![]() |
|||||||
|
Fusion Protein:SMS-DYRK2 |
Fusion Gene and Fusion Protein Summary |
![]() |
Fusion partner gene information | Fusion gene name: SMS-DYRK2 | FusionPDB ID: 84280 | FusionGDB2.0 ID: 84280 | Hgene | Tgene | Gene symbol | SMS | DYRK2 | Gene ID | 10743 | 8445 |
Gene name | retinoic acid induced 1 | dual specificity tyrosine phosphorylation regulated kinase 2 | |
Synonyms | SMCR|SMS | - | |
Cytomap | 17p11.2 | 12q15 | |
Type of gene | protein-coding | protein-coding | |
Description | retinoic acid-induced protein 1Smith-Magenis syndrome chromosome region | dual specificity tyrosine-phosphorylation-regulated kinase 2dual specificity tyrosine-(Y)-phosphorylation regulated kinase 2 | |
Modification date | 20200313 | 20200313 | |
UniProtAcc | . | Q92630 Main function of 5'-partner protein: FUNCTION: Serine/threonine-protein kinase involved in the regulation of the mitotic cell cycle, cell proliferation, apoptosis, organization of the cytoskeleton and neurite outgrowth. Functions in part via its role in ubiquitin-dependent proteasomal protein degradation. Functions downstream of ATM and phosphorylates p53/TP53 at 'Ser-46', and thereby contributes to the induction of apoptosis in response to DNA damage. Phosphorylates NFATC1, and thereby inhibits its accumulation in the nucleus and its transcription factor activity. Phosphorylates EIF2B5 at 'Ser-544', enabling its subsequent phosphorylation and inhibition by GSK3B. Likewise, phosphorylation of NFATC1, CRMP2/DPYSL2 and CRMP4/DPYSL3 promotes their subsequent phosphorylation by GSK3B. May play a general role in the priming of GSK3 substrates. Inactivates GYS1 by phosphorylation at 'Ser-641', and potentially also a second phosphorylation site, thus regulating glycogen synthesis. Mediates EDVP E3 ligase complex formation and is required for the phosphorylation and subsequent degradation of KATNA1. Phosphorylates TERT at 'Ser-457', promoting TERT ubiquitination by the EDVP complex. Phosphorylates SIAH2, and thereby increases its ubiquitin ligase activity. Promotes the proteasomal degradation of MYC and JUN, and thereby regulates progress through the mitotic cell cycle and cell proliferation. Promotes proteasomal degradation of GLI2 and GLI3, and thereby plays a role in smoothened and sonic hedgehog signaling. Plays a role in cytoskeleton organization and neurite outgrowth via its phosphorylation of DCX and DPYSL2. Phosphorylates CRMP2/DPYSL2, CRMP4/DPYSL3, DCX, EIF2B5, EIF4EBP1, GLI2, GLI3, GYS1, JUN, MDM2, MYC, NFATC1, p53/TP53, TAU/MAPT and KATNA1. Can phosphorylate histone H1, histone H3 and histone H2B (in vitro). Can phosphorylate CARHSP1 (in vitro). {ECO:0000269|PubMed:11311121, ECO:0000269|PubMed:12588975, ECO:0000269|PubMed:14593110, ECO:0000269|PubMed:15910284, ECO:0000269|PubMed:16511445, ECO:0000269|PubMed:16611631, ECO:0000269|PubMed:17349958, ECO:0000269|PubMed:18455992, ECO:0000269|PubMed:18599021, ECO:0000269|PubMed:19287380, ECO:0000269|PubMed:22307329, ECO:0000269|PubMed:22878263, ECO:0000269|PubMed:23362280, ECO:0000269|PubMed:9748265}. | |
Ensembl transtripts involved in fusion gene | ENST ids | ENST00000478094, ENST00000379404, ENST00000404933, ENST00000415881, | ENST00000344096, ENST00000537632, ENST00000393555, |
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0) | * DoF score | 4 X 1 X 4=16 | 8 X 5 X 7=280 |
# samples | 4 | 8 | |
** MAII score | log2(4/16*10)=1.32192809488736 effective Gene in Pan-Cancer Fusion Genes (eGinPCFGs). DoF>8 and MAII>0 | log2(8/280*10)=-1.8073549220576 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0 | |
Fusion gene context | PubMed: SMS [Title/Abstract] AND DYRK2 [Title/Abstract] AND fusion [Title/Abstract] | ||
Fusion neoantigen context | PubMed: SMS [Title/Abstract] AND DYRK2 [Title/Abstract] AND neoantigen [Title/Abstract] | ||
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0) | SMS(21958991)-DYRK2(68043577), # samples:2 | ||
Anticipated loss of major functional domain due to fusion event. | SMS-DYRK2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. SMS-DYRK2 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. SMS-DYRK2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. SMS-DYRK2 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. SMS-DYRK2 seems lost the major protein functional domain in Hgene partner, which is a cell metabolism gene due to the frame-shifted ORF. SMS-DYRK2 seems lost the major protein functional domain in Hgene partner, which is a essential gene due to the frame-shifted ORF. SMS-DYRK2 seems lost the major protein functional domain in Tgene partner, which is a essential gene due to the frame-shifted ORF. SMS-DYRK2 seems lost the major protein functional domain in Tgene partner, which is a IUPHAR drug target due to the frame-shifted ORF. SMS-DYRK2 seems lost the major protein functional domain in Tgene partner, which is a kinase due to the frame-shifted ORF. |
* DoF score (Degree of Frequency) = # partners X # break points X # cancer types ** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10) |
![]() |
Partner | Gene | GO ID | GO term | PubMed ID |
Hgene | SMS | GO:0045893 | positive regulation of transcription, DNA-templated | 22578325 |
Tgene | DYRK2 | GO:0006468 | protein phosphorylation | 11311121 |
Tgene | DYRK2 | GO:0042771 | intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator | 17349958 |
Tgene | DYRK2 | GO:0045725 | positive regulation of glycogen biosynthetic process | 11311121 |
![]() Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chrX:21958991/chr12:68043577) - FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels. - How to search 1. Put your fusion gene symbol. 2. Press the tab key until there will be shown the breakpoint information filled. 4. Go down and press 'Search' tab twice. 4. Go down to have the hyperlink of the search result. 5. Click the hyperlink. 6. See the FGviewer result for your fusion gene. |
![]() |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
![]() * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
![]() |
Top |
Fusion Amino Acid Sequences |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | Seq length (transcript) | BP loci (transcript) | Predicted start (transcript) | Predicted stop (transcript) | Seq length (amino acids) |
ENST00000404933 | SMS | chrX | 21958991 | + | ENST00000344096 | DYRK2 | chr12 | 68043577 | + | 8751 | 301 | 252 | 2057 | 601 |
ENST00000379404 | SMS | chrX | 21958991 | + | ENST00000344096 | DYRK2 | chr12 | 68043577 | + | 8609 | 159 | 110 | 1915 | 601 |
![]() |
Henst | Tenst | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand | No-coding score | Coding score |
ENST00000404933 | ENST00000344096 | SMS | chrX | 21958991 | + | DYRK2 | chr12 | 68043577 | + | 0.000686637 | 0.99931335 |
ENST00000379404 | ENST00000344096 | SMS | chrX | 21958991 | + | DYRK2 | chr12 | 68043577 | + | 0.000671921 | 0.99932814 |
![]() |
Get the fusion protein sequences from here. |
Fusion protein sequence information is available in the fasta format. >FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP |
Top |
Fusion Protein Breakpoint Sequences for SMS-DYRK2 |
![]() |
Hgene | Hchr | Hbp | Tgene | Tchr | Tbp | Length(fusion protein) | BP in fusion protein | Peptide |
SMS | chrX | 21958991 | DYRK2 | chr12 | 68043577 | 159 | 16 | ARHSTLDFMLGAKGRGGDSAVRQLQA |
SMS | chrX | 21958991 | DYRK2 | chr12 | 68043577 | 301 | 16 | ARHSTLDFMLGAKGRGGDSAVRQLQA |
Top |
Potential FusionNeoAntigen Information of SMS-DYRK2 in HLA I |
![]() |
SMS-DYRK2_21958991_68043577.msa |
![]() * We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5) |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA I | FusionNeoAntigen peptide | Binding score | Immunogenic score | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
SMS-DYRK2 | chrX | 21958991 | chr12 | 68043577 | 159 | HLA-A33:01 | DFMLGAKGR | 0.9925 | 0.6026 | 6 | 15 |
SMS-DYRK2 | chrX | 21958991 | chr12 | 68043577 | 159 | HLA-A33:05 | DFMLGAKGR | 0.9925 | 0.6026 | 6 | 15 |
SMS-DYRK2 | chrX | 21958991 | chr12 | 68043577 | 159 | HLA-A33:03 | DFMLGAKGR | 0.9034 | 0.5241 | 6 | 15 |
Top |
Potential FusionNeoAntigen Information of SMS-DYRK2 in HLA II |
![]() |
![]() * We used NetMHCIIpan v4.1 (%rank<0.5). |
Fusion gene | Hchr | Hbp | Tgene | Tchr | Tbp | HLA II | FusionNeoAntigen peptide | Neoantigen start (at BP 13) | Neoantigen end (at BP 13) |
Top |
Fusion breakpoint peptide structures of SMS-DYRK2 |
![]() * The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA. |
File name | BPseq | Hgene | Tgene | Hchr | Hbp | Tchr | Tbp | AAlen |
1094 | DFMLGAKGRGGDSA | SMS | DYRK2 | chrX | 21958991 | chr12 | 68043577 | 159 |
Top |
Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of SMS-DYRK2 |
![]() * We used Glide to predict the interaction between HLAs and neoantigens. |
HLA allele | PDB ID | File name | BPseq | Docking score | Glide score |
HLA-B14:02 | 3BVN | 1094 | DFMLGAKGRGGDSA | -5.34942 | -6.38472 |
HLA-B14:02 | 3BVN | 1094 | DFMLGAKGRGGDSA | -5.0153 | -5.1287 |
HLA-B52:01 | 3W39 | 1094 | DFMLGAKGRGGDSA | -7.47358 | -7.58698 |
HLA-B52:01 | 3W39 | 1094 | DFMLGAKGRGGDSA | -4.5023 | -5.5376 |
HLA-A11:01 | 4UQ2 | 1094 | DFMLGAKGRGGDSA | -7.49832 | -7.61172 |
HLA-A24:02 | 5HGA | 1094 | DFMLGAKGRGGDSA | -8.30687 | -8.42027 |
HLA-A24:02 | 5HGA | 1094 | DFMLGAKGRGGDSA | -5.37786 | -6.41316 |
HLA-B27:05 | 6PYJ | 1094 | DFMLGAKGRGGDSA | -6.81213 | -7.84743 |
HLA-B44:05 | 3DX8 | 1094 | DFMLGAKGRGGDSA | -9.00919 | -9.12259 |
HLA-B44:05 | 3DX8 | 1094 | DFMLGAKGRGGDSA | -3.81824 | -4.85354 |
Top |
Vaccine Design for the FusionNeoAntigens of SMS-DYRK2 |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide sequence | FusionNeoAntigen RNA sequence |
SMS-DYRK2 | chrX | 21958991 | chr12 | 68043577 | 6 | 15 | DFMLGAKGR | ACTTCATGCTCGGCGCCAAAGGCCGAG |
![]() |
Fusion gene | Hchr | Hbp | Tchr | Tbp | Start in +/-13AA | End in +/-13AA | FusionNeoAntigen peptide | FusionNEoAntigen RNA sequence |
Top |
Information of the samples that have these potential fusion neoantigens of SMS-DYRK2 |
![]() |
Cancer type | Fusion gene | Hchr | Hbp | Henst | Tchr | Tbp | Tenst | Sample |
BRCA | SMS-DYRK2 | chrX | 21958991 | ENST00000379404 | chr12 | 68043577 | ENST00000344096 | TCGA-E2-A14T-01A |
Top |
Potential target of CAR-T therapy development for SMS-DYRK2 |
![]() |
![]() * Minus value of BPloci means that the break point is located before the CDS. |
- In-frame and retained 'Transmembrane'. |
Partner | Gene | Hbp | Tbp | ENST | Strand | BPexon | TotalExon | Protein feature loci | *BPloci | TotalLen | Protein feature | Protein feature note |
![]() * We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image. |
Hgene | Hchr | Hbp | Henst | Tgene | Tchr | Tbp | Tenst | DeepLoc result |
Top |
Related Drugs to SMS-DYRK2 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Drug | Source | PMID |
Top |
Related Diseases to SMS-DYRK2 |
![]() (Manual curation of PubMed, 04-30-2022 + MyCancerGenome) |
Hgene | Tgene | Disease | Source | PMID |
![]() (DisGeNet 4.0) |
Partner | Gene | Disease ID | Disease name | # pubmeds | Source |