG-CRYBA4 | chr3 | 12422990 | chr22 | 27019198 | 601 | HLA-B58:01 | HACEGCKMVVW | 0.9996 | 0.99 | 6 | 17 |
| PPARG-CRYBA4 | chr3 | 12422990 | chr22 | 27019198 | 601 | HLA-B39:05 | VHACEGCKM | 0.9178 | 0.9611 | 5 | 14 |
| PPARG-CRYBA4 | chr3 | 12422990 | chr22 | 27019198 | 601 | HLA-B38:05 | VHACEGCKM | 0.9296 | 0.9877 | 5 | 14 |
| PPARG-CRYBA4 | chr3 | 12422990 | chr22 | 27019198 | 601 | HLA-B15:09 | VHACEGCKM | 0.6271 | 0.8236 | 5 | 14 |
| PPARG-CRYBA4 | chr3 | 12422990 | chr22 | 27019198 | 601 | HLA-B39:11 | VHACEGCKM | 0.2169 | 0.955 | 5 | 14 |
| PPARG-CRYBA4 | chr3 | 12422990 | chr22 | 27019198 | 601 | HLA-B57:10 | HACEGCKMVVW | 1 | 0.9933 | 6 | 17 |
Top |
Potential FusionNeoAntigen Information of PPARG-CRYBA4 in HLA II |
| Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific. |
| Potential FusionNeoAntigen Information * We used NetMHCIIpan v4.1 (%rank<0.5). |
| Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of PPARG-CRYBA4 |
| 3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
| File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
| 3263 | HACEGCKMVVWDED | PPARG | CRYBA4 | chr3 | 12422990 | chr22 | 27019198 | 601 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of PPARG-CRYBA4 |
| Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens * We used Glide to predict the interaction between HLAs and neoantigens. |
| HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
| HLA-B53:01 | 1A1O | 3263 | HACEGCKMVVWDED | -3.20963 | -4.24493 |
| HLA-B51:01 | 1E28 | 3263 | HACEGCKMVVWDED | -4.71049 | -4.82389 |
| HLA-B51:01 | 1E28 | 3263 | HACEGCKMVVWDED | -2.41218 | -3.44748 |
| HLA-B57:03 | 2BVO | 3263 | HACEGCKMVVWDED | -1.15793 | -2.19323 |
| HLA-A03:01 | 2XPG | 3263 | HACEGCKMVVWDED | -2.82905 | -3.86435 |
| HLA-B14:02 | 3BVN | 3263 | HACEGCKMVVWDED | -6.01624 | -6.12964 |
| HLA-B14:02 | 3BVN | 3263 | HACEGCKMVVWDED | -3.0101 | -4.0454 |
| HLA-B44:03 | 3DX7 | 3263 | HACEGCKMVVWDED | 0.0456146 | -0.989685 |
| HLA-B52:01 | 3W39 | 3263 | HACEGCKMVVWDED | -5.58746 | -5.70086 |
| HLA-B52:01 | 3W39 | 3263 | HACEGCKMVVWDED | -3.59213 | -4.62743 |
| HLA-B18:01 | 4JQV | 3263 | HACEGCKMVVWDED | -3.3293 | -3.4427 |
| HLA-B18:01 | 4JQV | 3263 | HACEGCKMVVWDED | -0.305763 | -1.34106 |
| HLA-A11:01 | 4UQ2 | 3263 | HACEGCKMVVWDED | -8.33749 | -8.45089 |
| HLA-A11:01 | 4UQ2 | 3263 | HACEGCKMVVWDED | -6.15985 | -7.19515 |
| HLA-A24:02 | 5HGA | 3263 | HACEGCKMVVWDED | -5.17069 | -6.20599 |
| HLA-A24:02 | 5HGA | 3263 | HACEGCKMVVWDED | -4.18377 | -4.29717 |
| HLA-B57:01 | 5VUD | 3263 | HACEGCKMVVWDED | -1.89423 | -2.92953 |
| HLA-B27:05 | 6PYJ | 3263 | HACEGCKMVVWDED | -2.66447 | -3.69977 |
| HLA-B27:05 | 6PYJ | 3263 | HACEGCKMVVWDED | -2.44586 | -2.55926 |
| HLA-B27:03 | 6PZ5 | 3263 | HACEGCKMVVWDED | -5.44487 | -5.55827 |
| HLA-B27:03 | 6PZ5 | 3263 | HACEGCKMVVWDED | -3.87227 | -4.90757 |
| HLA-B44:05 | 3DX8 | 3263 | HACEGCKMVVWDED | -5.01764 | -5.13104 |
| HLA-B44:05 | 3DX8 | 3263 | HACEGCKMVVWDED | -2.6392 | -3.6745 |
| HLA-B44:02 | 1M6O | 3263 | HACEGCKMVVWDED | -6.36013 | -6.47353 |
| HLA-B44:02 | 1M6O | 3263 | HACEGCKMVVWDED | -4.88756 | -5.92286 |
| HLA-B07:02 | 5EO0 | 3263 | HACEGCKMVVWDED | -4.6629 | -4.7763 |
| HLA-B07:02 | 5EO0 | 3263 | HACEGCKMVVWDED | -4.00587 | -5.04117 |
| HLA-A02:01 | 6TDR | 3263 | HACEGCKMVVWDED | -4.04667 | -4.16007 |
| HLA-A02:01 | 6TDR | 3263 | HACEGCKMVVWDED | -1.46854 | -2.50384 |
Top |
Vaccine Design for the FusionNeoAntigens of PPARG-CRYBA4 |
| mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
| PPARG-CRYBA4 | chr3 | 12422990 | chr22 | 27019198 | 5 | 14 | VHACEGCKM | GTTCATGCTTGTGAAGGATGCAAGATG |
| PPARG-CRYBA4 | chr3 | 12422990 | chr22 | 27019198 | 6 | 17 | HACEGCKMVVW | CATGCTTGTGAAGGATGCAAGATGGTGGTGTGG |
| mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs. |
| Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of PPARG-CRYBA4 |
| These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens. |
| Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
| BLCA | PPARG-CRYBA4 | chr3 | 12422990 | ENST00000287820 | chr22 | 27019198 | ENST00000354760 | TCGA-HQ-A2OE-01A |
Top |
Potential target of CAR-T therapy development for PPARG-CRYBA4 |
| Predicted 3D structure. We used RoseTTAFold. |
| Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features * Minus value of BPloci means that the break point is located before the CDS. |
| - In-frame and retained 'Transmembrane'. |
| Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
| Subcellular localization prediction of the transmembrane domain retained fusion proteins * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
| Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to PPARG-CRYBA4 |
| Drugs used for this fusion-positive patient. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to PPARG-CRYBA4 |
| Diseases that have this fusion gene. (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
| Hgene | Tgene | Disease | Source | PMID |
| Diseases associated with fusion partners. (DisGeNet 4.0) |
| Partner | Gene | Disease ID | Disease name | # pubmeds | Source |
| Hgene | PPARG | C0011860 | Diabetes Mellitus, Non-Insulin-Dependent | 6 | CTD_human;GENOMICS_ENGLAND |
| Hgene | PPARG | C0238463 | Papillary thyroid carcinoma | 4 | ORPHANET |
| Hgene | PPARG | C0002152 | Alloxan Diabetes | 3 | CTD_human |
| Hgene | PPARG | C0002395 | Alzheimer's Disease | 3 | CTD_human |
| Hgene | PPARG | C0011265 | Presenile dementia | 3 | CTD_human |
| Hgene | PPARG | C0011853 | Diabetes Mellitus, Experimental | 3 | CTD_human |
| Hgene | PPARG | C0020538 | Hypertensive disease | 3 | CTD_human |
| Hgene | PPARG | C0021655 | Insulin Resistance | 3 | CTD_human |
| Hgene | PPARG | C0022660 | Kidney Failure, Acute | 3 | CTD_human |
| Hgene | PPARG | C0028754 | Obesity | 3 | CTD_human;GENOMICS_ENGLAND;UNIPROT |
| Hgene | PPARG | C0035126 | Reperfusion Injury | 3 | CTD_human |
| Hgene | PPARG | C0038433 | Streptozotocin Diabetes | 3 | CTD_human |
| Hgene | PPARG | C0276496 | Familial Alzheimer Disease (FAD) | 3 | CTD_human |
| Hgene | PPARG | C0494463 | Alzheimer Disease, Late Onset | 3 | CTD_human |
| Hgene | PPARG | C0546126 | Acute Confusional Senile Dementia | 3 | CTD_human |
| Hgene | PPARG | C0750900 | Alzheimer's Disease, Focal Onset | 3 | CTD_human |
| Hgene | PPARG | C0750901 | Alzheimer Disease, Early Onset | 3 | CTD_human |
| Hgene | PPARG | C0920563 | Insulin Sensitivity | 3 | CTD_human |
| Hgene | PPARG | C1565662 | Acute Kidney Insufficiency | 3 | CTD_human |
| Hgene | PPARG | C1720861 | Familial Partial Lipodystrophy, Type 3 | 3 | CTD_human;GENOMICS_ENGLAND;ORPHANET;UNIPROT |
| Hgene | PPARG | C2609414 | Acute kidney injury | 3 | CTD_human |
| Hgene | PPARG | C0021368 | Inflammation | 2 | CTD_human |
| Hgene | PPARG | C0022116 | Ischemia | 2 | CTD_human |
| Hgene | PPARG | C0024623 | Malignant neoplasm of stomach | 2 | CTD_human |
| Hgene | PPARG | C0025202 | melanoma | 2 | CTD_human |
| Hgene | PPARG | C0030297 | Pancreatic Neoplasm | 2 | CTD_human |
| Hgene | PPARG | C0038356 | Stomach Neoplasms | 2 | CTD_human |
| Hgene | PPARG | C0346647 | Malignant neoplasm of pancreas | 2 | CTD_human |
| Hgene | PPARG | C1708349 | Hereditary Diffuse Gastric Cancer | 2 | CTD_human |
| Hgene | PPARG | C0001418 | Adenocarcinoma | 1 | CTD_human |
| Hgene | PPARG | C0004153 | Atherosclerosis | 1 | CTD_human |
| Hgene | PPARG | C0004763 | Barrett Esophagus | 1 | CTD_human |
| Hgene | PPARG | C0007102 | Malignant tumor of colon | 1 | CTD_human;UNIPROT |
| Hgene | PPARG | C0009375 | Colonic Neoplasms | 1 | CTD_human |
| Hgene | PPARG | C0009402 | Colorectal Carcinoma | 1 | CTD_human |
| Hgene | PPARG | C0009404 | Colorectal Neoplasms | 1 | CTD_human |
| Hgene | PPARG | C0010346 | Crohn Disease | 1 | CTD_human |
| Hgene | PPARG | C0011849 | Diabetes Mellitus | 1 | CTD_human |
| Hgene | PPARG | C0011859 | Lipoatrophic Diabetes Mellitus | 1 | ORPHANET |
| Hgene | PPARG | C0011881 | Diabetic Nephropathy | 1 | CTD_human |
| Hgene | PPARG | C0017658 | Glomerulonephritis | 1 | CTD_human |
| Hgene | PPARG | C0017667 | Nodular glomerulosclerosis | 1 | CTD_human |
| Hgene | PPARG | C0018801 | Heart failure | 1 | CTD_human |
| Hgene | PPARG | C0018802 | Congestive heart failure | 1 | CTD_human |
| Hgene | PPARG | C0023212 | Left-Sided Heart Failure | 1 | CTD_human |
| Hgene | PPARG | C0023645 | Lichen planus follicularis | 1 | GENOMICS_ENGLAND |
| Hgene | PPARG | C0023794 | Lipoidosis | 1 | CTD_human |
| Hgene | PPARG | C0023903 | Liver neoplasms | 1 | CTD_human |
| Hgene | PPARG | C0025517 | Metabolic Diseases | 1 | CTD_human |
| Hgene | PPARG | C0027746 | Nerve Degeneration | 1 | CTD_human |
| Hgene | PPARG | C0029408 | Degenerative polyarthritis | 1 | CTD_human |
| Hgene | PPARG | C0030246 | Pustulosis of Palms and Soles | 1 | CTD_human |
| Hgene | PPARG | C0030625 | Passive Cutaneous Anaphylaxis | 1 | GENOMICS_ENGLAND |
| Hgene | PPARG | C0033860 | Psoriasis | 1 | CTD_human |
| Hgene | PPARG | C0035078 | Kidney Failure | 1 | CTD_human |
| Hgene | PPARG | C0038525 | Subarachnoid Hemorrhage | 1 | CTD_human |
| Hgene | PPARG | C0040136 | Thyroid Neoplasm | 1 | CTD_human |
| Hgene | PPARG | C0079772 | T-Cell Lymphoma | 1 | CTD_human |
| Hgene | PPARG | C0085278 | Antiphospholipid Syndrome | 1 | CTD_human |
| Hgene | PPARG | C0085413 | Polycystic Kidney, Autosomal Dominant | 1 | CTD_human |
| Hgene | PPARG | C0086743 | Osteoarthrosis Deformans | 1 | CTD_human |
| Hgene | PPARG | C0086873 | Pseudopelade | 1 | GENOMICS_ENGLAND |
| Hgene | PPARG | C0151468 | Thyroid Gland Follicular Adenoma | 1 | CTD_human |
| Hgene | PPARG | C0156147 | Crohn's disease of large bowel | 1 | CTD_human |
| Hgene | PPARG | C0205641 | Adenocarcinoma, Basal Cell | 1 | CTD_human |
| Hgene | PPARG | C0205642 | Adenocarcinoma, Oxyphilic | 1 | CTD_human |
| Hgene | PPARG | C0205643 | Carcinoma, Cribriform | 1 | CTD_human |
| Hgene | PPARG | C0205644 | Carcinoma, Granular Cell | 1 | CTD_human |
| Hgene | PPARG | C0205645 | Adenocarcinoma, Tubular | 1 | CTD_human |
| Hgene | PPARG | C0206726 | gliosarcoma | 1 | ORPHANET |
| Hgene | PPARG | C0221032 | Familial generalized lipodystrophy | 1 | ORPHANET |
| Hgene | PPARG | C0221406 | Pituitary-dependent Cushing's disease | 1 | CTD_human |
| Hgene | PPARG | C0235527 | Heart Failure, Right-Sided | 1 | CTD_human |
| Hgene | PPARG | C0236811 | Chronobiology Disorders | 1 | CTD_human |
| Hgene | PPARG | C0242339 | Dyslipidemias | 1 | CTD_human |
| Hgene | PPARG | C0242488 | Acute Lung Injury | 1 | CTD_human |
| Hgene | PPARG | C0267380 | Crohn's disease of the ileum | 1 | CTD_human |
| Hgene | PPARG | C0270192 | Perinatal Subarachnoid Hemorrhage | 1 | CTD_human |
| Hgene | PPARG | C0271694 | Familial partial lipodystrophy | 1 | CTD_human |
| Hgene | PPARG | C0282548 | Leukostasis | 1 | CTD_human |
| Hgene | PPARG | C0334588 | Giant Cell Glioblastoma | 1 | ORPHANET |
| Hgene | PPARG | C0345904 | Malignant neoplasm of liver | 1 | CTD_human |
| Hgene | PPARG | C0472383 | Subarachnoid Hemorrhage, Spontaneous | 1 | CTD_human |
| Hgene | PPARG | C0525045 | Mood Disorders | 1 | PSYGENET |
| Hgene | PPARG | C0549473 | Thyroid carcinoma | 1 | CTD_human |
| Hgene | PPARG | C0598784 | Dyslipoproteinemias | 1 | CTD_human |
| Hgene | PPARG | C0678202 | Regional enteritis | 1 | CTD_human |
| Hgene | PPARG | C0751220 | Inappropriate ACTH Secretion Syndrome | 1 | CTD_human |
| Hgene | PPARG | C0751530 | Subarachnoid Hemorrhage, Aneurysmal | 1 | CTD_human |
| Hgene | PPARG | C0795688 | Subarachnoid Hemorrhage, Intracranial | 1 | CTD_human |
| Hgene | PPARG | C0813142 | Circadian Rhythm Disorders | 1 | CTD_human |
| Hgene | PPARG | C0887800 | Psychogenic Inversion of Circadian Rhythm | 1 | CTD_human |
| Hgene | PPARG | C0887850 | Polycystic Kidney, Type 1 Autosomal Dominant Disease | 1 | CTD_human |
| Hgene | PPARG | C0949272 | IIeocolitis | 1 | CTD_human |
| Hgene | PPARG | C1258085 | Barrett Epithelium | 1 | CTD_human |
| Hgene | PPARG | C1563937 | Atherogenesis | 1 | CTD_human |
| Hgene | PPARG | C1565489 | Renal Insufficiency | 1 | CTD_human |
| Hgene | PPARG | C1704377 | Bright Disease | 1 | CTD_human |
| Hgene | PPARG | C1720859 | Familial Partial Lipodystrophy, Type 1 | 1 | CTD_human |
| Hgene | PPARG | C1720860 | Familial Partial Lipodystrophy, Type 2 | 1 | CTD_human |
| Hgene | PPARG | C1959583 | Myocardial Failure | 1 | CTD_human |
| Hgene | PPARG | C1961112 | Heart Decompensation | 1 | CTD_human |
| Hgene | PPARG | C2239176 | Liver carcinoma | 1 | CTD_human |
| Hgene | PPARG | C2751306 | Polycystic kidney disease, type 2 | 1 | CTD_human |
| Hgene | PPARG | C2931367 | Thyroid cancer, follicular | 1 | CTD_human |
| Hgene | PPARG | C2936846 | Scarring alopecia | 1 | GENOMICS_ENGLAND |
Copyright 2023-PresentThe University of Texas Health Science Center at Houston (UTHealth)
Web File Viewing | Emergency Information
Campus Carry|Site Policies