Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:WNK1-PRMT8

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: WNK1-PRMT8
	FusionPDB ID: 99337
	FusionGDB2.0 ID: 99337
		Hgene	Tgene
	Gene symbol	WNK1	PRMT8
	Gene ID	65125	56341
	Gene name	WNK lysine deficient protein kinase 1	protein arginine methyltransferase 8
	Synonyms	HSAN2\|HSN2\|KDP\|PPP1R167\|PRKWNK1\|PSK\|p65	HRMT1L3\|HRMT1L4
	Cytomap	12p13.33	12p13.32
	Type of gene	protein-coding	protein-coding
	Description	serine/threonine-protein kinase WNK1WNK lysine deficient protein kinase 1 isoformerythrocyte 65 kDa proteinprostate-derived sterile 20-like kinaseprotein kinase with no lysine 1protein phosphatase 1, regulatory subunit 167serine/threonine-protein ki	protein arginine N-methyltransferase 8HMT1 hnRNP methyltransferase-like 3arginine methyltransferase 8heterogeneous nuclear ribonucleoprotein methyltransferase-like protein 4protein arginine N-methyltransferase 4
	Modification date	20200327	20200327
	UniProtAcc	.	.
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000315939, ENST00000340908, ENST00000530271, ENST00000535572, ENST00000537687, ENST00000447667, ENST00000540360, ENST00000574564,	ENST00000261252, ENST00000382622, ENST00000452611,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	23 X 19 X 15=6555	5 X 4 X 4=80
	# samples	37	5
	** MAII score	log2(37/6555*10)=-4.14699860459281 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(5/80*10)=-0.678071905112638 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: WNK1 [Title/Abstract] AND PRMT8 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: WNK1 [Title/Abstract] AND PRMT8 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	WNK1(971436)-PRMT8(3649772), # samples:3
Anticipated loss of major functional domain due to fusion event.	WNK1-PRMT8 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. WNK1-PRMT8 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. WNK1-PRMT8 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. WNK1-PRMT8 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	WNK1	GO:0006468	protein phosphorylation	10660600
Hgene	WNK1	GO:0010923	negative regulation of phosphatase activity	19389623
Hgene	WNK1	GO:0023016	signal transduction by trans-phosphorylation	16669787
Hgene	WNK1	GO:0035556	intracellular signal transduction	10660600
Tgene	PRMT8	GO:0006479	protein methylation	17925405
Tgene	PRMT8	GO:0016571	histone methylation	16051612\|17925405
Tgene	PRMT8	GO:0018216	peptidyl-arginine methylation	16051612\|18320585
Tgene	PRMT8	GO:0019919	peptidyl-arginine methylation, to asymmetrical-dimethyl arginine	16051612\|17925405
Tgene	PRMT8	GO:0051260	protein homooligomerization	26876602

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr12:971436/chr12:3649772)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across WNK1 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across PRMT8 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000535572	WNK1	chr12	971436	+	ENST00000452611	PRMT8	chr12	3649772	+	4222	3112	826	4221	1132
ENST00000535572	WNK1	chr12	971436	+	ENST00000382622	PRMT8	chr12	3649772	+	5013	3112	826	4221	1131
ENST00000537687	WNK1	chr12	971436	+	ENST00000452611	PRMT8	chr12	3649772	+	3892	2782	496	3891	1132
ENST00000537687	WNK1	chr12	971436	+	ENST00000382622	PRMT8	chr12	3649772	+	4683	2782	496	3891	1131
ENST00000315939	WNK1	chr12	971436	+	ENST00000452611	PRMT8	chr12	3649772	+	3892	2782	496	3891	1132
ENST00000315939	WNK1	chr12	971436	+	ENST00000382622	PRMT8	chr12	3649772	+	4683	2782	496	3891	1131
ENST00000530271	WNK1	chr12	971436	+	ENST00000452611	PRMT8	chr12	3649772	+	3249	2139	0	3248	1082
ENST00000530271	WNK1	chr12	971436	+	ENST00000382622	PRMT8	chr12	3649772	+	4040	2139	0	3248	1082
ENST00000340908	WNK1	chr12	971436	+	ENST00000452611	PRMT8	chr12	3649772	+	2028	918	0	2027	675
ENST00000340908	WNK1	chr12	971436	+	ENST00000382622	PRMT8	chr12	3649772	+	2819	918	0	2027	675

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000535572	ENST00000452611	WNK1	chr12	971436	+	PRMT8	chr12	3649772	+	0.003288893	0.99671113
ENST00000535572	ENST00000382622	WNK1	chr12	971436	+	PRMT8	chr12	3649772	+	0.002644941	0.9973551
ENST00000537687	ENST00000452611	WNK1	chr12	971436	+	PRMT8	chr12	3649772	+	0.002317427	0.9976826
ENST00000537687	ENST00000382622	WNK1	chr12	971436	+	PRMT8	chr12	3649772	+	0.001830105	0.9981699
ENST00000315939	ENST00000452611	WNK1	chr12	971436	+	PRMT8	chr12	3649772	+	0.002317427	0.9976826
ENST00000315939	ENST00000382622	WNK1	chr12	971436	+	PRMT8	chr12	3649772	+	0.001830105	0.9981699
ENST00000530271	ENST00000452611	WNK1	chr12	971436	+	PRMT8	chr12	3649772	+	0.000793369	0.9992066
ENST00000530271	ENST00000382622	WNK1	chr12	971436	+	PRMT8	chr12	3649772	+	0.000635754	0.9993643
ENST00000340908	ENST00000452611	WNK1	chr12	971436	+	PRMT8	chr12	3649772	+	0.001166007	0.99883395
ENST00000340908	ENST00000382622	WNK1	chr12	971436	+	PRMT8	chr12	3649772	+	0.000839753	0.9991603

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for WNK1-PRMT8

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
WNK1	chr12	971436	PRMT8	chr12	3649772	2139	713	QSQPHGVYPPSSVVNSPPSQPPQPVV
WNK1	chr12	971436	PRMT8	chr12	3649772	2782	762	QSQPHGVYPPSSVVNSPPSQPPQPVV
WNK1	chr12	971436	PRMT8	chr12	3649772	3112	762	QSQPHGVYPPSSVVNSPPSQPPQPVV
WNK1	chr12	971436	PRMT8	chr12	3649772	918	306	QSQPHGVYPPSSVVNSPPSQPPQPVV

Top

Potential FusionNeoAntigen Information of WNK1-PRMT8 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

WNK1-PRMT8_971436_3649772.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
WNK1-PRMT8	chr12	971436	chr12	3649772	2782	HLA-A02:38	GVYPPSSVV	0.9695	0.6508	5	14
WNK1-PRMT8	chr12	971436	chr12	3649772	2782	HLA-A02:13	GVYPPSSVV	0.9438	0.7206	5	14
WNK1-PRMT8	chr12	971436	chr12	3649772	2782	HLA-A02:27	GVYPPSSVV	0.9165	0.5145	5	14
WNK1-PRMT8	chr12	971436	chr12	3649772	2782	HLA-A02:21	GVYPPSSVV	0.8901	0.6783	5	14
WNK1-PRMT8	chr12	971436	chr12	3649772	2782	HLA-A02:35	GVYPPSSVV	0.8781	0.5862	5	14
WNK1-PRMT8	chr12	971436	chr12	3649772	2782	HLA-A02:11	GVYPPSSVV	0.8573	0.5949	5	14
WNK1-PRMT8	chr12	971436	chr12	3649772	2782	HLA-A30:08	GVYPPSSVV	0.8419	0.8281	5	14
WNK1-PRMT8	chr12	971436	chr12	3649772	2782	HLA-A02:20	GVYPPSSVV	0.8378	0.5663	5	14
WNK1-PRMT8	chr12	971436	chr12	3649772	2782	HLA-B52:01	GVYPPSSVV	0.455	0.9901	5	14
WNK1-PRMT8	chr12	971436	chr12	3649772	2782	HLA-B13:02	GVYPPSSVV	0.3841	0.9503	5	14
WNK1-PRMT8	chr12	971436	chr12	3649772	2782	HLA-C04:14	VYPPSSVV	0.9552	0.9811	6	14
WNK1-PRMT8	chr12	971436	chr12	3649772	2782	HLA-C01:30	VYPPSSVV	0.9215	0.9699	6	14
WNK1-PRMT8	chr12	971436	chr12	3649772	2782	HLA-C15:04	GVYPPSSVV	0.9987	0.9453	5	14
WNK1-PRMT8	chr12	971436	chr12	3649772	2782	HLA-C15:06	GVYPPSSVV	0.9986	0.9652	5	14
WNK1-PRMT8	chr12	971436	chr12	3649772	2782	HLA-C03:07	GVYPPSSVV	0.9979	0.986	5	14
WNK1-PRMT8	chr12	971436	chr12	3649772	2782	HLA-C04:06	GVYPPSSVV	0.9968	0.9882	5	14
WNK1-PRMT8	chr12	971436	chr12	3649772	2782	HLA-C12:04	GVYPPSSVV	0.9953	0.9944	5	14
WNK1-PRMT8	chr12	971436	chr12	3649772	2782	HLA-C06:03	GVYPPSSVV	0.995	0.9913	5	14
WNK1-PRMT8	chr12	971436	chr12	3649772	2782	HLA-C03:19	GVYPPSSVV	0.9921	0.9905	5	14
WNK1-PRMT8	chr12	971436	chr12	3649772	2782	HLA-C03:08	GVYPPSSVV	0.9634	0.8947	5	14
WNK1-PRMT8	chr12	971436	chr12	3649772	2782	HLA-C02:06	GVYPPSSVV	0.9622	0.9797	5	14
WNK1-PRMT8	chr12	971436	chr12	3649772	2782	HLA-C12:12	GVYPPSSVV	0.9589	0.9112	5	14
WNK1-PRMT8	chr12	971436	chr12	3649772	2782	HLA-C08:13	GVYPPSSVV	0.9379	0.9911	5	14
WNK1-PRMT8	chr12	971436	chr12	3649772	2782	HLA-C08:04	GVYPPSSVV	0.9379	0.9911	5	14
WNK1-PRMT8	chr12	971436	chr12	3649772	2782	HLA-B15:04	GVYPPSSVV	0.9307	0.9396	5	14
WNK1-PRMT8	chr12	971436	chr12	3649772	2782	HLA-B51:07	GVYPPSSVV	0.4759	0.9841	5	14
WNK1-PRMT8	chr12	971436	chr12	3649772	2782	HLA-C18:01	VYPPSSVV	0.9562	0.9804	6	14
WNK1-PRMT8	chr12	971436	chr12	3649772	2782	HLA-C14:02	VYPPSSVV	0.846	0.9747	6	14
WNK1-PRMT8	chr12	971436	chr12	3649772	2782	HLA-C14:03	VYPPSSVV	0.846	0.9747	6	14
WNK1-PRMT8	chr12	971436	chr12	3649772	2782	HLA-C15:02	GVYPPSSVV	0.9992	0.952	5	14
WNK1-PRMT8	chr12	971436	chr12	3649772	2782	HLA-C15:05	GVYPPSSVV	0.9989	0.9628	5	14
WNK1-PRMT8	chr12	971436	chr12	3649772	2782	HLA-C15:09	GVYPPSSVV	0.9987	0.9453	5	14
WNK1-PRMT8	chr12	971436	chr12	3649772	2782	HLA-C03:17	GVYPPSSVV	0.9884	0.9811	5	14
WNK1-PRMT8	chr12	971436	chr12	3649772	2782	HLA-C03:05	GVYPPSSVV	0.9862	0.9507	5	14
WNK1-PRMT8	chr12	971436	chr12	3649772	2782	HLA-C03:06	GVYPPSSVV	0.9769	0.992	5	14
WNK1-PRMT8	chr12	971436	chr12	3649772	2782	HLA-C03:03	GVYPPSSVV	0.9735	0.9903	5	14
WNK1-PRMT8	chr12	971436	chr12	3649772	2782	HLA-C03:04	GVYPPSSVV	0.9735	0.9903	5	14
WNK1-PRMT8	chr12	971436	chr12	3649772	2782	HLA-C12:03	GVYPPSSVV	0.9707	0.9758	5	14
WNK1-PRMT8	chr12	971436	chr12	3649772	2782	HLA-A02:03	GVYPPSSVV	0.9667	0.6699	5	14
WNK1-PRMT8	chr12	971436	chr12	3649772	2782	HLA-B15:73	GVYPPSSVV	0.9619	0.9749	5	14
WNK1-PRMT8	chr12	971436	chr12	3649772	2782	HLA-B15:30	GVYPPSSVV	0.932	0.9482	5	14
WNK1-PRMT8	chr12	971436	chr12	3649772	2782	HLA-A68:02	GVYPPSSVV	0.9208	0.5334	5	14
WNK1-PRMT8	chr12	971436	chr12	3649772	2782	HLA-B07:13	GVYPPSSVV	0.8992	0.8933	5	14
WNK1-PRMT8	chr12	971436	chr12	3649772	2782	HLA-A02:14	GVYPPSSVV	0.8922	0.5966	5	14
WNK1-PRMT8	chr12	971436	chr12	3649772	2782	HLA-A02:06	GVYPPSSVV	0.8901	0.6783	5	14
WNK1-PRMT8	chr12	971436	chr12	3649772	2782	HLA-A69:01	GVYPPSSVV	0.8743	0.7363	5	14
WNK1-PRMT8	chr12	971436	chr12	3649772	2782	HLA-C12:02	GVYPPSSVV	0.8663	0.9691	5	14
WNK1-PRMT8	chr12	971436	chr12	3649772	2782	HLA-C02:02	GVYPPSSVV	0.8383	0.9889	5	14
WNK1-PRMT8	chr12	971436	chr12	3649772	2782	HLA-C02:10	GVYPPSSVV	0.8383	0.9889	5	14
WNK1-PRMT8	chr12	971436	chr12	3649772	2782	HLA-C17:01	GVYPPSSVV	0.3824	0.9756	5	14
WNK1-PRMT8	chr12	971436	chr12	3649772	2782	HLA-A68:02	HGVYPPSSVV	0.7638	0.5913	4	14
WNK1-PRMT8	chr12	971436	chr12	3649772	2782	HLA-A69:01	HGVYPPSSVV	0.6483	0.7554	4	14

Top

Potential FusionNeoAntigen Information of WNK1-PRMT8 in HLA II

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene

Hchr

Hbp

Tgene

Tchr

Tbp

HLA II

FusionNeoAntigen peptide

Neoantigen start (at BP 13)

Neoantigen end (at BP 13)

Top

Fusion breakpoint peptide structures of WNK1-PRMT8

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
10407	VYPPSSVVNSPPSQ	WNK1	PRMT8	chr12	971436	chr12	3649772	2782

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of WNK1-PRMT8

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	10407	VYPPSSVVNSPPSQ	-7.9962	-8.1096
HLA-B14:02	3BVN	10407	VYPPSSVVNSPPSQ	-5.70842	-6.74372
HLA-B52:01	3W39	10407	VYPPSSVVNSPPSQ	-6.83737	-6.95077
HLA-B52:01	3W39	10407	VYPPSSVVNSPPSQ	-4.4836	-5.5189
HLA-A11:01	4UQ2	10407	VYPPSSVVNSPPSQ	-10.0067	-10.1201
HLA-A11:01	4UQ2	10407	VYPPSSVVNSPPSQ	-9.03915	-10.0745
HLA-A24:02	5HGA	10407	VYPPSSVVNSPPSQ	-6.56204	-6.67544
HLA-A24:02	5HGA	10407	VYPPSSVVNSPPSQ	-5.42271	-6.45801
HLA-B44:05	3DX8	10407	VYPPSSVVNSPPSQ	-7.85648	-8.89178
HLA-B44:05	3DX8	10407	VYPPSSVVNSPPSQ	-5.3978	-5.5112
HLA-B35:01	1A1N	10407	VYPPSSVVNSPPSQ	-6.27422	-6.38762
HLA-B35:01	1A1N	10407	VYPPSSVVNSPPSQ	-5.27424	-6.30954
HLA-A02:01	6TDR	10407	VYPPSSVVNSPPSQ	-3.37154	-4.40684

Top

Vaccine Design for the FusionNeoAntigens of WNK1-PRMT8

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
WNK1-PRMT8	chr12	971436	chr12	3649772	4	14	HGVYPPSSVV	CATGGGGTATATCCACCCTCAAGTGTGGTG
WNK1-PRMT8	chr12	971436	chr12	3649772	5	14	GVYPPSSVV	GGGGTATATCCACCCTCAAGTGTGGTG
WNK1-PRMT8	chr12	971436	chr12	3649772	6	14	VYPPSSVV	GTATATCCACCCTCAAGTGTGGTG

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene

Hchr

Hbp

Tchr

Tbp

Start in +/-13AA

End in +/-13AA

FusionNeoAntigen peptide

FusionNEoAntigen RNA sequence

Top

Information of the samples that have these potential fusion neoantigens of WNK1-PRMT8

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
BRCA	WNK1-PRMT8	chr12	971436	ENST00000315939	chr12	3649772	ENST00000382622	TCGA-BH-A18T-01A

Top

Potential target of CAR-T therapy development for WNK1-PRMT8

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to WNK1-PRMT8

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to WNK1-PRMT8

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)