Home

Download

Statistics

Examples

Help

Contact

Fusion Protein:XRCC5-RMDN1

Fusion Gene and Fusion Protein Summary

Fusion gene summary

Fusion partner gene information	Fusion gene name: XRCC5-RMDN1
	FusionPDB ID: 99769
	FusionGDB2.0 ID: 99769
		Hgene	Tgene
	Gene symbol	XRCC5	RMDN1
	Gene ID	7520	51115
	Gene name	X-ray repair cross complementing 5	regulator of microtubule dynamics 1
	Synonyms	KARP-1\|KARP1\|KU80\|KUB2\|Ku86\|NFIV	CGI-90\|FAM82B\|RMD-1\|RMD1
	Cytomap	2q35	8q21.3
	Type of gene	protein-coding	protein-coding
	Description	X-ray repair cross-complementing protein 586 kDa subunit of Ku antigenATP-dependent DNA helicase 2 subunit 2ATP-dependent DNA helicase II 80 kDa subunitCTC box-binding factor 85 kDa subunitCTC85CTCBFDNA repair protein XRCC5Ku autoantigen, 80kDaKu	regulator of microtubule dynamics protein 1family with sequence similarity 82, member Bmicrotubule-associated protein
	Modification date	20200313	20200313
	UniProtAcc	.	Q96DB5 Main function of 5'-partner protein:
Ensembl transtripts involved in fusion gene	ENST ids	ENST00000471649, ENST00000392132, ENST00000392133,	ENST00000406452, ENST00000430676, ENST00000519966, ENST00000523911, ENST00000518772,
Fusion gene scores for assessment (based on all fusion genes of FusionGDB 2.0)	* DoF score	13 X 10 X 7=910	6 X 6 X 2=72
	# samples	12	6
	** MAII score	log2(12/910*10)=-2.92283213947754 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0	log2(6/72*10)=-0.263034405833794 possibly effective Gene in Pan-Cancer Fusion Genes (peGinPCFGs). DoF>8 and MAII<0
Fusion gene context	PubMed: XRCC5 [Title/Abstract] AND RMDN1 [Title/Abstract] AND fusion [Title/Abstract]
Fusion neoantigen context	PubMed: XRCC5 [Title/Abstract] AND RMDN1 [Title/Abstract] AND neoantigen [Title/Abstract]
Most frequent breakpoint (based on all fusion genes of FusionGDB 2.0)	XRCC5(216997110)-RMDN1(87489553), # samples:1
Anticipated loss of major functional domain due to fusion event.	XRCC5-RMDN1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. XRCC5-RMDN1 seems lost the major protein functional domain in Hgene partner, which is a CGC by not retaining the major functional domain in the partially deleted in-frame ORF. XRCC5-RMDN1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF. XRCC5-RMDN1 seems lost the major protein functional domain in Hgene partner, which is a essential gene by not retaining the major functional domain in the partially deleted in-frame ORF.

* DoF score (Degree of Frequency) = # partners X # break points X # cancer types
** MAII score (Major Active Isofusion Index) = log2(# samples/DoF score*10)

Gene ontology of each fusion partner gene with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner	Gene	GO ID	GO term	PubMed ID
Hgene	XRCC5	GO:0002218	activation of innate immune response	28712728
Hgene	XRCC5	GO:0006303	double-strand break repair via nonhomologous end joining	26359349
Hgene	XRCC5	GO:0045860	positive regulation of protein kinase activity	22504299
Hgene	XRCC5	GO:0071480	cellular response to gamma radiation	26359349

Four levels of functional features of fusion genes
Go to FGviewer search page for the most frequent breakpoint (https://ccsmweb.uth.edu/FGviewer/chr2:216997110/chr8:87489553)
- FGviewer provides the online visualization of the retention search of the protein functional features across DNA, RNA, protein, and pathological levels.
- How to search
1. Put your fusion gene symbol.
2. Press the tab key until there will be shown the breakpoint information filled.
4. Go down and press 'Search' tab twice.
4. Go down to have the hyperlink of the search result.
5. Click the hyperlink.
6. See the FGviewer result for your fusion gene.

Retention analysis results of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features, are available here.

Fusion gene breakpoints across XRCC5 (5'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion gene breakpoints across RMDN1 (3'-gene)
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Top

Fusion Amino Acid Sequences

Fusion information from ORFfinder translation from full-length transcript sequence from FusionPDB.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	Seq length (transcript)	BP loci (transcript)	Predicted start (transcript)	Predicted stop (transcript)	Seq length (amino acids)
ENST00000392133	XRCC5	chr2	216997110	+	ENST00000406452	RMDN1	chr8	87489553	-	3748	1574	71	1789	572
ENST00000392133	XRCC5	chr2	216997110	+	ENST00000523911	RMDN1	chr8	87489553	-	1827	1574	71	1723	550
ENST00000392133	XRCC5	chr2	216997110	+	ENST00000519966	RMDN1	chr8	87489553	-	2038	1574	71	1750	559
ENST00000392133	XRCC5	chr2	216997110	+	ENST00000430676	RMDN1	chr8	87489553	-	1986	1574	71	1789	572
ENST00000392132	XRCC5	chr2	216997110	+	ENST00000406452	RMDN1	chr8	87489553	-	3427	1253	56	1468	470
ENST00000392132	XRCC5	chr2	216997110	+	ENST00000523911	RMDN1	chr8	87489553	-	1506	1253	56	1402	448
ENST00000392132	XRCC5	chr2	216997110	+	ENST00000519966	RMDN1	chr8	87489553	-	1717	1253	56	1429	457
ENST00000392132	XRCC5	chr2	216997110	+	ENST00000430676	RMDN1	chr8	87489553	-	1665	1253	56	1468	470

DeepORF prediction of the coding potential based on the fusion transcript sequence of in-frame fusion genes. DeepORF is a coding potential classifier based on convolutional neural network by comparing the real Ribo-seq data. If the no-coding score < 0.5 and coding score > 0.5, then the in-frame fusion transcript is predicted as being likely translated.

Henst	Tenst	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand	No-coding score	Coding score
ENST00000392133	ENST00000406452	XRCC5	chr2	216997110	+	RMDN1	chr8	87489553	-	0.000321886	0.99967813
ENST00000392133	ENST00000523911	XRCC5	chr2	216997110	+	RMDN1	chr8	87489553	-	0.001203338	0.9987967
ENST00000392133	ENST00000519966	XRCC5	chr2	216997110	+	RMDN1	chr8	87489553	-	0.000848913	0.9991511
ENST00000392133	ENST00000430676	XRCC5	chr2	216997110	+	RMDN1	chr8	87489553	-	0.00075485	0.99924517
ENST00000392132	ENST00000406452	XRCC5	chr2	216997110	+	RMDN1	chr8	87489553	-	0.000159963	0.99984
ENST00000392132	ENST00000523911	XRCC5	chr2	216997110	+	RMDN1	chr8	87489553	-	0.000368698	0.9996313
ENST00000392132	ENST00000519966	XRCC5	chr2	216997110	+	RMDN1	chr8	87489553	-	0.000309927	0.99969006
ENST00000392132	ENST00000430676	XRCC5	chr2	216997110	+	RMDN1	chr8	87489553	-	0.000250402	0.9997496

Predicted full-length fusion amino acid sequences. For individual full-length fusion transcript sequence from FusionPDB, we ran ORFfinder and chose the longest ORF among all the predicted ones.

Get the fusion protein sequences from here.

Fusion protein sequence information is available in the fasta format.
>FusionGDB ID_FusionGDB isoform ID_FGname_Hgene_Hchr_Hbp_Henst_Tgene_Tchr_Tbp_Tenst_length(fusion AA) seq_BP

Top

Fusion Protein Breakpoint Sequences for XRCC5-RMDN1

+/-13 AA sequence from the breakpoints of the fusion protein sequences.

Hgene	Hchr	Hbp	Tgene	Tchr	Tbp	Length(fusion protein)	BP in fusion protein	Peptide
XRCC5	chr2	216997110	RMDN1	chr8	87489553	1253	399	NQVLKVFAARDDEALGYFHRAEQGKT
XRCC5	chr2	216997110	RMDN1	chr8	87489553	1253	399	NQVLKVFAARDDEALGYFHRAEQVDP
XRCC5	chr2	216997110	RMDN1	chr8	87489553	1574	501	NQVLKVFAARDDEALGYFHRAEQGKT
XRCC5	chr2	216997110	RMDN1	chr8	87489553	1574	501	NQVLKVFAARDDEALGYFHRAEQVDP

Top

Potential FusionNeoAntigen Information of XRCC5-RMDN1 in HLA I

Multiple sequence alignments of the potential FusionNeoAntigens per fusion breakpoints. If the MSA is empty, then it means that there were predicted fusion neoantigens in this fusion breakpoint, but those predicted fusion neoantigens were not across the breakpoint, which is not fusion-specific.

XRCC5-RMDN1_216997110_87489553.msa

Potential FusionNeoAntigen Information
* We used NetMHCpan v4.1 (%rank<0.5) and deepHLApan v1.1 (immunogenic score>0.5)

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA I	FusionNeoAntigen peptide	Binding score	Immunogenic score	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	HLA-B18:01	DEALGYFH	0.9993	0.9607	11	19
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	HLA-B27:05	ARDDEALGY	0.9798	0.8802	8	17
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	HLA-B27:02	ARDDEALGY	0.9793	0.6846	8	17
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	HLA-B27:04	ARDDEALGY	0.9762	0.7433	8	17
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	HLA-B35:03	FAARDDEAL	0.9079	0.9511	6	15
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	HLA-B35:02	FAARDDEAL	0.7164	0.9772	6	15
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	HLA-B35:04	FAARDDEAL	0.7164	0.9772	6	15
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	HLA-B47:01	ARDDEALGY	0.3762	0.6117	8	17
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	HLA-B15:18	ARDDEALGY	0.184	0.7176	8	17
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	HLA-B27:02	ARDDEALGYF	0.9996	0.7355	8	18
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	HLA-B27:07	ARDDEALGYF	0.9992	0.5381	8	18
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	HLA-B35:08	FAARDDEALGY	0.9988	0.8638	6	17
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	HLA-B35:01	FAARDDEALGY	0.9965	0.8564	6	17
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	HLA-C03:19	FAARDDEAL	0.999	0.99	6	15
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	HLA-C03:07	FAARDDEAL	0.9987	0.9729	6	15
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	HLA-C03:08	FAARDDEAL	0.9979	0.9226	6	15
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	HLA-B54:01	EALGYFHRA	0.9942	0.5229	12	21
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	HLA-C08:15	FAARDDEAL	0.9901	0.961	6	15
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	HLA-C08:04	FAARDDEAL	0.9876	0.9608	6	15
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	HLA-C08:13	FAARDDEAL	0.9876	0.9608	6	15
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	HLA-B27:14	ARDDEALGY	0.9594	0.8095	8	17
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	HLA-C08:03	FAARDDEAL	0.9541	0.9758	6	15
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	HLA-C07:95	ARDDEALGY	0.9265	0.644	8	17
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	HLA-B78:01	EALGYFHRA	0.8983	0.7932	12	21
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	HLA-C07:27	ARDDEALGY	0.8858	0.9189	8	17
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	HLA-C07:05	ARDDEALGY	0.8239	0.9495	8	17
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	HLA-C07:19	ARDDEALGY	0.7841	0.7009	8	17
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	HLA-B27:03	ARDDEALGY	0.7815	0.8987	8	17
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	HLA-B35:12	FAARDDEAL	0.7164	0.9772	6	15
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	HLA-C07:67	ARDDEALGY	0.7129	0.9192	8	17
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	HLA-C07:80	ARDDEALGY	0.7129	0.9192	8	17
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	HLA-C07:10	ARDDEALGY	0.6866	0.9569	8	17
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	HLA-C07:46	ARDDEALGY	0.682	0.8715	8	17
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	HLA-B39:08	RDDEALGYF	0.2199	0.7173	9	18
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	HLA-C12:16	ARDDEALGY	0.0103	0.9256	8	17
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	HLA-C07:95	ARDDEALGYF	0.9976	0.7067	8	18
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	HLA-B18:05	DEALGYFH	0.9993	0.9607	11	19
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	HLA-B18:06	DEALGYFH	0.9993	0.9646	11	19
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	HLA-C03:04	FAARDDEAL	0.9992	0.9887	6	15
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	HLA-C03:03	FAARDDEAL	0.9992	0.9887	6	15
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	HLA-C03:17	FAARDDEAL	0.9984	0.9742	6	15
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	HLA-A68:02	EALGYFHRA	0.9932	0.9507	12	21
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	HLA-C08:02	FAARDDEAL	0.9901	0.961	6	15
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	HLA-C03:06	FAARDDEAL	0.9858	0.9905	6	15
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	HLA-A69:01	EALGYFHRA	0.9845	0.9421	12	21
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	HLA-B27:08	ARDDEALGY	0.9791	0.8045	8	17
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	HLA-B27:10	ARDDEALGY	0.9728	0.859	8	17
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	HLA-C08:01	FAARDDEAL	0.9541	0.9758	6	15
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	HLA-C07:01	ARDDEALGY	0.9328	0.621	8	17
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	HLA-B78:02	EALGYFHRA	0.9038	0.8581	12	21
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	HLA-B35:13	FAARDDEAL	0.8972	0.9549	6	15
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	HLA-B35:09	FAARDDEAL	0.7164	0.9772	6	15
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	HLA-C07:02	ARDDEALGY	0.7129	0.9192	8	17
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	HLA-C07:17	ARDDEALGY	0.6818	0.9407	8	17
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	HLA-C07:22	ARDDEALGY	0.5549	0.6392	8	17
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	HLA-C06:06	ARDDEALGY	0.256	0.973	8	17
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	HLA-B27:09	ARDDEALGYF	0.9993	0.8727	8	18
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	HLA-C18:01	ARDDEALGYF	0.9993	0.6706	8	18
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	HLA-C07:01	ARDDEALGYF	0.9977	0.6986	8	18
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	HLA-C07:22	ARDDEALGYF	0.9934	0.6801	8	18
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	HLA-B35:77	FAARDDEALGY	0.9965	0.8564	6	17

Top

Potential FusionNeoAntigen Information of XRCC5-RMDN1 in HLA II

XRCC5-RMDN1_216997110_87489553.msa

Potential FusionNeoAntigen Information
* We used NetMHCIIpan v4.1 (%rank<0.5).

Fusion gene	Hchr	Hbp	Tgene	Tchr	Tbp	HLA II	FusionNeoAntigen peptide	Neoantigen start (at BP 13)	Neoantigen end (at BP 13)
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-0810	DEALGYFHRAEQVDP	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-0828	DEALGYFHRAEQVDP	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-0828	DDEALGYFHRAEQVD	10	25
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-0828	DEALGYFHRAEQGKT	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-0828	DDEALGYFHRAEQGK	10	25
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1102	DEALGYFHRAEQVDP	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1102	DEALGYFHRAEQGKT	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1103	DEALGYFHRAEQVDP	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1103	DDEALGYFHRAEQVD	10	25
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1103	DEALGYFHRAEQGKT	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1103	DDEALGYFHRAEQGK	10	25
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1104	DEALGYFHRAEQGKT	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1116	DEALGYFHRAEQVDP	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1116	DEALGYFHRAEQGKT	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1118	DEALGYFHRAEQVDP	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1118	DEALGYFHRAEQGKT	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1125	DEALGYFHRAEQVDP	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1125	DEALGYFHRAEQGKT	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1125	DDEALGYFHRAEQGK	10	25
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1135	DEALGYFHRAEQGKT	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1136	DEALGYFHRAEQVDP	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1136	DEALGYFHRAEQGKT	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1138	DEALGYFHRAEQGKT	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1141	DEALGYFHRAEQVDP	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1141	DEALGYFHRAEQGKT	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1141	DDEALGYFHRAEQGK	10	25
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1143	DEALGYFHRAEQGKT	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1144	DEALGYFHRAEQGKT	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1146	DEALGYFHRAEQGKT	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1148	DEALGYFHRAEQVDP	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1148	DEALGYFHRAEQGKT	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1148	DDEALGYFHRAEQGK	10	25
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1155	DEALGYFHRAEQVDP	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1155	DEALGYFHRAEQGKT	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1155	DDEALGYFHRAEQGK	10	25
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1158	DEALGYFHRAEQGKT	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1159	DEALGYFHRAEQVDP	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1159	DEALGYFHRAEQGKT	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1159	DDEALGYFHRAEQGK	10	25
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1160	DEALGYFHRAEQGKT	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1163	DEALGYFHRAEQVDP	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1163	DDEALGYFHRAEQVD	10	25
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1163	DEALGYFHRAEQGKT	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1163	DDEALGYFHRAEQGK	10	25
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1165	DEALGYFHRAEQVDP	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1165	DEALGYFHRAEQGKT	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1167	DEALGYFHRAEQVDP	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1167	DDEALGYFHRAEQVD	10	25
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1167	DEALGYFHRAEQGKT	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1167	DDEALGYFHRAEQGK	10	25
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1169	DEALGYFHRAEQGKT	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1170	DEALGYFHRAEQGKT	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1176	DEALGYFHRAEQVDP	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1176	DDEALGYFHRAEQVD	10	25
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1176	DEALGYFHRAEQGKT	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1176	DDEALGYFHRAEQGK	10	25
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1177	DEALGYFHRAEQGKT	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1178	DEALGYFHRAEQGKT	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1185	DEALGYFHRAEQVDP	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1185	DDEALGYFHRAEQVD	10	25
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1185	DEALGYFHRAEQGKT	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1185	DDEALGYFHRAEQGK	10	25
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1301	DEALGYFHRAEQVDP	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1301	DEALGYFHRAEQGKT	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1304	DEALGYFHRAEQVDP	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1304	DDEALGYFHRAEQVD	10	25
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1304	DEALGYFHRAEQGKT	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1304	DDEALGYFHRAEQGK	10	25
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1306	DEALGYFHRAEQVDP	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1306	DEALGYFHRAEQGKT	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1308	DEALGYFHRAEQVDP	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1308	DEALGYFHRAEQGKT	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1308	DDEALGYFHRAEQGK	10	25
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1309	DEALGYFHRAEQVDP	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1309	DDEALGYFHRAEQVD	10	25
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1309	DEALGYFHRAEQGKT	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1309	DDEALGYFHRAEQGK	10	25
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1311	DEALGYFHRAEQGKT	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1317	DEALGYFHRAEQVDP	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1317	DEALGYFHRAEQGKT	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1317	DDEALGYFHRAEQGK	10	25
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1318	DEALGYFHRAEQVDP	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1318	DEALGYFHRAEQGKT	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1318	DDEALGYFHRAEQGK	10	25
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1319	DEALGYFHRAEQGKT	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1320	DEALGYFHRAEQVDP	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1320	DEALGYFHRAEQGKT	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1322	DEALGYFHRAEQVDP	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1322	DEALGYFHRAEQGKT	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1324	DEALGYFHRAEQVDP	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1324	DDEALGYFHRAEQVD	10	25
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1324	DEALGYFHRAEQGKT	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1324	DDEALGYFHRAEQGK	10	25
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1332	DEALGYFHRAEQVDP	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1332	DEALGYFHRAEQGKT	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1332	DDEALGYFHRAEQGK	10	25
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1335	DEALGYFHRAEQVDP	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1335	DEALGYFHRAEQGKT	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1342	DEALGYFHRAEQGKT	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1343	DEALGYFHRAEQVDP	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1343	DEALGYFHRAEQGKT	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1348	DEALGYFHRAEQVDP	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1348	DEALGYFHRAEQGKT	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1348	DDEALGYFHRAEQGK	10	25
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1351	DEALGYFHRAEQVDP	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1351	DEALGYFHRAEQGKT	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1352	DEALGYFHRAEQVDP	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1352	DEALGYFHRAEQGKT	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1353	DEALGYFHRAEQGKT	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1354	DEALGYFHRAEQVDP	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1354	DEALGYFHRAEQGKT	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1359	DEALGYFHRAEQVDP	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1359	DEALGYFHRAEQGKT	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1364	DEALGYFHRAEQVDP	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1364	DEALGYFHRAEQGKT	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1368	DEALGYFHRAEQVDP	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1368	DEALGYFHRAEQGKT	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1369	DEALGYFHRAEQVDP	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1369	DEALGYFHRAEQGKT	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1370	DEALGYFHRAEQVDP	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1370	DEALGYFHRAEQGKT	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1370	DDEALGYFHRAEQGK	10	25
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1372	DEALGYFHRAEQVDP	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1372	DEALGYFHRAEQGKT	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1372	DDEALGYFHRAEQGK	10	25
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1375	DEALGYFHRAEQVDP	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1375	DDEALGYFHRAEQVD	10	25
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1375	DEALGYFHRAEQGKT	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1375	DDEALGYFHRAEQGK	10	25
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1378	DEALGYFHRAEQVDP	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1378	DEALGYFHRAEQGKT	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1379	DEALGYFHRAEQVDP	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1379	DEALGYFHRAEQGKT	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1380	DEALGYFHRAEQVDP	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1380	DEALGYFHRAEQGKT	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1383	DEALGYFHRAEQVDP	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1383	DEALGYFHRAEQGKT	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1384	DEALGYFHRAEQVDP	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1384	DEALGYFHRAEQGKT	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1384	DDEALGYFHRAEQGK	10	25
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1387	DEALGYFHRAEQVDP	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1387	DEALGYFHRAEQGKT	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1391	DEALGYFHRAEQVDP	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1391	DEALGYFHRAEQGKT	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1392	DEALGYFHRAEQVDP	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1392	DEALGYFHRAEQGKT	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1393	DEALGYFHRAEQVDP	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1393	DDEALGYFHRAEQVD	10	25
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1393	DEALGYFHRAEQGKT	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1393	DDEALGYFHRAEQGK	10	25
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1398	DEALGYFHRAEQGKT	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1412	DEALGYFHRAEQVDP	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1412	DEALGYFHRAEQGKT	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1416	DEALGYFHRAEQVDP	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1416	DEALGYFHRAEQGKT	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1437	DEALGYFHRAEQVDP	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1437	DEALGYFHRAEQGKT	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1437	DDEALGYFHRAEQGK	10	25
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1457	NQVLKVFAARDDEAL	0	15
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1457	NQVLKVFAARDDEAL	0	15
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1478	DEALGYFHRAEQVDP	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1478	DEALGYFHRAEQGKT	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1478	DDEALGYFHRAEQGK	10	25
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1484	DEALGYFHRAEQVDP	11	26
XRCC5-RMDN1	chr2	216997110	chr8	87489553	1253	DRB1-1484	DEALGYFHRAEQGKT	11	26

Top

Fusion breakpoint peptide structures of XRCC5-RMDN1

3D structures of the fusion breakpoint peptide of 14AA sequence that have potential fusion neoantigens
* The minimum length of the amino acid sequence in RoseTTAFold is 14AA. Here, we predicted the 14AA fusion protein breakpoint sequence not the fusion neoantigen peptide, which is shorter than 14 AA.

File name	BPseq	Hgene	Tgene	Hchr	Hbp	Tchr	Tbp	AAlen
2281	FAARDDEALGYFHR	XRCC5	RMDN1	chr2	216997110	chr8	87489553	1253

Top

Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D of XRCC5-RMDN1

Virtual screening between 25 HLAs (from PDB) and FusionNeoAntigens
* We used Glide to predict the interaction between HLAs and neoantigens.

HLA allele	PDB ID	File name	BPseq	Docking score	Glide score
HLA-B14:02	3BVN	2281	FAARDDEALGYFHR	-4.62424	-5.65954
HLA-B14:02	3BVN	2281	FAARDDEALGYFHR	-4.1114	-4.2248
HLA-B52:01	3W39	2281	FAARDDEALGYFHR	-6.8001	-6.9135
HLA-B52:01	3W39	2281	FAARDDEALGYFHR	-6.46104	-7.49634
HLA-A24:02	5HGA	2281	FAARDDEALGYFHR	-9.1447	-9.2581
HLA-A24:02	5HGA	2281	FAARDDEALGYFHR	-6.01279	-7.04809
HLA-B44:05	3DX8	2281	FAARDDEALGYFHR	-5.02862	-5.14202
HLA-B44:05	3DX8	2281	FAARDDEALGYFHR	-4.60714	-5.64244

Top

Vaccine Design for the FusionNeoAntigens of XRCC5-RMDN1

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-Is.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide sequence	FusionNeoAntigen RNA sequence
XRCC5-RMDN1	chr2	216997110	chr8	87489553	11	19	DEALGYFH	GATGAGGCCTTAGGCTACTTTCAC
XRCC5-RMDN1	chr2	216997110	chr8	87489553	12	21	EALGYFHRA	GAGGCCTTAGGCTACTTTCACAGGGCA
XRCC5-RMDN1	chr2	216997110	chr8	87489553	6	15	FAARDDEAL	TTTGCAGCAAGAGATGATGAGGCCTTA
XRCC5-RMDN1	chr2	216997110	chr8	87489553	6	17	FAARDDEALGY	TTTGCAGCAAGAGATGATGAGGCCTTAGGCTAC
XRCC5-RMDN1	chr2	216997110	chr8	87489553	8	17	ARDDEALGY	GCAAGAGATGATGAGGCCTTAGGCTAC
XRCC5-RMDN1	chr2	216997110	chr8	87489553	8	18	ARDDEALGYF	GCAAGAGATGATGAGGCCTTAGGCTACTTT
XRCC5-RMDN1	chr2	216997110	chr8	87489553	9	18	RDDEALGYF	AGAGATGATGAGGCCTTAGGCTACTTT

mRNA and peptide sequences of FusionNeoAntigens that have potential interaction with HLA-IIs.

Fusion gene	Hchr	Hbp	Tchr	Tbp	Start in +/-13AA	End in +/-13AA	FusionNeoAntigen peptide	FusionNEoAntigen RNA sequence
XRCC5-RMDN1	chr2	216997110	chr8	87489553	0	15	NQVLKVFAARDDEAL	AATCAAGTTCTAAAGGTCTTTGCAGCAAGAGATGATGAGGCCTTA
XRCC5-RMDN1	chr2	216997110	chr8	87489553	10	25	DDEALGYFHRAEQGK	GATGATGAGGCCTTAGGCTACTTTCACAGGGCAGAACAAGGAAAG
XRCC5-RMDN1	chr2	216997110	chr8	87489553	10	25	DDEALGYFHRAEQVD	GATGATGAGGCCTTAGGCTACTTTCACAGGGCAGAACAAGTGGAT
XRCC5-RMDN1	chr2	216997110	chr8	87489553	11	26	DEALGYFHRAEQGKT	GATGAGGCCTTAGGCTACTTTCACAGGGCAGAACAAGGAAAGACA
XRCC5-RMDN1	chr2	216997110	chr8	87489553	11	26	DEALGYFHRAEQVDP	GATGAGGCCTTAGGCTACTTTCACAGGGCAGAACAAGTGGATCCA

Top

Information of the samples that have these potential fusion neoantigens of XRCC5-RMDN1

These samples were reported as having these fusion breakpoints. For individual breakpoints, we checked the open reading frames considering multiple gene isoforms and chose the in-frame fusion genes only. Then, we made fusion protein sequences and predicted the fusion neoantigens. These fusion-positive samples may have these potential fusion neoantigens.

Cancer type	Fusion gene	Hchr	Hbp	Henst	Tchr	Tbp	Tenst	Sample
STAD	XRCC5-RMDN1	chr2	216997110	ENST00000392132	chr8	87489553	ENST00000519966	TCGA-BR-A4QI-01A

Top

Potential target of CAR-T therapy development for XRCC5-RMDN1

Predicted 3D structure. We used RoseTTAFold.

Retention analysis result of each fusion partner protein across 39 protein features of UniProt such as six molecule processing features, 13 region features, four site features, six amino acid modification features, two natural variation features, five experimental info features, and 3 secondary structure features. Here, to provide the retention of the transmembrane domain, we only show the protein feature retention information of those transmembrane features

* Minus value of BPloci means that the break point is located before the CDS.

- In-frame and retained 'Transmembrane'.

Partner

Gene

Hbp

Tbp

ENST

Strand

BPexon

TotalExon

Protein feature loci

*BPloci

TotalLen

Protein feature

Protein feature note

Subcellular localization prediction of the transmembrane domain retained fusion proteins
* We used DeepLoc 1.0. The order of the X-axis of the barplot is as follows: Entry_ID, Localization, Type, Nucleus, Cytoplasm, Extracellular, Mitochondrion, Cell_membrane, Endoplasmic_reticulum, Plastid, Golgi.apparatus, Lysosome.Vacuole, Peroxisome. Y-axis is the output score of DeepLoc. Clicking the image will open a new tab with a large image.

Hgene

Hchr

Hbp

Henst

Tgene

Tchr

Tbp

Tenst

DeepLoc result

Top

Related Drugs to XRCC5-RMDN1

Drugs used for this fusion-positive patient.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Drug

Source

PMID

Top

Related Diseases to XRCC5-RMDN1

Diseases that have this fusion gene.
(Manual curation of PubMed, 04-30-2022 + MyCancerGenome)

Hgene

Tgene

Disease

Source

PMID

Diseases associated with fusion partners.
(DisGeNet 4.0)

Partner

Gene

Disease ID

Disease name

# pubmeds

Source

	Fusion Gene and Fusion Protein Summary
	Fusion Amino Acid Sequences (multiple BPs and multiple gene isoforms)
	Fusion Protein Breakpoint Sequences - (for the Screening of the FusionNeoAntigens)
	Potential FusionNeoAntigens in HLA I - (netMHCpan v4.1 + deepHLApan v1.1)
	Potential FusionNeoAntigens in HLA II - (netMHCIIpan v4.1)
	Fusion Breakpoint 14 AA Peptide Structure - (RoseTTAFold)
	Filtering FusionNeoAntigens Through Checking the Interaction with HLAs in 3D - (Glide)
	Vaccine Design for the FusionNeoAntigens (RNA/protein sequences)
	Potential target of CAR-T therapy development
	Information on the samples that have these potential fusion neoantigens
	Fusion Protein Targeting Drugs - (Manual Curation)
	Fusion Protein Related diseases - (Manual Curation)