Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:TCF4-PMAIP1

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: TCF4-PMAIP1
	FusionPDB ID: 89790
	FusionGDB2.0 ID: 89790
		Hgene	Tgene
	Gene symbol	TCF4	PMAIP1
	Gene ID	6934	5366
	Gene name	transcription factor 7 like 2	phorbol-12-myristate-13-acetate-induced protein 1
	Synonyms	TCF-4\|TCF4	APR\|NOXA
	Cytomap	10q25.2-q25.3	18q21.32
	Type of gene	protein-coding	protein-coding
	Description	transcription factor 7-like 2HMG box transcription factor 4T-cell factor 4T-cell-specific transcription factor 4hTCF-4transcription factor 7-like 2 (T-cell specific, HMG-box)	phorbol-12-myristate-13-acetate-induced protein 1PMA-induced protein 1adult T cell leukemia-derived PMA-responsiveimmediate-early-response protein APRprotein Noxa
	Modification date	20200315	20200313
	UniProtAcc	.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000563760, ENST00000354452, ENST00000356073, ENST00000537578, ENST00000537856, ENST00000540999, ENST00000561992, ENST00000564999, ENST00000566279, ENST00000568673, ENST00000568740, ENST00000398339, ENST00000457482, ENST00000543082, ENST00000544241, ENST00000561831, ENST00000564228, ENST00000564403, ENST00000565018, ENST00000566286, ENST00000567880, ENST00000570177, ENST00000570287,	ENST00000269518, ENST00000316660,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	13 X 13 X 4=676	1 X 1 X 1=1
	# samples	13	1
	** MAII score	log2(13/676*10)=-2.37851162325373 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(1/1*10)=3.32192809488736
Fusion gene context	PubMed: TCF4 [Title/Abstract] AND PMAIP1 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: TCF4 [Title/Abstract] AND PMAIP1 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	TCF4(52928696)-PMAIP1(57569878), # samples:1
Anticipated loss of major functional domain due to fusion event.	TCF4-PMAIP1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. TCF4-PMAIP1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. TCF4-PMAIP1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. TCF4-PMAIP1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. TCF4-PMAIP1 seems lost the major protein functional domain in Hgene partner, which is a transcription factor due to the frame-shifted ORF. TCF4-PMAIP1 seems lost the major protein functional domain in Hgene partner, which is a tumor suppressor due to the frame-shifted ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	TCF4	GO:0000122	negative regulation of transcription by RNA polymerase II	12799378
Hgene	TCF4	GO:0006357	regulation of transcription by RNA polymerase II	9727977
Hgene	TCF4	GO:0032092	positive regulation of protein binding	12799378
Hgene	TCF4	GO:0032350	regulation of hormone metabolic process	15525634
Hgene	TCF4	GO:0042593	glucose homeostasis	15525634
Hgene	TCF4	GO:0043433	negative regulation of DNA-binding transcription factor activity	12799378
Hgene	TCF4	GO:0045444	fat cell differentiation	10937998
Hgene	TCF4	GO:0045892	negative regulation of transcription, DNA-templated	12799378\|15525634
Hgene	TCF4	GO:0045944	positive regulation of transcription by RNA polymerase II	9065401\|19168596
Hgene	TCF4	GO:0048625	myoblast fate commitment	10937998
Tgene	PMAIP1	GO:0010498	proteasomal protein catabolic process	15901672
Tgene	PMAIP1	GO:0010907	positive regulation of glucose metabolic process	21145489
Tgene	PMAIP1	GO:0043065	positive regulation of apoptotic process	21145489
Tgene	PMAIP1	GO:0043280	positive regulation of cysteine-type endopeptidase activity involved in apoptotic process	14699081
Tgene	PMAIP1	GO:0043331	response to dsRNA	15705586
Tgene	PMAIP1	GO:0046902	regulation of mitochondrial membrane permeability	14500711
Tgene	PMAIP1	GO:0051607	defense response to virus	15705586
Tgene	PMAIP1	GO:0072593	reactive oxygen species metabolic process	14699081
Tgene	PMAIP1	GO:0090200	positive regulation of release of cytochrome c from mitochondria	14500711\|14699081\|15705586
Tgene	PMAIP1	GO:0097193	intrinsic apoptotic signaling pathway	14500711
Tgene	PMAIP1	GO:1902043	positive regulation of extrinsic apoptotic signaling pathway via death domain receptors	15705586
Tgene	PMAIP1	GO:2001244	positive regulation of intrinsic apoptotic signaling pathway	21454712

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr18:52928696/chr18:57569878)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across TCF4 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across PMAIP1 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000457482	TCF4	chr18	52928696	-	ENST00000316660	PMAIP1	chr18	57569878	+	2726	1066	556	1116	186
ENST00000457482	TCF4	chr18	52928696	-	ENST00000269518	PMAIP1	chr18	57569878	+	1957	1066	556	1116	186
ENST00000543082	TCF4	chr18	52928696	-	ENST00000316660	PMAIP1	chr18	57569878	+	2696	1036	172	1086	304
ENST00000543082	TCF4	chr18	52928696	-	ENST00000269518	PMAIP1	chr18	57569878	+	1927	1036	172	1086	304
ENST00000544241	TCF4	chr18	52928696	-	ENST00000316660	PMAIP1	chr18	57569878	+	2718	1058	206	1108	300
ENST00000544241	TCF4	chr18	52928696	-	ENST00000269518	PMAIP1	chr18	57569878	+	1949	1058	206	1108	300
ENST00000561831	TCF4	chr18	52928696	-	ENST00000316660	PMAIP1	chr18	57569878	+	2312	652	142	702	186
ENST00000561831	TCF4	chr18	52928696	-	ENST00000269518	PMAIP1	chr18	57569878	+	1543	652	142	702	186
ENST00000565018	TCF4	chr18	52928696	-	ENST00000316660	PMAIP1	chr18	57569878	+	2894	1234	226	1284	352
ENST00000565018	TCF4	chr18	52928696	-	ENST00000269518	PMAIP1	chr18	57569878	+	2125	1234	226	1284	352
ENST00000570287	TCF4	chr18	52928696	-	ENST00000316660	PMAIP1	chr18	57569878	+	2418	758	248	808	186
ENST00000570287	TCF4	chr18	52928696	-	ENST00000269518	PMAIP1	chr18	57569878	+	1649	758	248	808	186
ENST00000564228	TCF4	chr18	52928696	-	ENST00000316660	PMAIP1	chr18	57569878	+	2437	777	0	827	275
ENST00000564228	TCF4	chr18	52928696	-	ENST00000269518	PMAIP1	chr18	57569878	+	1668	777	0	827	275
ENST00000567880	TCF4	chr18	52928696	-	ENST00000316660	PMAIP1	chr18	57569878	+	2470	810	0	860	286
ENST00000567880	TCF4	chr18	52928696	-	ENST00000269518	PMAIP1	chr18	57569878	+	1701	810	0	860	286
ENST00000566286	TCF4	chr18	52928696	-	ENST00000316660	PMAIP1	chr18	57569878	+	2644	984	0	1034	344
ENST00000566286	TCF4	chr18	52928696	-	ENST00000269518	PMAIP1	chr18	57569878	+	1875	984	0	1034	344
ENST00000564403	TCF4	chr18	52928696	-	ENST00000316660	PMAIP1	chr18	57569878	+	3195	1535	509	1585	358
ENST00000564403	TCF4	chr18	52928696	-	ENST00000269518	PMAIP1	chr18	57569878	+	2426	1535	509	1585	358
ENST00000398339	TCF4	chr18	52928696	-	ENST00000316660	PMAIP1	chr18	57569878	+	3013	1353	57	1403	448
ENST00000398339	TCF4	chr18	52928696	-	ENST00000269518	PMAIP1	chr18	57569878	+	2244	1353	57	1403	448
ENST00000570177	TCF4	chr18	52928696	-	ENST00000316660	PMAIP1	chr18	57569878	+	2467	807	78	857	259
ENST00000570177	TCF4	chr18	52928696	-	ENST00000269518	PMAIP1	chr18	57569878	+	1698	807	78	857	259

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000457482	ENST00000316660	TCF4	chr18	52928696	-	PMAIP1	chr18	57569878	+	0.006407169	0.9935928
ENST00000457482	ENST00000269518	TCF4	chr18	52928696	-	PMAIP1	chr18	57569878	+	0.00835058	0.9916494
ENST00000543082	ENST00000316660	TCF4	chr18	52928696	-	PMAIP1	chr18	57569878	+	0.002013767	0.9979862
ENST00000543082	ENST00000269518	TCF4	chr18	52928696	-	PMAIP1	chr18	57569878	+	0.003939969	0.99605995
ENST00000544241	ENST00000316660	TCF4	chr18	52928696	-	PMAIP1	chr18	57569878	+	0.004059686	0.9959403
ENST00000544241	ENST00000269518	TCF4	chr18	52928696	-	PMAIP1	chr18	57569878	+	0.009457395	0.9905426
ENST00000561831	ENST00000316660	TCF4	chr18	52928696	-	PMAIP1	chr18	57569878	+	0.009641758	0.9903583
ENST00000561831	ENST00000269518	TCF4	chr18	52928696	-	PMAIP1	chr18	57569878	+	0.005937181	0.99406284
ENST00000565018	ENST00000316660	TCF4	chr18	52928696	-	PMAIP1	chr18	57569878	+	0.00051114	0.99948883
ENST00000565018	ENST00000269518	TCF4	chr18	52928696	-	PMAIP1	chr18	57569878	+	0.001531433	0.9984686
ENST00000570287	ENST00000316660	TCF4	chr18	52928696	-	PMAIP1	chr18	57569878	+	0.003656583	0.99634343
ENST00000570287	ENST00000269518	TCF4	chr18	52928696	-	PMAIP1	chr18	57569878	+	0.003230559	0.9967694
ENST00000564228	ENST00000316660	TCF4	chr18	52928696	-	PMAIP1	chr18	57569878	+	0.003408811	0.9965912
ENST00000564228	ENST00000269518	TCF4	chr18	52928696	-	PMAIP1	chr18	57569878	+	0.005533247	0.99446684
ENST00000567880	ENST00000316660	TCF4	chr18	52928696	-	PMAIP1	chr18	57569878	+	0.001649327	0.99835074
ENST00000567880	ENST00000269518	TCF4	chr18	52928696	-	PMAIP1	chr18	57569878	+	0.004485298	0.9955147
ENST00000566286	ENST00000316660	TCF4	chr18	52928696	-	PMAIP1	chr18	57569878	+	0.000587103	0.9994129
ENST00000566286	ENST00000269518	TCF4	chr18	52928696	-	PMAIP1	chr18	57569878	+	0.001736882	0.9982632
ENST00000564403	ENST00000316660	TCF4	chr18	52928696	-	PMAIP1	chr18	57569878	+	0.000536265	0.99946374
ENST00000564403	ENST00000269518	TCF4	chr18	52928696	-	PMAIP1	chr18	57569878	+	0.001314424	0.99868554
ENST00000398339	ENST00000316660	TCF4	chr18	52928696	-	PMAIP1	chr18	57569878	+	0.001148821	0.9988512
ENST00000398339	ENST00000269518	TCF4	chr18	52928696	-	PMAIP1	chr18	57569878	+	0.003920073	0.99608
ENST00000570177	ENST00000316660	TCF4	chr18	52928696	-	PMAIP1	chr18	57569878	+	0.003817587	0.9961824
ENST00000570177	ENST00000269518	TCF4	chr18	52928696	-	PMAIP1	chr18	57569878	+	0.003958613	0.9960414

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for TCF4-PMAIP1

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
TCF4	chr18	52928696	PMAIP1	chr18	57569878	1036	288	SQTGDALGKALASSWKSSVLLNSGDL
TCF4	chr18	52928696	PMAIP1	chr18	57569878	1058	284	SQTGDALGKALASSWKSSVLLNSGDL
TCF4	chr18	52928696	PMAIP1	chr18	57569878	1066	170	SQTGDALGKALASSWKSSVLLNSGDL
TCF4	chr18	52928696	PMAIP1	chr18	57569878	1234	336	SQTGDALGKALASSWKSSVLLNSGDL
TCF4	chr18	52928696	PMAIP1	chr18	57569878	1353	80	FCKHQSKNIISWTGMVAHTCNPSTLG
TCF4	chr18	52928696	PMAIP1	chr18	57569878	1535	342	SQTGDALGKALASSWKSSVLLNSGDL
TCF4	chr18	52928696	PMAIP1	chr18	57569878	652	170	SQTGDALGKALASSWKSSVLLNSGDL
TCF4	chr18	52928696	PMAIP1	chr18	57569878	758	170	SQTGDALGKALASSWKSSVLLNSGDL
TCF4	chr18	52928696	PMAIP1	chr18	57569878	777	259	SQTGDALGKALASSWKSSVLLNSGDL
TCF4	chr18	52928696	PMAIP1	chr18	57569878	807	243	SQTGDALGKALASSWKSSVLLNSGDL
TCF4	chr18	52928696	PMAIP1	chr18	57569878	810	270	SQTGDALGKALASSWKSSVLLNSGDL
TCF4	chr18	52928696	PMAIP1	chr18	57569878	984	328	SQTGDALGKALASSWKSSVLLNSGDL

Top

Potential FusionNeoAntigen Information of TCF4-PMAIP1 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

TCF4-PMAIP1_52928696_57569878.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1066	HLA-B57:01	LGKALASSW	0.9992	0.9955	6	15
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1066	HLA-B58:02	LGKALASSW	0.9977	0.9893	6	15
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1066	HLA-B58:01	LGKALASSW	0.9964	0.994	6	15
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1066	HLA-B15:17	SSWKSSVLL	0.9934	0.9243	12	21
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1066	HLA-B15:16	SSWKSSVLL	0.9896	0.6678	12	21
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1066	HLA-B51:02	LASSWKSSV	0.9843	0.6705	10	19
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1066	HLA-B58:02	SSWKSSVLL	0.9795	0.9375	12	21
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1066	HLA-B57:03	SSWKSSVLL	0.9628	0.9891	12	21
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1066	HLA-A30:08	SSWKSSVLL	0.8736	0.7985	12	21
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1066	HLA-A32:13	SSWKSSVLL	0.7297	0.9656	12	21
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1066	HLA-B52:01	SSWKSSVLL	0.6153	0.865	12	21
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1066	HLA-A02:13	ALASSWKSSV	0.9908	0.8642	9	19
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1066	HLA-B53:01	DALGKALASSW	0.996	0.7292	4	15
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1066	HLA-C15:04	SSWKSSVLL	0.9994	0.9073	12	21
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1066	HLA-C15:06	SSWKSSVLL	0.9992	0.9423	12	21
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1066	HLA-C03:08	ASSWKSSVL	0.9992	0.9416	11	20
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1066	HLA-C03:07	ASSWKSSVL	0.999	0.9878	11	20
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1066	HLA-C03:19	ASSWKSSVL	0.999	0.9909	11	20
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1066	HLA-C03:07	SSWKSSVLL	0.9987	0.9905	12	21
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1066	HLA-C03:19	SSWKSSVLL	0.9984	0.9927	12	21
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1066	HLA-C03:08	SSWKSSVLL	0.9984	0.9421	12	21
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1066	HLA-C15:06	ASSWKSSVL	0.9984	0.9527	11	20
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1066	HLA-C01:17	ASSWKSSVL	0.997	0.9731	11	20
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1066	HLA-C12:04	LASSWKSSV	0.9949	0.9981	10	19
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1066	HLA-C06:03	LASSWKSSV	0.9941	0.9984	10	19
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1066	HLA-C12:12	ASSWKSSVL	0.991	0.9369	11	20
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1066	HLA-C12:12	LASSWKSSV	0.9898	0.9752	10	19
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1066	HLA-C01:30	ASSWKSSVL	0.9225	0.9776	11	20
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1066	HLA-C02:06	ASSWKSSVL	0.8288	0.9872	11	20
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1066	HLA-B44:06	DALGKALASSW	0.9874	0.6118	4	15
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1066	HLA-C03:05	SSWKSSVL	0.9997	0.9529	12	20
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1066	HLA-C03:17	SSWKSSVL	0.9997	0.9862	12	20
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1066	HLA-C16:01	SSWKSSVL	0.9761	0.9857	12	20
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1066	HLA-C15:09	SSWKSSVLL	0.9994	0.9073	12	21
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1066	HLA-C03:04	ASSWKSSVL	0.9992	0.9928	11	20
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1066	HLA-C03:03	ASSWKSSVL	0.9992	0.9928	11	20
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1066	HLA-B57:10	LGKALASSW	0.9992	0.9955	6	15
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1066	HLA-C15:02	SSWKSSVLL	0.9989	0.8994	12	21
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1066	HLA-C15:05	SSWKSSVLL	0.9989	0.9311	12	21
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1066	HLA-C03:05	ASSWKSSVL	0.9987	0.947	11	20
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1066	HLA-C03:17	ASSWKSSVL	0.9983	0.9842	11	20
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1066	HLA-C03:05	SSWKSSVLL	0.998	0.9381	12	21
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1066	HLA-C15:02	ASSWKSSVL	0.9978	0.9244	11	20
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1066	HLA-B58:06	LGKALASSW	0.9978	0.9813	6	15
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1066	HLA-C15:05	ASSWKSSVL	0.9977	0.9505	11	20
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1066	HLA-C03:17	SSWKSSVLL	0.9977	0.9846	12	21
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1066	HLA-C01:03	ASSWKSSVL	0.9967	0.9475	11	20
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1066	HLA-C03:03	SSWKSSVLL	0.9966	0.9942	12	21
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1066	HLA-C03:04	SSWKSSVLL	0.9966	0.9942	12	21
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1066	HLA-C01:02	ASSWKSSVL	0.9965	0.9734	11	20
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1066	HLA-B57:04	LGKALASSW	0.9965	0.875	6	15
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1066	HLA-B58:06	SSWKSSVLL	0.99	0.8276	12	21
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1066	HLA-C12:03	LASSWKSSV	0.9843	0.9935	10	19
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1353	HLA-A69:01	NIISWTGMV	0.979	0.6653	7	16
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1066	HLA-C16:04	LASSWKSSV	0.9789	0.993	10	19
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1066	HLA-C16:02	SSWKSSVLL	0.9767	0.9955	12	21
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1066	HLA-C16:02	LASSWKSSV	0.9674	0.9959	10	19
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1066	HLA-A32:01	SSWKSSVLL	0.9612	0.9699	12	21
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1066	HLA-C03:06	SSWKSSVLL	0.956	0.9939	12	21
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1066	HLA-C03:06	ASSWKSSVL	0.95	0.9928	11	20
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1066	HLA-C16:01	ASSWKSSVL	0.9426	0.9877	11	20
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1066	HLA-B15:24	LGKALASSW	0.9349	0.9894	6	15
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1066	HLA-B57:02	SSWKSSVLL	0.9234	0.9696	12	21
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1066	HLA-C16:02	ASSWKSSVL	0.9157	0.9967	11	20
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1066	HLA-B35:13	SSWKSSVLL	0.8304	0.9074	12	21
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1066	HLA-C16:01	LASSWKSSV	0.7705	0.9906	10	19
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1066	HLA-C17:01	SSWKSSVLL	0.6309	0.9546	12	21
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1066	HLA-B07:13	ASSWKSSVL	0.5135	0.8901	11	20
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1066	HLA-A02:03	ALASSWKSSV	0.9972	0.848	9	19
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1066	HLA-B15:24	ALGKALASSW	0.9959	0.9899	5	15
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1066	HLA-B53:02	DALGKALASSW	0.9993	0.6827	4	15

Top

Potential FusionNeoAntigen Information of TCF4-PMAIP1 in HLA II

TCF4-PMAIP1_52928696_57569878.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1353	DRB1-1501	QSKNIISWTGMVAHT	4	19
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1353	DRB1-1505	QSKNIISWTGMVAHT	4	19
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1353	DRB1-1506	QSKNIISWTGMVAHT	4	19
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1353	DRB1-1509	QSKNIISWTGMVAHT	4	19
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1353	DRB1-1510	QSKNIISWTGMVAHT	4	19
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1353	DRB1-1513	QSKNIISWTGMVAHT	4	19
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1353	DRB1-1516	QSKNIISWTGMVAHT	4	19
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1353	DRB1-1518	QSKNIISWTGMVAHT	4	19
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1353	DRB1-1520	QSKNIISWTGMVAHT	4	19
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1353	DRB1-1521	QSKNIISWTGMVAHT	4	19
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1353	DRB1-1522	QSKNIISWTGMVAHT	4	19
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1353	DRB1-1524	QSKNIISWTGMVAHT	4	19
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1353	DRB1-1528	QSKNIISWTGMVAHT	4	19
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1353	DRB1-1532	QSKNIISWTGMVAHT	4	19
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1353	DRB1-1533	QSKNIISWTGMVAHT	4	19
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1353	DRB1-1535	QSKNIISWTGMVAHT	4	19
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1353	DRB1-1536	QSKNIISWTGMVAHT	4	19
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1353	DRB1-1537	QSKNIISWTGMVAHT	4	19
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1353	DRB1-1540	QSKNIISWTGMVAHT	4	19
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1353	DRB1-1541	QSKNIISWTGMVAHT	4	19
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1353	DRB1-1542	QSKNIISWTGMVAHT	4	19
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1353	DRB1-1543	QSKNIISWTGMVAHT	4	19
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1353	DRB1-1545	QSKNIISWTGMVAHT	4	19
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1353	DRB1-1546	QSKNIISWTGMVAHT	4	19
TCF4-PMAIP1	chr18	52928696	chr18	57569878	1353	DRB1-1549	QSKNIISWTGMVAHT	4	19

Top

Fusion breakpoint peptide structures of TCF4-PMAIP1

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
4450	KNIISWTGMVAHTC	TCF4	PMAIP1	chr18	52928696	chr18	57569878	1353

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
5007	LGKALASSWKSSVL	TCF4	PMAIP1	chr18	52928696	chr18	57569878	1066

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of TCF4-PMAIP1

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	4450	KNIISWTGMVAHTC	-7.15543	-7.26883
HLA-B14:02	3BVN	4450	KNIISWTGMVAHTC	-4.77435	-5.80965
HLA-B52:01	3W39	4450	KNIISWTGMVAHTC	-6.80875	-6.92215
HLA-B52:01	3W39	4450	KNIISWTGMVAHTC	-4.20386	-5.23916
HLA-A11:01	4UQ2	4450	KNIISWTGMVAHTC	-7.5194	-8.5547
HLA-A11:01	4UQ2	4450	KNIISWTGMVAHTC	-6.9601	-7.0735
HLA-A24:02	5HGA	4450	KNIISWTGMVAHTC	-7.52403	-7.63743
HLA-A24:02	5HGA	4450	KNIISWTGMVAHTC	-5.82433	-6.85963
HLA-B27:05	6PYJ	4450	KNIISWTGMVAHTC	-3.28285	-4.31815
HLA-B44:05	3DX8	4450	KNIISWTGMVAHTC	-5.91172	-6.94702
HLA-B44:05	3DX8	4450	KNIISWTGMVAHTC	-4.24346	-4.35686
HLA-B14:02	3BVN	5007	LGKALASSWKSSVL	-5.10891	-5.11611
HLA-B52:01	3W39	5007	LGKALASSWKSSVL	-3.96405	-3.97125
HLA-A24:02	5HGA	5007	LGKALASSWKSSVL	-7.52386	-7.53106
HLA-B44:05	3DX8	5007	LGKALASSWKSSVL	-6.52848	-6.53568

Top

Vaccine Design for the FusionNeoAntigens of TCF4-PMAIP1

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
TCF4-PMAIP1	chr18	52928696	chr18	57569878	10	19	LASSWKSSV	CTTGCTTCGAGCTGGAAGTCGAGTGTG
TCF4-PMAIP1	chr18	52928696	chr18	57569878	11	20	ASSWKSSVL	GCTTCGAGCTGGAAGTCGAGTGTGCTA
TCF4-PMAIP1	chr18	52928696	chr18	57569878	12	20	SSWKSSVL	TCGAGCTGGAAGTCGAGTGTGCTA
TCF4-PMAIP1	chr18	52928696	chr18	57569878	12	21	SSWKSSVLL	TCGAGCTGGAAGTCGAGTGTGCTACTC
TCF4-PMAIP1	chr18	52928696	chr18	57569878	4	15	DALGKALASSW	GATGCTCTGGGGAAAGCACTTGCTTCGAGCTGG
TCF4-PMAIP1	chr18	52928696	chr18	57569878	5	15	ALGKALASSW	GCTCTGGGGAAAGCACTTGCTTCGAGCTGG
TCF4-PMAIP1	chr18	52928696	chr18	57569878	6	15	LGKALASSW	CTGGGGAAAGCACTTGCTTCGAGCTGG
TCF4-PMAIP1	chr18	52928696	chr18	57569878	7	16	NIISWTGMV	GGGAAAGCACTTGCTTCGAGCTGGAAG
TCF4-PMAIP1	chr18	52928696	chr18	57569878	9	19	ALASSWKSSV	GCACTTGCTTCGAGCTGGAAGTCGAGTGTG

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
TCF4-PMAIP1	chr18	52928696	chr18	57569878	4	19	QSKNIISWTGMVAHT	GATGCTCTGGGGAAAGCACTTGCTTCGAGCTGGAAGTCGAGTGTG

Top

Information of the samples that have these potential fusion neoantigens of TCF4-PMAIP1

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
STAD	TCF4-PMAIP1	chr18	52928696	ENST00000398339	chr18	57569878	ENST00000269518	TCGA-ZQ-A9CR
STAD	TCF4-PMAIP1	chr18	52928696	ENST00000457482	chr18	57569878	ENST00000269518	TCGA-ZQ-A9CR

Top

Potential target of CAR-T therapy development for TCF4-PMAIP1

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to TCF4-PMAIP1

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to TCF4-PMAIP1

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner	Gene	Disease ID	Disease name	# pubmeds	Source
Hgene	TCF4	C1970431	PITT-HOPKINS SYNDROME	14	CLINGEN;CTD_human;GENOMICS_ENGLAND;ORPHANET;UNIPROT
Hgene	TCF4	C0005586	Bipolar Disorder	5	PSYGENET
Hgene	TCF4	C0036341	Schizophrenia	4	PSYGENET
Hgene	TCF4	C0016781	Fuchs Endothelial Dystrophy	1	ORPHANET
Hgene	TCF4	C0018799	Heart Diseases	1	CTD_human
Hgene	TCF4	C0022333	Jacksonian Seizure	1	CTD_human
Hgene	TCF4	C0023893	Liver Cirrhosis, Experimental	1	CTD_human
Hgene	TCF4	C0023903	Liver neoplasms	1	CTD_human
Hgene	TCF4	C0025958	Microcephaly	1	CTD_human
Hgene	TCF4	C0033975	Psychotic Disorders	1	PSYGENET
Hgene	TCF4	C0036572	Seizures	1	CTD_human
Hgene	TCF4	C0149958	Complex partial seizures	1	CTD_human
Hgene	TCF4	C0234533	Generalized seizures	1	CTD_human
Hgene	TCF4	C0234535	Clonic Seizures	1	CTD_human
Hgene	TCF4	C0270824	Visual seizure	1	CTD_human
Hgene	TCF4	C0270844	Tonic Seizures	1	CTD_human
Hgene	TCF4	C0270846	Epileptic drop attack	1	CTD_human
Hgene	TCF4	C0345904	Malignant neoplasm of liver	1	CTD_human
Hgene	TCF4	C0349204	Nonorganic psychosis	1	PSYGENET
Hgene	TCF4	C0376634	Craniofacial Abnormalities	1	CTD_human
Hgene	TCF4	C0422850	Seizures, Somatosensory	1	CTD_human
Hgene	TCF4	C0422852	Seizures, Auditory	1	CTD_human
Hgene	TCF4	C0422853	Olfactory seizure	1	CTD_human
Hgene	TCF4	C0422854	Gustatory seizure	1	CTD_human
Hgene	TCF4	C0422855	Vertiginous seizure	1	CTD_human
Hgene	TCF4	C0494475	Tonic - clonic seizures	1	CTD_human
Hgene	TCF4	C0566602	Primary sclerosing cholangitis	1	ORPHANET
Hgene	TCF4	C0751056	Non-epileptic convulsion	1	CTD_human
Hgene	TCF4	C0751110	Single Seizure	1	CTD_human
Hgene	TCF4	C0751123	Atonic Absence Seizures	1	CTD_human
Hgene	TCF4	C0751494	Convulsive Seizures	1	CTD_human
Hgene	TCF4	C0751495	Seizures, Focal	1	CTD_human
Hgene	TCF4	C0751496	Seizures, Sensory	1	CTD_human
Hgene	TCF4	C1456784	Paranoia	1	PSYGENET
Hgene	TCF4	C1535926	Neurodevelopmental Disorders	1	CTD_human
Hgene	TCF4	C1956147	Microlissencephaly	1	CTD_human
Hgene	TCF4	C2750451	CORNEAL DYSTROPHY, FUCHS ENDOTHELIAL, 3	1	CTD_human;GENOMICS_ENGLAND
Hgene	TCF4	C2931456	Prostate cancer, familial	1	CTD_human
Hgene	TCF4	C3495874	Nonepileptic Seizures	1	CTD_human
Hgene	TCF4	C3853041	Severe Congenital Microcephaly	1	CTD_human
Hgene	TCF4	C4048158	Convulsions	1	CTD_human
Hgene	TCF4	C4316903	Absence Seizures	1	CTD_human
Hgene	TCF4	C4317109	Epileptic Seizures	1	CTD_human
Hgene	TCF4	C4317123	Myoclonic Seizures	1	CTD_human
Hgene	TCF4	C4505436	Generalized Absence Seizures	1	CTD_human
Hgene	TCF4	C4721453	Peripheral Nervous System Diseases	1	CTD_human
Hgene	TCF4	C4722327	PROSTATE CANCER, HEREDITARY, 1	1	CTD_human

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)