Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:SMARCE1-RARA

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: SMARCE1-RARA
	FusionPDB ID: 83981
	FusionGDB2.0 ID: 83981
		Hgene	Tgene
	Gene symbol	SMARCE1	RARA
	Gene ID	6605	5914
	Gene name	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1	retinoic acid receptor alpha
	Synonyms	BAF57\|CSS5	NR1B1\|RAR
	Cytomap	17q21.2	17q21.2
	Type of gene	protein-coding	protein-coding
	Description	SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily E member 1BRG1-associated factor 57SWI/SNF-related matrix-associated actin-dependent regulator of chromatin e1chromatin remodeling complex BRG1-associated factor 57	retinoic acid receptor alphaRAR-alphanuclear receptor subfamily 1 group B member 1nucleophosmin-retinoic acid receptor alpha fusion protein NPM-RAR long formretinoic acid nuclear receptor alpha variant 1retinoic acid nuclear receptor alpha variant 2
	Modification date	20200313	20200327
	UniProtAcc	.	P10276 Main function of 5'-partner protein: FUNCTION: Receptor for retinoic acid (PubMed:19850744, PubMed:16417524, PubMed:20215566). Retinoic acid receptors bind as heterodimers to their target response elements in response to their ligands, all-trans or 9-cis retinoic acid, and regulate gene expression in various biological processes (PubMed:28167758). The RXR/RAR heterodimers bind to the retinoic acid response elements (RARE) composed of tandem 5'-AGGTCA-3' sites known as DR1-DR5 (PubMed:28167758, PubMed:19398580). In the absence of ligand, the RXR-RAR heterodimers associate with a multiprotein complex containing transcription corepressors that induce histone deacetylation, chromatin condensation and transcriptional suppression (PubMed:16417524). On ligand binding, the corepressors dissociate from the receptors and associate with the coactivators leading to transcriptional activation (PubMed:9267036, PubMed:19850744, PubMed:20215566). Formation of a complex with histone deacetylases might lead to inhibition of RARE DNA element binding and to transcriptional repression (PubMed:28167758). Transcriptional activation and RARE DNA element binding might be supported by the transcription factor KLF2 (PubMed:28167758). RARA plays an essential role in the regulation of retinoic acid-induced germ cell development during spermatogenesis (By similarity). Has a role in the survival of early spermatocytes at the beginning prophase of meiosis (By similarity). In Sertoli cells, may promote the survival and development of early meiotic prophase spermatocytes (By similarity). In concert with RARG, required for skeletal growth, matrix homeostasis and growth plate function (By similarity). Together with RXRA, positively regulates microRNA-10a expression, thereby inhibiting the GATA6/VCAM1 signaling response to pulsatile shear stress in vascular endothelial cells (PubMed:28167758). In association with HDAC3, HDAC5 and HDAC7 corepressors, plays a role in the repression of microRNA-10a and thereby promotes the inflammatory response (PubMed:28167758). {ECO:0000250\|UniProtKB:P11416, ECO:0000269\|PubMed:16417524, ECO:0000269\|PubMed:19398580, ECO:0000269\|PubMed:19850744, ECO:0000269\|PubMed:20215566, ECO:0000269\|PubMed:28167758, ECO:0000269\|PubMed:9267036}.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000348513, ENST00000377808, ENST00000400122, ENST00000431889, ENST00000544009, ENST00000578044, ENST00000580419, ENST00000474246,	ENST00000420042, ENST00000254066, ENST00000394081, ENST00000394086, ENST00000394089, ENST00000425707,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	3 X 5 X 3=45	29 X 39 X 17=19227
	# samples	5	55
	** MAII score	log2(5/45*10)=0.15200309344505 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0	log2(55/19227*10)=-5.12755824682814 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: SMARCE1 [Title/Abstract] AND RARA [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: SMARCE1 [Title/Abstract] AND RARA [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	SMARCE1(38792183)-RARA(38511515), # samples:2
Anticipated loss of major functional domain due to fusion event.	SMARCE1-RARA seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. SMARCE1-RARA seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. SMARCE1-RARA seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. SMARCE1-RARA seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. SMARCE1-RARA seems lost the major protein functional domain in Hgene partner, which is a CGC due to the frame-shifted ORF. SMARCE1-RARA seems lost the major protein functional domain in Hgene partner, which is a epigenetic factor due to the frame-shifted ORF. SMARCE1-RARA seems lost the major protein functional domain in Hgene partner, which is a essential gene due to the frame-shifted ORF. SMARCE1-RARA seems lost the major protein functional domain in Tgene partner, which is a CGC due to the frame-shifted ORF. SMARCE1-RARA seems lost the major protein functional domain in Tgene partner, which is a epigenetic factor due to the frame-shifted ORF. SMARCE1-RARA seems lost the major protein functional domain in Tgene partner, which is a IUPHAR drug target due to the frame-shifted ORF. SMARCE1-RARA seems lost the major protein functional domain in Tgene partner, which is a transcription factor due to the frame-shifted ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	SMARCE1	GO:0006337	nucleosome disassembly	8895581
Hgene	SMARCE1	GO:0006338	chromatin remodeling	11726552
Hgene	SMARCE1	GO:0045892	negative regulation of transcription, DNA-templated	12192000
Tgene	RARA	GO:0007165	signal transduction	2825025
Tgene	RARA	GO:0030853	negative regulation of granulocyte differentiation	19917671
Tgene	RARA	GO:0032689	negative regulation of interferon-gamma production	18416830
Tgene	RARA	GO:0032720	negative regulation of tumor necrosis factor production	18416830
Tgene	RARA	GO:0032736	positive regulation of interleukin-13 production	18416830
Tgene	RARA	GO:0032753	positive regulation of interleukin-4 production	18416830
Tgene	RARA	GO:0032754	positive regulation of interleukin-5 production	18416830
Tgene	RARA	GO:0045630	positive regulation of T-helper 2 cell differentiation	18416830
Tgene	RARA	GO:0045892	negative regulation of transcription, DNA-templated	20080953
Tgene	RARA	GO:0045893	positive regulation of transcription, DNA-templated	18845237\|19850744\|20080953
Tgene	RARA	GO:0045944	positive regulation of transcription by RNA polymerase II	19850744\|21131358
Tgene	RARA	GO:0071300	cellular response to retinoic acid	19917671
Tgene	RARA	GO:0071391	cellular response to estrogen stimulus	20080953

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr17:38792183/chr17:38511515)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across SMARCE1 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across RARA (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000544009	SMARCE1	chr17	38792183	-	ENST00000254066	RARA	chr17	38511515	+	1385	438	104	814	236
ENST00000544009	SMARCE1	chr17	38792183	-	ENST00000394089	RARA	chr17	38511515	+	920	438	104	814	236
ENST00000544009	SMARCE1	chr17	38792183	-	ENST00000425707	RARA	chr17	38511515	+	1431	438	104	814	236
ENST00000544009	SMARCE1	chr17	38792183	-	ENST00000394086	RARA	chr17	38511515	+	1384	438	104	814	236
ENST00000544009	SMARCE1	chr17	38792183	-	ENST00000394081	RARA	chr17	38511515	+	1384	438	104	814	236
ENST00000377808	SMARCE1	chr17	38792183	-	ENST00000254066	RARA	chr17	38511515	+	1474	527	91	903	270
ENST00000377808	SMARCE1	chr17	38792183	-	ENST00000394089	RARA	chr17	38511515	+	1009	527	91	903	270
ENST00000377808	SMARCE1	chr17	38792183	-	ENST00000425707	RARA	chr17	38511515	+	1520	527	91	903	270
ENST00000377808	SMARCE1	chr17	38792183	-	ENST00000394086	RARA	chr17	38511515	+	1473	527	91	903	270
ENST00000377808	SMARCE1	chr17	38792183	-	ENST00000394081	RARA	chr17	38511515	+	1473	527	91	903	270
ENST00000400122	SMARCE1	chr17	38792183	-	ENST00000254066	RARA	chr17	38511515	+	1430	483	149	859	236
ENST00000400122	SMARCE1	chr17	38792183	-	ENST00000394089	RARA	chr17	38511515	+	965	483	149	859	236
ENST00000400122	SMARCE1	chr17	38792183	-	ENST00000425707	RARA	chr17	38511515	+	1476	483	149	859	236
ENST00000400122	SMARCE1	chr17	38792183	-	ENST00000394086	RARA	chr17	38511515	+	1429	483	149	859	236
ENST00000400122	SMARCE1	chr17	38792183	-	ENST00000394081	RARA	chr17	38511515	+	1429	483	149	859	236
ENST00000544009	SMARCE1	chr17	38792182	-	ENST00000254066	RARA	chr17	38511514	+	1385	438	104	814	236
ENST00000544009	SMARCE1	chr17	38792182	-	ENST00000394089	RARA	chr17	38511514	+	920	438	104	814	236
ENST00000544009	SMARCE1	chr17	38792182	-	ENST00000425707	RARA	chr17	38511514	+	1431	438	104	814	236
ENST00000544009	SMARCE1	chr17	38792182	-	ENST00000394086	RARA	chr17	38511514	+	1384	438	104	814	236
ENST00000544009	SMARCE1	chr17	38792182	-	ENST00000394081	RARA	chr17	38511514	+	1384	438	104	814	236
ENST00000377808	SMARCE1	chr17	38792182	-	ENST00000254066	RARA	chr17	38511514	+	1474	527	91	903	270
ENST00000377808	SMARCE1	chr17	38792182	-	ENST00000394089	RARA	chr17	38511514	+	1009	527	91	903	270
ENST00000377808	SMARCE1	chr17	38792182	-	ENST00000425707	RARA	chr17	38511514	+	1520	527	91	903	270
ENST00000377808	SMARCE1	chr17	38792182	-	ENST00000394086	RARA	chr17	38511514	+	1473	527	91	903	270
ENST00000377808	SMARCE1	chr17	38792182	-	ENST00000394081	RARA	chr17	38511514	+	1473	527	91	903	270
ENST00000400122	SMARCE1	chr17	38792182	-	ENST00000254066	RARA	chr17	38511514	+	1430	483	149	859	236
ENST00000400122	SMARCE1	chr17	38792182	-	ENST00000394089	RARA	chr17	38511514	+	965	483	149	859	236
ENST00000400122	SMARCE1	chr17	38792182	-	ENST00000425707	RARA	chr17	38511514	+	1476	483	149	859	236
ENST00000400122	SMARCE1	chr17	38792182	-	ENST00000394086	RARA	chr17	38511514	+	1429	483	149	859	236
ENST00000400122	SMARCE1	chr17	38792182	-	ENST00000394081	RARA	chr17	38511514	+	1429	483	149	859	236

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000544009	ENST00000254066	SMARCE1	chr17	38792183	-	RARA	chr17	38511515	+	0.00475625	0.9952437
ENST00000544009	ENST00000394089	SMARCE1	chr17	38792183	-	RARA	chr17	38511515	+	0.005135478	0.9948645
ENST00000544009	ENST00000425707	SMARCE1	chr17	38792183	-	RARA	chr17	38511515	+	0.004582485	0.9954175
ENST00000544009	ENST00000394086	SMARCE1	chr17	38792183	-	RARA	chr17	38511515	+	0.004762658	0.99523735
ENST00000544009	ENST00000394081	SMARCE1	chr17	38792183	-	RARA	chr17	38511515	+	0.004762658	0.99523735
ENST00000377808	ENST00000254066	SMARCE1	chr17	38792183	-	RARA	chr17	38511515	+	0.006681904	0.9933181
ENST00000377808	ENST00000394089	SMARCE1	chr17	38792183	-	RARA	chr17	38511515	+	0.008522294	0.99147767
ENST00000377808	ENST00000425707	SMARCE1	chr17	38792183	-	RARA	chr17	38511515	+	0.006151333	0.9938486
ENST00000377808	ENST00000394086	SMARCE1	chr17	38792183	-	RARA	chr17	38511515	+	0.006716357	0.9932836
ENST00000377808	ENST00000394081	SMARCE1	chr17	38792183	-	RARA	chr17	38511515	+	0.006716357	0.9932836
ENST00000400122	ENST00000254066	SMARCE1	chr17	38792183	-	RARA	chr17	38511515	+	0.004713611	0.9952864
ENST00000400122	ENST00000394089	SMARCE1	chr17	38792183	-	RARA	chr17	38511515	+	0.005402209	0.9945978
ENST00000400122	ENST00000425707	SMARCE1	chr17	38792183	-	RARA	chr17	38511515	+	0.004366895	0.99563307
ENST00000400122	ENST00000394086	SMARCE1	chr17	38792183	-	RARA	chr17	38511515	+	0.004721179	0.99527884
ENST00000400122	ENST00000394081	SMARCE1	chr17	38792183	-	RARA	chr17	38511515	+	0.004721179	0.99527884
ENST00000544009	ENST00000254066	SMARCE1	chr17	38792182	-	RARA	chr17	38511514	+	0.00475625	0.9952437
ENST00000544009	ENST00000394089	SMARCE1	chr17	38792182	-	RARA	chr17	38511514	+	0.005135478	0.9948645
ENST00000544009	ENST00000425707	SMARCE1	chr17	38792182	-	RARA	chr17	38511514	+	0.004582485	0.9954175
ENST00000544009	ENST00000394086	SMARCE1	chr17	38792182	-	RARA	chr17	38511514	+	0.004762658	0.99523735
ENST00000544009	ENST00000394081	SMARCE1	chr17	38792182	-	RARA	chr17	38511514	+	0.004762658	0.99523735
ENST00000377808	ENST00000254066	SMARCE1	chr17	38792182	-	RARA	chr17	38511514	+	0.006681904	0.9933181
ENST00000377808	ENST00000394089	SMARCE1	chr17	38792182	-	RARA	chr17	38511514	+	0.008522294	0.99147767
ENST00000377808	ENST00000425707	SMARCE1	chr17	38792182	-	RARA	chr17	38511514	+	0.006151333	0.9938486
ENST00000377808	ENST00000394086	SMARCE1	chr17	38792182	-	RARA	chr17	38511514	+	0.006716357	0.9932836
ENST00000377808	ENST00000394081	SMARCE1	chr17	38792182	-	RARA	chr17	38511514	+	0.006716357	0.9932836
ENST00000400122	ENST00000254066	SMARCE1	chr17	38792182	-	RARA	chr17	38511514	+	0.004713611	0.9952864
ENST00000400122	ENST00000394089	SMARCE1	chr17	38792182	-	RARA	chr17	38511514	+	0.005402209	0.9945978
ENST00000400122	ENST00000425707	SMARCE1	chr17	38792182	-	RARA	chr17	38511514	+	0.004366895	0.99563307
ENST00000400122	ENST00000394086	SMARCE1	chr17	38792182	-	RARA	chr17	38511514	+	0.004721179	0.99527884
ENST00000400122	ENST00000394081	SMARCE1	chr17	38792182	-	RARA	chr17	38511514	+	0.004721179	0.99527884

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for SMARCE1-RARA

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
SMARCE1	chr17	38792182	RARA	chr17	38511514	438	111	EPYMSIQPAEDPDDRQDLEQPDRVDM
SMARCE1	chr17	38792182	RARA	chr17	38511514	483	111	EPYMSIQPAEDPDDRQDLEQPDRVDM
SMARCE1	chr17	38792182	RARA	chr17	38511514	527	145	EPYMSIQPAEDPDDRQDLEQPDRVDM
SMARCE1	chr17	38792183	RARA	chr17	38511515	438	111	EPYMSIQPAEDPDDRQDLEQPDRVDM
SMARCE1	chr17	38792183	RARA	chr17	38511515	483	111	EPYMSIQPAEDPDDRQDLEQPDRVDM
SMARCE1	chr17	38792183	RARA	chr17	38511515	527	145	EPYMSIQPAEDPDDRQDLEQPDRVDM

Top

Potential FusionNeoAntigen Information of SMARCE1-RARA in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

SMARCE1-RARA_38792182_38511514.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
SMARCE1-RARA	chr17	38792182	chr17	38511514	527	HLA-B39:13	AEDPDDRQDL	0.8552	0.936	8	18
SMARCE1-RARA	chr17	38792182	chr17	38511514	527	HLA-B39:08	AEDPDDRQDL	0.9626	0.8825	8	18
SMARCE1-RARA	chr17	38792182	chr17	38511514	527	HLA-B40:04	AEDPDDRQDL	0.9936	0.677	8	18
SMARCE1-RARA	chr17	38792182	chr17	38511514	527	HLA-B41:03	AEDPDDRQDL	0.8509	0.7598	8	18

Top

Potential FusionNeoAntigen Information of SMARCE1-RARA in HLA II

SMARCE1-RARA_38792182_38511514.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
SMARCE1-RARA	chr17	38792182	chr17	38511514	527	DRB1-0405	EPYMSIQPAEDPDDR	0	15
SMARCE1-RARA	chr17	38792182	chr17	38511514	527	DRB1-0409	EPYMSIQPAEDPDDR	0	15
SMARCE1-RARA	chr17	38792182	chr17	38511514	527	DRB1-0411	YMSIQPAEDPDDRQD	2	17
SMARCE1-RARA	chr17	38792182	chr17	38511514	527	DRB1-0411	EPYMSIQPAEDPDDR	0	15
SMARCE1-RARA	chr17	38792182	chr17	38511514	527	DRB1-0411	PYMSIQPAEDPDDRQ	1	16
SMARCE1-RARA	chr17	38792182	chr17	38511514	527	DRB1-0417	EPYMSIQPAEDPDDR	0	15
SMARCE1-RARA	chr17	38792182	chr17	38511514	527	DRB1-0424	EPYMSIQPAEDPDDR	0	15
SMARCE1-RARA	chr17	38792182	chr17	38511514	527	DRB1-0429	EPYMSIQPAEDPDDR	0	15
SMARCE1-RARA	chr17	38792182	chr17	38511514	527	DRB1-0430	EPYMSIQPAEDPDDR	0	15
SMARCE1-RARA	chr17	38792182	chr17	38511514	527	DRB1-0445	EPYMSIQPAEDPDDR	0	15
SMARCE1-RARA	chr17	38792182	chr17	38511514	527	DRB1-0448	EPYMSIQPAEDPDDR	0	15
SMARCE1-RARA	chr17	38792182	chr17	38511514	527	DRB1-0457	EPYMSIQPAEDPDDR	0	15
SMARCE1-RARA	chr17	38792182	chr17	38511514	527	DRB1-0462	EPYMSIQPAEDPDDR	0	15
SMARCE1-RARA	chr17	38792182	chr17	38511514	527	DRB1-0467	YMSIQPAEDPDDRQD	2	17
SMARCE1-RARA	chr17	38792182	chr17	38511514	527	DRB1-0467	PYMSIQPAEDPDDRQ	1	16
SMARCE1-RARA	chr17	38792182	chr17	38511514	527	DRB1-0467	EPYMSIQPAEDPDDR	0	15
SMARCE1-RARA	chr17	38792182	chr17	38511514	527	DRB1-0469	EPYMSIQPAEDPDDR	0	15
SMARCE1-RARA	chr17	38792182	chr17	38511514	527	DRB1-0477	EPYMSIQPAEDPDDR	0	15
SMARCE1-RARA	chr17	38792182	chr17	38511514	527	DRB1-0480	EPYMSIQPAEDPDDR	0	15
SMARCE1-RARA	chr17	38792182	chr17	38511514	527	DRB1-0482	EPYMSIQPAEDPDDR	0	15
SMARCE1-RARA	chr17	38792182	chr17	38511514	527	DRB1-0483	EPYMSIQPAEDPDDR	0	15
SMARCE1-RARA	chr17	38792182	chr17	38511514	527	DRB1-0484	EPYMSIQPAEDPDDR	0	15
SMARCE1-RARA	chr17	38792182	chr17	38511514	527	DRB1-0486	EPYMSIQPAEDPDDR	0	15
SMARCE1-RARA	chr17	38792182	chr17	38511514	527	DRB1-0487	EPYMSIQPAEDPDDR	0	15
SMARCE1-RARA	chr17	38792182	chr17	38511514	527	DRB1-0489	EPYMSIQPAEDPDDR	0	15
SMARCE1-RARA	chr17	38792182	chr17	38511514	527	DRB1-0491	YMSIQPAEDPDDRQD	2	17
SMARCE1-RARA	chr17	38792182	chr17	38511514	527	DRB1-0491	EPYMSIQPAEDPDDR	0	15
SMARCE1-RARA	chr17	38792182	chr17	38511514	527	DRB1-0491	PYMSIQPAEDPDDRQ	1	16
SMARCE1-RARA	chr17	38792182	chr17	38511514	527	DRB1-0803	EPYMSIQPAEDPDDR	0	15
SMARCE1-RARA	chr17	38792182	chr17	38511514	527	DRB1-0805	EPYMSIQPAEDPDDR	0	15
SMARCE1-RARA	chr17	38792182	chr17	38511514	527	DRB1-0814	EPYMSIQPAEDPDDR	0	15
SMARCE1-RARA	chr17	38792182	chr17	38511514	527	DRB1-0818	EPYMSIQPAEDPDDR	0	15
SMARCE1-RARA	chr17	38792182	chr17	38511514	527	DRB1-0823	EPYMSIQPAEDPDDR	0	15
SMARCE1-RARA	chr17	38792182	chr17	38511514	527	DRB1-0827	EPYMSIQPAEDPDDR	0	15
SMARCE1-RARA	chr17	38792182	chr17	38511514	527	DRB1-0829	EPYMSIQPAEDPDDR	0	15
SMARCE1-RARA	chr17	38792182	chr17	38511514	527	DRB1-0832	EPYMSIQPAEDPDDR	0	15
SMARCE1-RARA	chr17	38792182	chr17	38511514	527	DRB1-0833	EPYMSIQPAEDPDDR	0	15
SMARCE1-RARA	chr17	38792182	chr17	38511514	527	DRB1-0835	EPYMSIQPAEDPDDR	0	15
SMARCE1-RARA	chr17	38792182	chr17	38511514	527	DRB1-0836	EPYMSIQPAEDPDDR	0	15
SMARCE1-RARA	chr17	38792182	chr17	38511514	527	DRB1-0838	EPYMSIQPAEDPDDR	0	15
SMARCE1-RARA	chr17	38792182	chr17	38511514	527	DRB1-0840	EPYMSIQPAEDPDDR	0	15
SMARCE1-RARA	chr17	38792182	chr17	38511514	527	DRB1-0908	EPYMSIQPAEDPDDR	0	15
SMARCE1-RARA	chr17	38792182	chr17	38511514	527	DRB1-1001	EPYMSIQPAEDPDDR	0	15
SMARCE1-RARA	chr17	38792182	chr17	38511514	527	DRB1-1003	EPYMSIQPAEDPDDR	0	15

Top

Fusion breakpoint peptide structures of SMARCE1-RARA

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
7446	QPAEDPDDRQDLEQ	SMARCE1	RARA	chr17	38792182	chr17	38511514	527

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of SMARCE1-RARA

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	7446	QPAEDPDDRQDLEQ	-7.15543	-7.26883
HLA-B14:02	3BVN	7446	QPAEDPDDRQDLEQ	-4.77435	-5.80965
HLA-B52:01	3W39	7446	QPAEDPDDRQDLEQ	-6.80875	-6.92215
HLA-B52:01	3W39	7446	QPAEDPDDRQDLEQ	-4.20386	-5.23916
HLA-A11:01	4UQ2	7446	QPAEDPDDRQDLEQ	-7.5194	-8.5547
HLA-A11:01	4UQ2	7446	QPAEDPDDRQDLEQ	-6.9601	-7.0735
HLA-A24:02	5HGA	7446	QPAEDPDDRQDLEQ	-7.52403	-7.63743
HLA-A24:02	5HGA	7446	QPAEDPDDRQDLEQ	-5.82433	-6.85963
HLA-B27:05	6PYJ	7446	QPAEDPDDRQDLEQ	-3.28285	-4.31815
HLA-B44:05	3DX8	7446	QPAEDPDDRQDLEQ	-5.91172	-6.94702
HLA-B44:05	3DX8	7446	QPAEDPDDRQDLEQ	-4.24346	-4.35686

Top

Vaccine Design for the FusionNeoAntigens of SMARCE1-RARA

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
SMARCE1-RARA	chr17	38792182	chr17	38511514	8	18	AEDPDDRQDL	CTGAAGATCCAGATGACCGCCAGGACCTGG

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
SMARCE1-RARA	chr17	38792182	chr17	38511514	0	15	EPYMSIQPAEDPDDR	AACCGTACATGAGCATTCAGCCTGCTGAAGATCCAGATGACCGCC
SMARCE1-RARA	chr17	38792182	chr17	38511514	1	16	PYMSIQPAEDPDDRQ	CGTACATGAGCATTCAGCCTGCTGAAGATCCAGATGACCGCCAGG
SMARCE1-RARA	chr17	38792182	chr17	38511514	2	17	YMSIQPAEDPDDRQD	ACATGAGCATTCAGCCTGCTGAAGATCCAGATGACCGCCAGGACC

Top

Information of the samples that have these potential fusion neoantigens of SMARCE1-RARA

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
READ	SMARCE1-RARA	chr17	38792182	ENST00000377808	chr17	38511514	ENST00000254066	TCGA-AH-6643

Top

Potential target of CAR-T therapy development for SMARCE1-RARA

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to SMARCE1-RARA

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to SMARCE1-RARA

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner	Gene	Disease ID	Disease name	# pubmeds	Source
Tgene	RARA	C0023487	Acute Promyelocytic Leukemia	24	CTD_human;ORPHANET
Tgene	RARA	C0036341	Schizophrenia	3	PSYGENET
Tgene	RARA	C0006142	Malignant neoplasm of breast	1	CTD_human
Tgene	RARA	C0009363	Congenital ocular coloboma (disorder)	1	GENOMICS_ENGLAND
Tgene	RARA	C0010701	Phyllodes Tumor	1	CTD_human
Tgene	RARA	C0085183	Neoplasms, Second Primary	1	CTD_human
Tgene	RARA	C0086696	Neoplasms, Therapy-Associated	1	CTD_human
Tgene	RARA	C0149940	Sciatic Neuropathy	1	CTD_human
Tgene	RARA	C0154748	Lesion of Sciatic Nerve	1	CTD_human
Tgene	RARA	C0206650	Fibroadenoma	1	CTD_human
Tgene	RARA	C0242013	Sciatic Neuritis	1	CTD_human
Tgene	RARA	C0525045	Mood Disorders	1	PSYGENET
Tgene	RARA	C0600066	Malignant Cystosarcoma Phyllodes	1	CTD_human
Tgene	RARA	C0678222	Breast Carcinoma	1	CTD_human
Tgene	RARA	C0751924	Neuralgia-Neuritis, Sciatic Nerve	1	CTD_human
Tgene	RARA	C0751925	Sciatic Nerve Palsy	1	CTD_human
Tgene	RARA	C0877578	Treatment related secondary malignancy	1	CTD_human
Tgene	RARA	C1257931	Mammary Neoplasms, Human	1	CTD_human
Tgene	RARA	C1458155	Mammary Neoplasms	1	CTD_human
Tgene	RARA	C2239176	Liver carcinoma	1	CTD_human
Tgene	RARA	C4704874	Mammary Carcinoma, Human	1	CTD_human

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)