Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:SMARCB1-SNW1

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: SMARCB1-SNW1
	FusionPDB ID: 83932
	FusionGDB2.0 ID: 83932
		Hgene	Tgene
	Gene symbol	SMARCB1	SNW1
	Gene ID	6598	22938
	Gene name	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1	SNW domain containing 1
	Synonyms	BAF47\|CSS3\|INI1\|MRD15\|PPP1R144\|RDT\|RTPS1\|SNF5\|SNF5L1\|SWNTS1\|Sfh1p\|Snr1\|hSNFS	Bx42\|FUN20\|NCOA-62\|PRPF45\|Prp45\|SKIIP\|SKIP\|SKIP1
	Cytomap	22q11.23\|22q11	14q24.3
	Type of gene	protein-coding	protein-coding
	Description	SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily B member 1BRG1-associated factor 47SNF5 homologSWI/SNF-related matrix-associated proteinhSNF5integrase interactor 1 proteinmalignant rhabdoid tumor suppressorprotein	SNW domain-containing protein 1SKI interacting proteinhomolog of Drosophila BX42nuclear protein SkiPnuclear receptor coactivator NCoA-62nuclear receptor coactivator, 62-kDski-interacting protein
	Modification date	20200313	20200313
	UniProtAcc	.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000263121, ENST00000344921, ENST00000407082, ENST00000407422, ENST00000477836,	ENST00000261531, ENST00000554775, ENST00000555761,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	14 X 15 X 8=1680	20 X 9 X 11=1980
	# samples	19	22
	** MAII score	log2(19/1680*10)=-3.14438990933518 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(22/1980*10)=-3.16992500144231 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: SMARCB1 [Title/Abstract] AND SNW1 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: SMARCB1 [Title/Abstract] AND SNW1 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	SMARCB1(24129449)-SNW1(78201355), # samples:3
Anticipated loss of major functional domain due to fusion event.	SMARCB1-SNW1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. SMARCB1-SNW1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	SMARCB1	GO:0006337	nucleosome disassembly	8895581
Hgene	SMARCB1	GO:0006338	chromatin remodeling	11726552
Hgene	SMARCB1	GO:0039692	single stranded viral RNA replication via double stranded DNA intermediate	14963118
Hgene	SMARCB1	GO:0045944	positive regulation of transcription by RNA polymerase II	11950834
Hgene	SMARCB1	GO:0051091	positive regulation of DNA-binding transcription factor activity	11950834
Hgene	SMARCB1	GO:1902661	positive regulation of glucose mediated signaling pathway	22368283
Tgene	SNW1	GO:0000122	negative regulation of transcription by RNA polymerase II	14985122
Tgene	SNW1	GO:0000398	mRNA splicing, via spliceosome	15194481\|28076346
Tgene	SNW1	GO:0030511	positive regulation of transforming growth factor beta receptor signaling pathway	11278756
Tgene	SNW1	GO:0043923	positive regulation by host of viral transcription	15905409
Tgene	SNW1	GO:0045892	negative regulation of transcription, DNA-templated	10713164\|15878163
Tgene	SNW1	GO:0045944	positive regulation of transcription by RNA polymerase II	14985122\|19934264
Tgene	SNW1	GO:0048384	retinoic acid receptor signaling pathway	19934264
Tgene	SNW1	GO:0048385	regulation of retinoic acid receptor signaling pathway	14985122
Tgene	SNW1	GO:0070562	regulation of vitamin D receptor signaling pathway	14985122
Tgene	SNW1	GO:0070564	positive regulation of vitamin D receptor signaling pathway	9632709\|11514567
Tgene	SNW1	GO:0071300	cellular response to retinoic acid	19934264

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr22:24129449/chr14:78201355)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across SMARCB1 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across SNW1 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000344921	SMARCB1	chr22	24129449	+	ENST00000261531	SNW1	chr14	78201355	-	1692	300	207	1202	331
ENST00000344921	SMARCB1	chr22	24129449	+	ENST00000554775	SNW1	chr14	78201355	-	1663	300	207	1202	331
ENST00000344921	SMARCB1	chr22	24129449	+	ENST00000555761	SNW1	chr14	78201355	-	1418	300	207	1307	366
ENST00000263121	SMARCB1	chr22	24129449	+	ENST00000261531	SNW1	chr14	78201355	-	1681	289	196	1191	331
ENST00000263121	SMARCB1	chr22	24129449	+	ENST00000554775	SNW1	chr14	78201355	-	1652	289	196	1191	331
ENST00000263121	SMARCB1	chr22	24129449	+	ENST00000555761	SNW1	chr14	78201355	-	1407	289	196	1296	366
ENST00000407422	SMARCB1	chr22	24129449	+	ENST00000261531	SNW1	chr14	78201355	-	1661	269	176	1171	331
ENST00000407422	SMARCB1	chr22	24129449	+	ENST00000554775	SNW1	chr14	78201355	-	1632	269	176	1171	331
ENST00000407422	SMARCB1	chr22	24129449	+	ENST00000555761	SNW1	chr14	78201355	-	1387	269	176	1276	366
ENST00000407082	SMARCB1	chr22	24129449	+	ENST00000261531	SNW1	chr14	78201355	-	1644	252	159	1154	331
ENST00000407082	SMARCB1	chr22	24129449	+	ENST00000554775	SNW1	chr14	78201355	-	1615	252	159	1154	331
ENST00000407082	SMARCB1	chr22	24129449	+	ENST00000555761	SNW1	chr14	78201355	-	1370	252	159	1259	366

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000344921	ENST00000261531	SMARCB1	chr22	24129449	+	SNW1	chr14	78201355	-	0.000387265	0.99961275
ENST00000344921	ENST00000554775	SMARCB1	chr22	24129449	+	SNW1	chr14	78201355	-	0.000422942	0.9995771
ENST00000344921	ENST00000555761	SMARCB1	chr22	24129449	+	SNW1	chr14	78201355	-	0.00109637	0.99890363
ENST00000263121	ENST00000261531	SMARCB1	chr22	24129449	+	SNW1	chr14	78201355	-	0.000378695	0.9996213
ENST00000263121	ENST00000554775	SMARCB1	chr22	24129449	+	SNW1	chr14	78201355	-	0.000420478	0.9995795
ENST00000263121	ENST00000555761	SMARCB1	chr22	24129449	+	SNW1	chr14	78201355	-	0.001065663	0.9989343
ENST00000407422	ENST00000261531	SMARCB1	chr22	24129449	+	SNW1	chr14	78201355	-	0.000364744	0.9996352
ENST00000407422	ENST00000554775	SMARCB1	chr22	24129449	+	SNW1	chr14	78201355	-	0.000409369	0.9995907
ENST00000407422	ENST00000555761	SMARCB1	chr22	24129449	+	SNW1	chr14	78201355	-	0.001058415	0.9989416
ENST00000407082	ENST00000261531	SMARCB1	chr22	24129449	+	SNW1	chr14	78201355	-	0.000378673	0.9996213
ENST00000407082	ENST00000554775	SMARCB1	chr22	24129449	+	SNW1	chr14	78201355	-	0.000412562	0.9995875
ENST00000407082	ENST00000555761	SMARCB1	chr22	24129449	+	SNW1	chr14	78201355	-	0.001066436	0.9989336

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for SMARCB1-SNW1

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
SMARCB1	chr22	24129449	SNW1	chr14	78201355	252	29	FQLEDDGEFYMIGSEMTVKEQQEWKI
SMARCB1	chr22	24129449	SNW1	chr14	78201355	269	29	FQLEDDGEFYMIGSEMTVKEQQEWKI
SMARCB1	chr22	24129449	SNW1	chr14	78201355	289	29	FQLEDDGEFYMIGSEMTVKEQQEWKI
SMARCB1	chr22	24129449	SNW1	chr14	78201355	300	29	FQLEDDGEFYMIGSEMTVKEQQEWKI

Top

Potential FusionNeoAntigen Information of SMARCB1-SNW1 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

SMARCB1-SNW1_24129449_78201355.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
SMARCB1-SNW1	chr22	24129449	chr14	78201355	289	HLA-A02:22	YMIGSEMTV	0.9991	0.5541	9	18
SMARCB1-SNW1	chr22	24129449	chr14	78201355	289	HLA-A02:60	YMIGSEMTV	0.9989	0.5108	9	18
SMARCB1-SNW1	chr22	24129449	chr14	78201355	289	HLA-A02:21	YMIGSEMTV	0.9987	0.5673	9	18
SMARCB1-SNW1	chr22	24129449	chr14	78201355	289	HLA-A02:27	YMIGSEMTV	0.9985	0.5134	9	18
SMARCB1-SNW1	chr22	24129449	chr14	78201355	289	HLA-A02:13	YMIGSEMTV	0.9983	0.5791	9	18
SMARCB1-SNW1	chr22	24129449	chr14	78201355	289	HLA-A02:35	YMIGSEMTV	0.9966	0.5155	9	18
SMARCB1-SNW1	chr22	24129449	chr14	78201355	289	HLA-A02:38	YMIGSEMTV	0.9957	0.5715	9	18
SMARCB1-SNW1	chr22	24129449	chr14	78201355	289	HLA-A02:04	YMIGSEMTV	0.995	0.7212	9	18
SMARCB1-SNW1	chr22	24129449	chr14	78201355	289	HLA-A02:17	YMIGSEMTV	0.989	0.5348	9	18
SMARCB1-SNW1	chr22	24129449	chr14	78201355	289	HLA-B13:02	YMIGSEMTV	0.2215	0.6537	9	18
SMARCB1-SNW1	chr22	24129449	chr14	78201355	289	HLA-C07:29	FYMIGSEM	0.9618	0.8011	8	16
SMARCB1-SNW1	chr22	24129449	chr14	78201355	289	HLA-C07:80	FYMIGSEM	0.9492	0.904	8	16
SMARCB1-SNW1	chr22	24129449	chr14	78201355	289	HLA-C07:67	FYMIGSEM	0.9492	0.904	8	16
SMARCB1-SNW1	chr22	24129449	chr14	78201355	289	HLA-C07:10	FYMIGSEM	0.9484	0.9496	8	16
SMARCB1-SNW1	chr22	24129449	chr14	78201355	289	HLA-A02:07	YMIGSEMTV	0.999	0.5138	9	18
SMARCB1-SNW1	chr22	24129449	chr14	78201355	289	HLA-C04:06	YMIGSEMTV	0.9933	0.8837	9	18
SMARCB1-SNW1	chr22	24129449	chr14	78201355	289	HLA-B15:21	EFYMIGSEM	0.8137	0.8881	7	16
SMARCB1-SNW1	chr22	24129449	chr14	78201355	289	HLA-C02:06	YMIGSEMTV	0.568	0.9691	9	18
SMARCB1-SNW1	chr22	24129449	chr14	78201355	289	HLA-C03:67	FYMIGSEM	0.9893	0.9719	8	16
SMARCB1-SNW1	chr22	24129449	chr14	78201355	289	HLA-C07:17	FYMIGSEM	0.9728	0.9678	8	16
SMARCB1-SNW1	chr22	24129449	chr14	78201355	289	HLA-C07:02	FYMIGSEM	0.9492	0.904	8	16
SMARCB1-SNW1	chr22	24129449	chr14	78201355	289	HLA-C04:04	FYMIGSEM	0.9403	0.6259	8	16
SMARCB1-SNW1	chr22	24129449	chr14	78201355	289	HLA-C14:03	FYMIGSEM	0.9238	0.9699	8	16
SMARCB1-SNW1	chr22	24129449	chr14	78201355	289	HLA-C14:02	FYMIGSEM	0.9238	0.9699	8	16
SMARCB1-SNW1	chr22	24129449	chr14	78201355	289	HLA-C06:06	FYMIGSEM	0.8746	0.9884	8	16
SMARCB1-SNW1	chr22	24129449	chr14	78201355	289	HLA-A02:03	YMIGSEMTV	0.9992	0.618	9	18
SMARCB1-SNW1	chr22	24129449	chr14	78201355	289	HLA-A02:14	YMIGSEMTV	0.9987	0.514	9	18
SMARCB1-SNW1	chr22	24129449	chr14	78201355	289	HLA-A02:06	YMIGSEMTV	0.9987	0.5673	9	18
SMARCB1-SNW1	chr22	24129449	chr14	78201355	289	HLA-C03:06	YMIGSEMTV	0.9572	0.9906	9	18
SMARCB1-SNW1	chr22	24129449	chr14	78201355	289	HLA-C04:04	YMIGSEMTV	0.9142	0.8418	9	18
SMARCB1-SNW1	chr22	24129449	chr14	78201355	289	HLA-C17:01	YMIGSEMTV	0.6157	0.9302	9	18
SMARCB1-SNW1	chr22	24129449	chr14	78201355	289	HLA-C03:67	EFYMIGSEM	0.4253	0.9654	7	16
SMARCB1-SNW1	chr22	24129449	chr14	78201355	289	HLA-C14:02	EFYMIGSEM	0.3012	0.9541	7	16
SMARCB1-SNW1	chr22	24129449	chr14	78201355	289	HLA-C14:03	EFYMIGSEM	0.3012	0.9541	7	16
SMARCB1-SNW1	chr22	24129449	chr14	78201355	289	HLA-C07:04	YMIGSEMTV	0.2252	0.9412	9	18
SMARCB1-SNW1	chr22	24129449	chr14	78201355	289	HLA-B40:04	GEFYMIGSEM	0.9896	0.6462	6	16

Top

Potential FusionNeoAntigen Information of SMARCB1-SNW1 in HLA II

SMARCB1-SNW1_24129449_78201355.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
SMARCB1-SNW1	chr22	24129449	chr14	78201355	289	DRB1-0113	DGEFYMIGSEMTVKE	5	20
SMARCB1-SNW1	chr22	24129449	chr14	78201355	289	DRB1-0117	DGEFYMIGSEMTVKE	5	20
SMARCB1-SNW1	chr22	24129449	chr14	78201355	289	DRB1-0121	DGEFYMIGSEMTVKE	5	20
SMARCB1-SNW1	chr22	24129449	chr14	78201355	289	DRB1-1527	DGEFYMIGSEMTVKE	5	20
SMARCB1-SNW1	chr22	24129449	chr14	78201355	289	DRB1-1534	DGEFYMIGSEMTVKE	5	20
SMARCB1-SNW1	chr22	24129449	chr14	78201355	289	DRB1-1601	DGEFYMIGSEMTVKE	5	20
SMARCB1-SNW1	chr22	24129449	chr14	78201355	289	DRB1-1601	DDGEFYMIGSEMTVK	4	19
SMARCB1-SNW1	chr22	24129449	chr14	78201355	289	DRB1-1602	DGEFYMIGSEMTVKE	5	20
SMARCB1-SNW1	chr22	24129449	chr14	78201355	289	DRB1-1603	DGEFYMIGSEMTVKE	5	20
SMARCB1-SNW1	chr22	24129449	chr14	78201355	289	DRB1-1603	DDGEFYMIGSEMTVK	4	19
SMARCB1-SNW1	chr22	24129449	chr14	78201355	289	DRB1-1604	DGEFYMIGSEMTVKE	5	20
SMARCB1-SNW1	chr22	24129449	chr14	78201355	289	DRB1-1605	DGEFYMIGSEMTVKE	5	20
SMARCB1-SNW1	chr22	24129449	chr14	78201355	289	DRB1-1607	DGEFYMIGSEMTVKE	5	20
SMARCB1-SNW1	chr22	24129449	chr14	78201355	289	DRB1-1608	DGEFYMIGSEMTVKE	5	20
SMARCB1-SNW1	chr22	24129449	chr14	78201355	289	DRB1-1608	DDGEFYMIGSEMTVK	4	19
SMARCB1-SNW1	chr22	24129449	chr14	78201355	289	DRB1-1609	DGEFYMIGSEMTVKE	5	20
SMARCB1-SNW1	chr22	24129449	chr14	78201355	289	DRB1-1610	DGEFYMIGSEMTVKE	5	20
SMARCB1-SNW1	chr22	24129449	chr14	78201355	289	DRB1-1611	DGEFYMIGSEMTVKE	5	20
SMARCB1-SNW1	chr22	24129449	chr14	78201355	289	DRB1-1612	DGEFYMIGSEMTVKE	5	20
SMARCB1-SNW1	chr22	24129449	chr14	78201355	289	DRB1-1614	DGEFYMIGSEMTVKE	5	20
SMARCB1-SNW1	chr22	24129449	chr14	78201355	289	DRB1-1616	DGEFYMIGSEMTVKE	5	20

Top

Fusion breakpoint peptide structures of SMARCB1-SNW1

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
2746	GEFYMIGSEMTVKE	SMARCB1	SNW1	chr22	24129449	chr14	78201355	289

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of SMARCB1-SNW1

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	2746	GEFYMIGSEMTVKE	-7.69222	-7.69942
HLA-B52:01	3W39	2746	GEFYMIGSEMTVKE	-7.60148	-7.60868
HLA-A11:01	4UQ2	2746	GEFYMIGSEMTVKE	-6.66327	-6.67047
HLA-A24:02	5HGA	2746	GEFYMIGSEMTVKE	-9.4375	-9.4447
HLA-B27:05	6PYJ	2746	GEFYMIGSEMTVKE	-4.77117	-4.77837
HLA-B44:05	3DX8	2746	GEFYMIGSEMTVKE	-6.68497	-6.69217

Top

Vaccine Design for the FusionNeoAntigens of SMARCB1-SNW1

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
SMARCB1-SNW1	chr22	24129449	chr14	78201355	6	16	GEFYMIGSEM	TTCTACATGATCGGCTCCGAGATGACTGTA
SMARCB1-SNW1	chr22	24129449	chr14	78201355	7	16	EFYMIGSEM	TACATGATCGGCTCCGAGATGACTGTA
SMARCB1-SNW1	chr22	24129449	chr14	78201355	8	16	FYMIGSEM	ATGATCGGCTCCGAGATGACTGTA
SMARCB1-SNW1	chr22	24129449	chr14	78201355	9	18	YMIGSEMTV	ATCGGCTCCGAGATGACTGTAAAGGAA

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
SMARCB1-SNW1	chr22	24129449	chr14	78201355	4	19	DDGEFYMIGSEMTVK	GGCGAGTTCTACATGATCGGCTCCGAGATGACTGTAAAGGAACAA
SMARCB1-SNW1	chr22	24129449	chr14	78201355	5	20	DGEFYMIGSEMTVKE	GAGTTCTACATGATCGGCTCCGAGATGACTGTAAAGGAACAACAA

Top

Information of the samples that have these potential fusion neoantigens of SMARCB1-SNW1

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
BLCA	SMARCB1-SNW1	chr22	24129449	ENST00000263121	chr14	78201355	ENST00000261531	TCGA-UY-A9PE-01A

Top

Potential target of CAR-T therapy development for SMARCB1-SNW1

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to SMARCB1-SNW1

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to SMARCB1-SNW1

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)