![]() |
|||||||
|
Fusion Protein:SMAD2-C10orf90 |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: SMAD2-C10orf90 | FusionPDB ID: 83766 | FusionGDB2.0 ID: 83766 | Hgene | Tgene | Gene symbol | SMAD2 | C10orf90 | Gene ID | 4087 | 118611 |
Gene name | SMAD family member 2 | chromosome 10 open reading frame 90 | |
Synonyms | JV18|JV18-1|MADH2|MADR2|hMAD-2|hSMAD2 | FATS|bA422P15.2 | |
Cytomap | 18q21.1 | 10q26.2 | |
Type of gene | protein-coding | protein-coding | |
Description | mothers against decapentaplegic homolog 2MAD homolog 2SMAD, mothers against DPP homolog 2Sma- and Mad-related protein 2mother against DPP homolog 2 | (E2-independent) E3 ubiquitin-conjugating enzyme FATSE2/E3 hybrid ubiquitin-protein ligase FATScentrosomal protein C10orf90fragile-site associated tumor suppressor homolog | |
Modification date | 20200322 | 20200313 | |
UniProtAcc | . | Q96M02 Main function of 5'-partner protein: FUNCTION: Tumor suppressor that is required to sustain G2/M checkpoint after DNA damage. Acts as a p53/TP53 activator by inhibiting MDM2 binding to p53/TP53 and stimulating non-proteolytic polyubiquitination of p53/TP53. Exhibits ubiquitin ligase (E3) activity and assemble ubiquitin polymers through 'Lys-11'- (K11-), 'Lys-29'- (K29-) and 'Lys-63'- (K63)-linkages, independently of the ubiquitin-conjugating enzyme (E2). Promotes p53/TP53-dependent transcription of CDKN1A/p21, leading to robust checkpoint response. Mediates CDKN1A/p21 protein stability in a ubiquitin-independent manner. Interacts with HDAC1 and prevents binding of HDAC1 to CDKN1A/p21 and facilitates the acetylation and stabilization of CDKN1A/p21 (By similarity). May have a role in the assembly of primary cilia (Probable). {ECO:0000250|UniProtKB:D2J0Y4, ECO:0000305|PubMed:20844083}. | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000262160, ENST00000356825, ENST00000402690, ENST00000586040, ENST00000591214, ENST00000587353, | ENST00000356858, ENST00000368674, ENST00000392694, ENST00000480379, ENST00000284694, ENST00000454341, ENST00000544758, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 21 X 18 X 8=3024 | 3 X 2 X 2=12 |
# samples | 23 | 3 | |
** MAII score | log2(23/3024*10)=-3.7167523732767 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | log2(3/12*10)=1.32192809488736 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0 | |
Fusion gene context | PubMed: SMAD2 [Title/Abstract] AND C10orf90 [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: SMAD2 [Title/Abstract] AND C10orf90 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | SMAD2(45394694)-C10orf90(128202508), # samples:3 | ||
Anticipated loss of major functional domain due to fusion event. | SMAD2-C10orf90 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. SMAD2-C10orf90 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. SMAD2-C10orf90 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. SMAD2-C10orf90 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. SMAD2-C10orf90 seems lost the major protein functional domain in Hgene partner, which is a CGC due to the frame-shifted ORF. SMAD2-C10orf90 seems lost the major protein functional domain in Hgene partner, which is a tumor suppressor due to the frame-shifted ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
Hgene | SMAD2 | GO:0007179 | transforming growth factor beta receptor signaling pathway | 8752209|9389648|9732876|18548003 |
Hgene | SMAD2 | GO:0007182 | common-partner SMAD protein phosphorylation | 16806156 |
Hgene | SMAD2 | GO:0007183 | SMAD protein complex assembly | 9111321 |
Hgene | SMAD2 | GO:0045893 | positive regulation of transcription, DNA-templated | 9311995|9389648|9732876 |
Hgene | SMAD2 | GO:0045944 | positive regulation of transcription by RNA polymerase II | 9389648 |
Hgene | SMAD2 | GO:0070723 | response to cholesterol | 17878231 |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr18:45394694/chr10:128202508) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000402690 | SMAD2 | chr18 | 45394694 | - | ENST00000454341 | C10orf90 | chr10 | 128202508 | - | 3692 | 1050 | 395 | 2836 | 813 |
ENST00000402690 | SMAD2 | chr18 | 45394694 | - | ENST00000284694 | C10orf90 | chr10 | 128202508 | - | 3983 | 1050 | 395 | 3127 | 910 |
ENST00000402690 | SMAD2 | chr18 | 45394694 | - | ENST00000544758 | C10orf90 | chr10 | 128202508 | - | 3427 | 1050 | 395 | 3127 | 910 |
ENST00000356825 | SMAD2 | chr18 | 45394694 | - | ENST00000454341 | C10orf90 | chr10 | 128202508 | - | 3605 | 963 | 398 | 2749 | 783 |
ENST00000356825 | SMAD2 | chr18 | 45394694 | - | ENST00000284694 | C10orf90 | chr10 | 128202508 | - | 3896 | 963 | 398 | 3040 | 880 |
ENST00000356825 | SMAD2 | chr18 | 45394694 | - | ENST00000544758 | C10orf90 | chr10 | 128202508 | - | 3340 | 963 | 398 | 3040 | 880 |
ENST00000586040 | SMAD2 | chr18 | 45394694 | - | ENST00000454341 | C10orf90 | chr10 | 128202508 | - | 3262 | 620 | 55 | 2406 | 783 |
ENST00000586040 | SMAD2 | chr18 | 45394694 | - | ENST00000284694 | C10orf90 | chr10 | 128202508 | - | 3553 | 620 | 55 | 2697 | 880 |
ENST00000586040 | SMAD2 | chr18 | 45394694 | - | ENST00000544758 | C10orf90 | chr10 | 128202508 | - | 2997 | 620 | 55 | 2697 | 880 |
ENST00000591214 | SMAD2 | chr18 | 45394694 | - | ENST00000454341 | C10orf90 | chr10 | 128202508 | - | 3303 | 661 | 96 | 2447 | 783 |
ENST00000591214 | SMAD2 | chr18 | 45394694 | - | ENST00000284694 | C10orf90 | chr10 | 128202508 | - | 3594 | 661 | 96 | 2738 | 880 |
ENST00000591214 | SMAD2 | chr18 | 45394694 | - | ENST00000544758 | C10orf90 | chr10 | 128202508 | - | 3038 | 661 | 96 | 2738 | 880 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000402690 | ENST00000454341 | SMAD2 | chr18 | 45394694 | - | C10orf90 | chr10 | 128202508 | - | 0.000895673 | 0.9991043 |
ENST00000402690 | ENST00000284694 | SMAD2 | chr18 | 45394694 | - | C10orf90 | chr10 | 128202508 | - | 0.000507415 | 0.9994925 |
ENST00000402690 | ENST00000544758 | SMAD2 | chr18 | 45394694 | - | C10orf90 | chr10 | 128202508 | - | 0.000665725 | 0.9993343 |
ENST00000356825 | ENST00000454341 | SMAD2 | chr18 | 45394694 | - | C10orf90 | chr10 | 128202508 | - | 0.001657362 | 0.99834263 |
ENST00000356825 | ENST00000284694 | SMAD2 | chr18 | 45394694 | - | C10orf90 | chr10 | 128202508 | - | 0.00089603 | 0.99910396 |
ENST00000356825 | ENST00000544758 | SMAD2 | chr18 | 45394694 | - | C10orf90 | chr10 | 128202508 | - | 0.001181378 | 0.9988186 |
ENST00000586040 | ENST00000454341 | SMAD2 | chr18 | 45394694 | - | C10orf90 | chr10 | 128202508 | - | 0.001199088 | 0.9988009 |
ENST00000586040 | ENST00000284694 | SMAD2 | chr18 | 45394694 | - | C10orf90 | chr10 | 128202508 | - | 0.000674211 | 0.99932575 |
ENST00000586040 | ENST00000544758 | SMAD2 | chr18 | 45394694 | - | C10orf90 | chr10 | 128202508 | - | 0.000845305 | 0.9991547 |
ENST00000591214 | ENST00000454341 | SMAD2 | chr18 | 45394694 | - | C10orf90 | chr10 | 128202508 | - | 0.001362394 | 0.9986376 |
ENST00000591214 | ENST00000284694 | SMAD2 | chr18 | 45394694 | - | C10orf90 | chr10 | 128202508 | - | 0.000758918 | 0.9992411 |
ENST00000591214 | ENST00000544758 | SMAD2 | chr18 | 45394694 | - | C10orf90 | chr10 | 128202508 | - | 0.001003926 | 0.9989961 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for SMAD2-C10orf90 |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
SMAD2 | chr18 | 45394694 | C10orf90 | chr10 | 128202508 | 1050 | 218 | FPAGIEPQSNYIPGLRDSYHSRRDQI |
SMAD2 | chr18 | 45394694 | C10orf90 | chr10 | 128202508 | 620 | 188 | FPAGIEPQSNYIPGLRDSYHSRRDQI |
SMAD2 | chr18 | 45394694 | C10orf90 | chr10 | 128202508 | 661 | 188 | FPAGIEPQSNYIPGLRDSYHSRRDQI |
SMAD2 | chr18 | 45394694 | C10orf90 | chr10 | 128202508 | 963 | 188 | FPAGIEPQSNYIPGLRDSYHSRRDQI |
Top |
Potential FusionNeoAntigen Information of SMAD2-C10orf90 in HLA I |
![]() |
SMAD2-C10orf90_45394694_128202508.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
SMAD2-C10orf90 | chr18 | 45394694 | chr10 | 128202508 | 963 | HLA-B15:02 | YIPGLRDSY | 0.9844 | 0.6225 | 10 | 19 |
SMAD2-C10orf90 | chr18 | 45394694 | chr10 | 128202508 | 963 | HLA-B15:21 | YIPGLRDSY | 0.9824 | 0.5665 | 10 | 19 |
SMAD2-C10orf90 | chr18 | 45394694 | chr10 | 128202508 | 963 | HLA-B15:31 | YIPGLRDSY | 0.9414 | 0.5937 | 10 | 19 |
SMAD2-C10orf90 | chr18 | 45394694 | chr10 | 128202508 | 963 | HLA-C12:16 | NYIPGLRDSY | 0.9652 | 0.9009 | 9 | 19 |
SMAD2-C10orf90 | chr18 | 45394694 | chr10 | 128202508 | 963 | HLA-B15:21 | NYIPGLRDSY | 0.9574 | 0.6612 | 9 | 19 |
SMAD2-C10orf90 | chr18 | 45394694 | chr10 | 128202508 | 963 | HLA-C07:27 | NYIPGLRDSY | 0.9086 | 0.8088 | 9 | 19 |
SMAD2-C10orf90 | chr18 | 45394694 | chr10 | 128202508 | 963 | HLA-C07:80 | NYIPGLRDSY | 0.8972 | 0.7403 | 9 | 19 |
SMAD2-C10orf90 | chr18 | 45394694 | chr10 | 128202508 | 963 | HLA-C07:67 | NYIPGLRDSY | 0.8972 | 0.7403 | 9 | 19 |
SMAD2-C10orf90 | chr18 | 45394694 | chr10 | 128202508 | 963 | HLA-C07:10 | NYIPGLRDSY | 0.8935 | 0.8529 | 9 | 19 |
SMAD2-C10orf90 | chr18 | 45394694 | chr10 | 128202508 | 963 | HLA-B15:27 | YIPGLRDSY | 0.9965 | 0.5513 | 10 | 19 |
SMAD2-C10orf90 | chr18 | 45394694 | chr10 | 128202508 | 963 | HLA-B35:23 | YIPGLRDSY | 0.945 | 0.5838 | 10 | 19 |
SMAD2-C10orf90 | chr18 | 45394694 | chr10 | 128202508 | 963 | HLA-B35:20 | YIPGLRDSY | 0.9305 | 0.6671 | 10 | 19 |
SMAD2-C10orf90 | chr18 | 45394694 | chr10 | 128202508 | 963 | HLA-A25:01 | YIPGLRDSY | 0.8515 | 0.5958 | 10 | 19 |
SMAD2-C10orf90 | chr18 | 45394694 | chr10 | 128202508 | 963 | HLA-C12:02 | YIPGLRDSY | 0.796 | 0.923 | 10 | 19 |
SMAD2-C10orf90 | chr18 | 45394694 | chr10 | 128202508 | 963 | HLA-C03:02 | YIPGLRDSY | 0.7425 | 0.9012 | 10 | 19 |
SMAD2-C10orf90 | chr18 | 45394694 | chr10 | 128202508 | 963 | HLA-C07:02 | NYIPGLRDSY | 0.8972 | 0.7403 | 9 | 19 |
SMAD2-C10orf90 | chr18 | 45394694 | chr10 | 128202508 | 963 | HLA-C07:17 | NYIPGLRDSY | 0.8707 | 0.9028 | 9 | 19 |
SMAD2-C10orf90 | chr18 | 45394694 | chr10 | 128202508 | 963 | HLA-C14:03 | NYIPGLRDSY | 0.515 | 0.9426 | 9 | 19 |
SMAD2-C10orf90 | chr18 | 45394694 | chr10 | 128202508 | 963 | HLA-C14:02 | NYIPGLRDSY | 0.515 | 0.9426 | 9 | 19 |
Top |
Potential FusionNeoAntigen Information of SMAD2-C10orf90 in HLA II |
![]() |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of SMAD2-C10orf90 |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
6927 | PQSNYIPGLRDSYH | SMAD2 | C10orf90 | chr18 | 45394694 | chr10 | 128202508 | 963 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of SMAD2-C10orf90 |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 6927 | PQSNYIPGLRDSYH | -7.15543 | -7.26883 |
HLA-B14:02 | 3BVN | 6927 | PQSNYIPGLRDSYH | -4.77435 | -5.80965 |
HLA-B52:01 | 3W39 | 6927 | PQSNYIPGLRDSYH | -6.80875 | -6.92215 |
HLA-B52:01 | 3W39 | 6927 | PQSNYIPGLRDSYH | -4.20386 | -5.23916 |
HLA-A11:01 | 4UQ2 | 6927 | PQSNYIPGLRDSYH | -7.5194 | -8.5547 |
HLA-A11:01 | 4UQ2 | 6927 | PQSNYIPGLRDSYH | -6.9601 | -7.0735 |
HLA-A24:02 | 5HGA | 6927 | PQSNYIPGLRDSYH | -7.52403 | -7.63743 |
HLA-A24:02 | 5HGA | 6927 | PQSNYIPGLRDSYH | -5.82433 | -6.85963 |
HLA-B27:05 | 6PYJ | 6927 | PQSNYIPGLRDSYH | -3.28285 | -4.31815 |
HLA-B44:05 | 3DX8 | 6927 | PQSNYIPGLRDSYH | -5.91172 | -6.94702 |
HLA-B44:05 | 3DX8 | 6927 | PQSNYIPGLRDSYH | -4.24346 | -4.35686 |
Top |
Vaccine Design for the FusionNeoAntigens of SMAD2-C10orf90 |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
SMAD2-C10orf90 | chr18 | 45394694 | chr10 | 128202508 | 10 | 19 | YIPGLRDSY | ATATTCCAGGATTACGGGACAGCTACC |
SMAD2-C10orf90 | chr18 | 45394694 | chr10 | 128202508 | 9 | 19 | NYIPGLRDSY | ATTATATTCCAGGATTACGGGACAGCTACC |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of SMAD2-C10orf90 |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
LUAD | SMAD2-C10orf90 | chr18 | 45394694 | ENST00000356825 | chr10 | 128202508 | ENST00000284694 | TCGA-97-7937-01A |
Top |
Potential target of CAR-T therapy development for SMAD2-C10orf90 |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to SMAD2-C10orf90 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to SMAD2-C10orf90 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |