Home

Download

Statistics

Examples

Help

Contact

	Gene Summary
	Translation studies in PubMed
	Exon Skipping Events
	Expression
	Expression Regulation
	Associated Genes
	Protein 3D Structure
	Protein-Protein Interaction
	Mutations
	Prognostic Analysis
	Gender Association
	Age Association
	Related Drugs
	Related Diseases

Translation Factor: WARS2 (NCBI Gene ID:10352)

Gene Summary

Gene Summary

Gene Information	Gene Name: WARS2
	Gene ID: 10352
	Gene Symbol	WARS2
	Gene ID	10352
	Gene Name	tryptophanyl tRNA synthetase 2, mitochondrial
	Synonyms	NEMMLAS\|TrpRS\|mtTrpRS
	Cytomap	1p12
	Type of Gene	protein-coding
	Description	tryptophan--tRNA ligase, mitochondrial(Mt)TrpRStryptophan tRNA ligase 2, mitochondrial
	Modification date	20200313
	UniProtAcc	Q9UGM6

Child GO biological process term(s) under GO:0006412

GO ID	GO term
GO:0032543	Mitochondrial translation
GO:0006418	tRNA aminoacylation for protein translation
GO:0006412	Translation

Gene ontology of translaction factor with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner

Gene

GO ID

GO term

PubMed ID

Inferred gene age of translation factor.

Gene	Inferred gene age group among (0 - 67.6], (67.6 - 355.7], (355.7 - 733], (733 - 1119.25], >1119.25
WARS2	>1119.25

Top

Translation Studies in PubMed

We searched PubMed using 'WARS2[title] AND translation [title] AND human.'

Gene	Title	PMID
WARS2	.	.

Top

Exon Skipping Events

Skipped exons in TCGA and GTEx based on Ensembl gene isoform structure.
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.
For more annotations, please visit our ExonSkipDB.

Open reading frame (ORF) analsis of exon skipping events based on Ensembl gene isoform structure.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.

ENST	Exon skip start (DNA)	Exon Skip end (DNA)	ORF
ENST00000235521	119584886	119584972	Frame-shift
ENST00000235521	119618972	119619230	In-frame

Exon skipping position in the amino acid sequence.

ENST	Exon skip start (DNA)	Exon Skip end (DNA)	Len(transcript seq)	Exon skip start (mRNA)	Exon Skip end (mRNA)	Len(amino acid seq)	Exon skip start (AA)	Exon Skip end (AA)
ENST00000235521	119618972	119619230	2817	118	375	360	30	116

Potentially (partially) lost protein functional features of UniProt.

UniProtAcc	Exon skip start (AA)	Exon Skip end (AA)	Function feature start (AA)	Function feature end (AA)	Functional feature type	Functional feature desc.
Q9UGM6	30	116	19	360	Chain	ID=PRO_0000035828;Note=Tryptophan--tRNA ligase%2C mitochondrial
Q9UGM6	30	116	48	51	Nucleotide binding	Note=ATP;Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:5EKD
Q9UGM6	30	116	42	42	Binding site	Note=ATP;Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:5EKD
Q9UGM6	30	116	45	45	Natural variant	ID=VAR_079734;Note=In NEMMLAS. G->V;Ontology_term=ECO:0000269;evidence=ECO:0000269\|PubMed:28905505;Dbxref=PMID:28905505
Q9UGM6	30	116	50	50	Natural variant	ID=VAR_028848;Note=G->S;Ontology_term=ECO:0000269;evidence=ECO:0000269\|PubMed:15489334;Dbxref=dbSNP:rs11552864,PMID:15489334
Q9UGM6	30	116	77	77	Natural variant	ID=VAR_079735;Note=In NEMMLAS%3B unknown pathological significance. H->Q;Ontology_term=ECO:0000269;evidence=ECO:0000269\|PubMed:28905505;Dbxref=dbSNP:rs766501807,PMID:28905505
Q9UGM6	30	116	100	100	Natural variant	ID=VAR_079736;Note=In NEMMLAS. Missing;Ontology_term=ECO:0000269;evidence=ECO:0000269\|PubMed:28650581;Dbxref=PMID:28650581
Q9UGM6	30	116	37	41	Beta strand	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:5EKD
Q9UGM6	30	116	43	45	Beta strand	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:5EKD
Q9UGM6	30	116	49	54	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:5EKD
Q9UGM6	30	116	56	65	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:5EKD
Q9UGM6	30	116	69	73	Beta strand	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:5EKD
Q9UGM6	30	116	75	78	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:5EKD
Q9UGM6	30	116	85	102	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:5EKD
Q9UGM6	30	116	106	108	Turn	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:5EKD
Q9UGM6	30	116	109	113	Beta strand	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:5EKD
Q9UGM6	30	116	114	116	Helix	Ontology_term=ECO:0000244;evidence=ECO:0000244\|PDB:5EKD

Top

Expression

Gene expression level across TCGA pancancer

Gene expression level across GTEx pantissue

Expression level of gene isoforms across TCGA pancancer

Expression level of gene isoforms across GTEx pantissue

Cancer(tissue) type-specific expression level of Translation factor using z-score distriution

Differential expression between tumor and matched normal (in the cancer types with more than 10 matched samples)

Cancer type	Translation factor	FC	adj.pval
PRAD	WARS2	2.22021907294155	3.33417295851411e-06

Top

Expression Regulation

Translation factor expression regulation through miRNA binding

Cancer type	Gene	miRNA	TargetScan binding score (Context++ score percentile)	Coefficient	Pvalue
ESCA	WARS2	hsa-miR-9-5p	86	-0.339546529419947	0.00247780535528675

Translation factor expression regulation through methylation in the promoter of Translation factor

Cancer type

Gene

methyl group b

methyl group a

DEG pval

avg methyl in b

avg methyl in a

avg exp in b

avg exp in a

Translation factor expression regulation through methylation in the gene body of Translation factor (positive regulation)

Cancer type

Gene

methyl group b

methyl group a

DEG pval

avg methyl in b

avg methyl in a

avg exp in b

avg exp in a

Translation factor expression regulation through copy number variation of Translation factor

Cancer type

Gene

Coefficient

Pvalue

Top

Associated Genes

Strongly correlated genes belong to cellular important gene groups with WARS2 (coefficient>0.8, pval<0.05, node color based on FC between tumor and matched normal). Significantly associated important genes in the individual cancer types. * Cell metabolism gene: cell metabolism genes from REACTOME (black edge), IUPHAR: drug target genes from IUPHAR (blue edge), Kinase: human kinase genes (brown edge), CGC: cancer gene census genes (orange edge), TSG: tumor suppresor genes (purple edge), Epifactor: epigenetic factors (light blue edge), TF: transcription factors (green)

Cancer type	Gene group	Translation factor	Correlated gene	Coefficient	Pvalue
KICH	Cell metabolism gene	WARS2	SSR1	0.800267163	1.79E-21
KICH	Epifactor	WARS2	HDAC2	0.807604112	4.02E-22
KICH	IUPHAR	WARS2	HDAC2	0.807604112	4.02E-22
KICH	TSG	WARS2	IFT88	0.833433605	1.20E-24

Top

Protein structure

Protein 3D structure
Visit iCn3D.

Top

Protein-Protein Interaction

Protein-protein interaction networks
* Overlap between up-regulated DEGs (log2FC<-1 and adj.P<0.05) and STRING PPI network (center: Translation factor, node: DEGs, edges: weighted by -log2(adj.P))

Overlap between down-regulated DEGs (log2FC>1 and adj.P<0.05) and STRING PPI network (center: Translation factor, node: DEGs, edges: weighted by -log2(adj.P))

* Edge colors based on TCGA cancer types.

* Overlap between DEGs (log2FC>1 and adj.P<0.05) and STRING PPI network per cancer (center: Translation factor, node: DEGs, node color: log2FC, edges: weighted by -log2(adj.P))

Cancer type	Translation factor	Interacting protein coding gene	FC	adj.pval
STAD	WARS2	LARS2	-3.14243034518345	0.00019507110118866
STAD	WARS2	YARS	-6.49411565641968	0.000280400272458792
KIRP	WARS2	PARS2	1.16452168188224	0.000471815001219511
HNSC	WARS2	YARS	1.29642872422682	0.000481783007217019
THCA	WARS2	LARS2	1.46480152873302	0.000495104848866816
STAD	WARS2	AARS	-1.37044043826934	0.000657554250210524
BLCA	WARS2	PARS2	-2.53947468245316	0.002838134765625
THCA	WARS2	WARS	2.95768973159174	0.00305071956645465
HNSC	WARS2	YARS2	1.51758504797514	0.00498432417884942
KIRC	WARS2	WARS	-3.93324665771133	0.00591357067334741
STAD	WARS2	CDH5	2.00605684119557	0.0148032568395138
ESCA	WARS2	YARS2	-2.00710684466974	0.0185546875
READ	WARS2	WARS	-1.7125292902591	0.03125
STAD	WARS2	IARS2	-1.36774073274524	0.0324882394634187
PRAD	WARS2	PARS2	-1.46158282673459	0.0436765184075403
LUAD	WARS2	PARS2	-3.49187010929807	1.06715530949094e-10
BRCA	WARS2	LARS2	-5.48583270161281	1.12177735729832e-06
THCA	WARS2	YARS	-1.52851760350795	1.38467683131598e-09
LUAD	WARS2	SARS2	-1.6825303693262	1.52668366875458e-07
BRCA	WARS2	IARS2	1.50870900515201	2.53632294696759e-14
LUAD	WARS2	LARS2	-1.17851720308655	2.81164525558733e-06
KICH	WARS2	YARS	-2.00632816869948	2.98023223876953e-07
LUSC	WARS2	PARS2	-2.93653902690081	3.1117120779415e-08
BRCA	WARS2	YARS	-2.58863291399932	3.63754942015711e-21
LUSC	WARS2	WARS	-1.79063789640973	4.0549719008113e-07
KICH	WARS2	LARS2	1.44112931619469	4.17232513427734e-06
LUAD	WARS2	WARS	-1.3247218686619	4.20890892730867e-05
BRCA	WARS2	CDH5	-1.807083202754	4.22798866054525e-23
LUAD	WARS2	AARS	-6.1139400689607	4.40386642176516e-08
LUAD	WARS2	CDH5	-2.18549136229301	4.67307812889392e-11
KIRC	WARS2	SARS2	1.02423405449982	8.65930768143138e-05
STAD	WARS2	NARS2	-1.47625969382721	9.99853946268559e-05

Protein-protein interactors with this translation factor (BIOGRID-3.4.160)

PPI interactors with WARS2

APP, RMND5A, Naa11, WARS2, EFTUD2, MRM1, PDK1, TRMT61B, KRAS, HSCB, C21orf33, C6orf203, GFM1, GRSF1, ICT1, MDH2, MRRF, MTIF2, MTIF3, PMPCB, SSBP1, TBRG4, TSFM, CLPP, COX8A, CS, PDHA1,

Top

Mutations

Clinically associated variants from ClinVar.

Gene	Chr	Position	RefSeq	VarSeq	RefSeeq	VarType	Pathogenic	Disease	VarInfo
WARS2	chr1	119575297	C	G	single_nucleotide_variant	Benign	not_provided	SO:0001624\|3_prime_UTR_variant	SO:0001624\|3_prime_UTR_variant
WARS2	chr1	119575538	A	G	single_nucleotide_variant	Benign	not_provided	SO:0001583\|missense_variant,SO:0001624\|3_prime_UTR_variant	SO:0001583\|missense_variant,SO:0001624\|3_prime_UTR_variant
WARS2	chr1	119575587	C	A	single_nucleotide_variant	Uncertain_significance	not_provided	SO:0001587\|nonsense,SO:0001624\|3_prime_UTR_variant	SO:0001587\|nonsense,SO:0001624\|3_prime_UTR_variant
WARS2	chr1	119575601	G	A	single_nucleotide_variant	Uncertain_significance	Neurodevelopmental_disorder,_mitochondrial,_with_abnormal_movements_and_lactic_acidosis,_with_or_without_seizures	SO:0001583\|missense_variant,SO:0001624\|3_prime_UTR_variant	SO:0001583\|missense_variant,SO:0001624\|3_prime_UTR_variant
WARS2	chr1	119575679	T	A	single_nucleotide_variant	Uncertain_significance	Neurodevelopmental_disorder,_mitochondrial,_with_abnormal_movements_and_lactic_acidosis,_with_or_without_seizures\|Inborn_genetic_diseases\|not_provided	SO:0001583\|missense_variant,SO:0001624\|3_prime_UTR_variant	SO:0001583\|missense_variant,SO:0001624\|3_prime_UTR_variant
WARS2	chr1	119575687	C	T	single_nucleotide_variant	Benign	not_provided	SO:0001819\|synonymous_variant,SO:0001624\|3_prime_UTR_variant	SO:0001819\|synonymous_variant,SO:0001624\|3_prime_UTR_variant
WARS2	chr1	119575718	G	A	single_nucleotide_variant	Uncertain_significance	Neurodevelopmental_disorder,_mitochondrial,_with_abnormal_movements_and_lactic_acidosis,_with_or_without_seizures	SO:0001583\|missense_variant,SO:0001624\|3_prime_UTR_variant	SO:0001583\|missense_variant,SO:0001624\|3_prime_UTR_variant
WARS2	chr1	119575818	C	G	single_nucleotide_variant	Benign	not_provided	SO:0001583\|missense_variant,SO:0001624\|3_prime_UTR_variant	SO:0001583\|missense_variant,SO:0001624\|3_prime_UTR_variant
WARS2	chr1	119575819	CG	C	Deletion	Uncertain_significance	Neurodevelopmental_disorder,_mitochondrial,_with_abnormal_movements_and_lactic_acidosis,_with_or_without_seizures\|Inborn_genetic_diseases	SO:0001589\|frameshift_variant,SO:0001624\|3_prime_UTR_variant	SO:0001589\|frameshift_variant,SO:0001624\|3_prime_UTR_variant
WARS2	chr1	119575826	T	C	single_nucleotide_variant	Conflicting_interpretations_of_pathogenicity	not_provided	SO:0001583\|missense_variant,SO:0001624\|3_prime_UTR_variant	SO:0001583\|missense_variant,SO:0001624\|3_prime_UTR_variant
WARS2	chr1	119575838	G	A	single_nucleotide_variant	Uncertain_significance	not_provided	SO:0001583\|missense_variant,SO:0001624\|3_prime_UTR_variant	SO:0001583\|missense_variant,SO:0001624\|3_prime_UTR_variant
WARS2	chr1	119575863	G	A	single_nucleotide_variant	Uncertain_significance	Inborn_genetic_diseases\|not_provided	SO:0001583\|missense_variant,SO:0001624\|3_prime_UTR_variant	SO:0001583\|missense_variant,SO:0001624\|3_prime_UTR_variant
WARS2	chr1	119575902	G	A	single_nucleotide_variant	Likely_pathogenic	not_provided	SO:0001587\|nonsense,SO:0001624\|3_prime_UTR_variant	SO:0001587\|nonsense,SO:0001624\|3_prime_UTR_variant
WARS2	chr1	119575933	C	T	single_nucleotide_variant	Benign	not_provided	SO:0001819\|synonymous_variant,SO:0001624\|3_prime_UTR_variant	SO:0001819\|synonymous_variant,SO:0001624\|3_prime_UTR_variant
WARS2	chr1	119575934	G	C	single_nucleotide_variant	Uncertain_significance	Neurodevelopmental_disorder,_mitochondrial,_with_abnormal_movements_and_lactic_acidosis,_with_or_without_seizures	SO:0001583\|missense_variant,SO:0001624\|3_prime_UTR_variant	SO:0001583\|missense_variant,SO:0001624\|3_prime_UTR_variant
WARS2	chr1	119576730	C	A	single_nucleotide_variant	Pathogenic	Neurodevelopmental_disorder,_mitochondrial,_with_abnormal_movements_and_lactic_acidosis,_with_or_without_seizures	SO:0001583\|missense_variant,SO:0001587\|nonsense	SO:0001583\|missense_variant,SO:0001587\|nonsense
WARS2	chr1	119576820	C	G	single_nucleotide_variant	Pathogenic	Neurodevelopmental_disorder,_mitochondrial,_with_abnormal_movements_and_lactic_acidosis,_with_or_without_seizures	SO:0001583\|missense_variant	SO:0001583\|missense_variant
WARS2	chr1	119576904	G	A	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
WARS2	chr1	119584915	G	A	single_nucleotide_variant	Uncertain_significance	Neurodevelopmental_disorder,_mitochondrial,_with_abnormal_movements_and_lactic_acidosis,_with_or_without_seizures	SO:0001583\|missense_variant,SO:0001627\|intron_variant	SO:0001583\|missense_variant,SO:0001627\|intron_variant
WARS2	chr1	119584919	T	C	single_nucleotide_variant	Benign	not_provided	SO:0001819\|synonymous_variant,SO:0001627\|intron_variant	SO:0001819\|synonymous_variant,SO:0001627\|intron_variant
WARS2	chr1	119584949	G	A	single_nucleotide_variant	Benign	not_provided	SO:0001819\|synonymous_variant,SO:0001627\|intron_variant	SO:0001819\|synonymous_variant,SO:0001627\|intron_variant
WARS2	chr1	119584950	T	C	single_nucleotide_variant	Likely_benign	not_provided	SO:0001583\|missense_variant,SO:0001627\|intron_variant	SO:0001583\|missense_variant,SO:0001627\|intron_variant
WARS2	chr1	119588230	C	T	single_nucleotide_variant	Uncertain_significance	Neurodevelopmental_disorder,_mitochondrial,_with_abnormal_movements_and_lactic_acidosis,_with_or_without_seizures	SO:0001583\|missense_variant	SO:0001583\|missense_variant
WARS2	chr1	119591855	TGTCTGGGGCAGTCGGAGGACAACCTGGGCCACCAAGCGGCCCAACTCCAGGGGAAAACCATCTCCCTTCTGGCTCCCCCATCTGCTGTTTTCTCCGTATTTCAATAGTTTCTCTTTTCAGTCTCCTTTTGCTGGTTCCTCCCCTTTAACCTGACTTCTTAATTGCTGACACCCAGGTTTCAGTCTTTGTTTCTTCTATTGTTTTTTATACCCACTCCCTTTGCAATATCACATCATCTCACTGCTTTAAGTAAA	T	Deletion	Pathogenic	Neurodevelopmental_disorder,_mitochondrial,_with_abnormal_movements_and_lactic_acidosis,_with_or_without_seizures	SO:0001574\|splice_acceptor_variant,SO:0001575\|splice_donor_variant,SO:0001582\|initiatior_codon_variant,SO:0001627\|intron_variant	SO:0001574\|splice_acceptor_variant,SO:0001575\|splice_donor_variant,SO:0001582\|initiatior_codon_variant,SO:0001627\|intron_variant
WARS2	chr1	119618970	G	A	single_nucleotide_variant	Uncertain_significance	Neurodevelopmental_disorder,_mitochondrial,_with_abnormal_movements_and_lactic_acidosis,_with_or_without_seizures	SO:0001627\|intron_variant	SO:0001627\|intron_variant
WARS2	chr1	119618995	CT	C	Deletion	Pathogenic	Neurodevelopmental_disorder,_mitochondrial,_with_abnormal_movements_and_lactic_acidosis,_with_or_without_seizures	SO:0001589\|frameshift_variant,SO:0001627\|intron_variant	SO:0001589\|frameshift_variant,SO:0001627\|intron_variant
WARS2	chr1	119619004	G	A	single_nucleotide_variant	Uncertain_significance	Neurodevelopmental_disorder,_mitochondrial,_with_abnormal_movements_and_lactic_acidosis,_with_or_without_seizures	SO:0001583\|missense_variant,SO:0001627\|intron_variant	SO:0001583\|missense_variant,SO:0001627\|intron_variant
WARS2	chr1	119619020	CAAG	C	Microsatellite	Conflicting_interpretations_of_pathogenicity	Neurodevelopmental_disorder,_mitochondrial,_with_abnormal_movements_and_lactic_acidosis,_with_or_without_seizures\|Inborn_genetic_diseases	SO:0001822\|inframe_deletion,SO:0001627\|intron_variant	SO:0001822\|inframe_deletion,SO:0001627\|intron_variant
WARS2	chr1	119619073	T	C	single_nucleotide_variant	Uncertain_significance	not_provided	SO:0001583\|missense_variant,SO:0001623\|5_prime_UTR_variant,SO:0001627\|intron_variant	SO:0001583\|missense_variant,SO:0001623\|5_prime_UTR_variant,SO:0001627\|intron_variant
WARS2	chr1	119619172	C	T	single_nucleotide_variant	Likely_pathogenic	Neurodevelopmental_disorder,_mitochondrial,_with_abnormal_movements_and_lactic_acidosis,_with_or_without_seizures	SO:0001583\|missense_variant,SO:0001623\|5_prime_UTR_variant,SO:0001627\|intron_variant	SO:0001583\|missense_variant,SO:0001623\|5_prime_UTR_variant,SO:0001627\|intron_variant
WARS2	chr1	119619174	C	G	single_nucleotide_variant	Benign	not_provided	SO:0001819\|synonymous_variant,SO:0001623\|5_prime_UTR_variant,SO:0001627\|intron_variant	SO:0001819\|synonymous_variant,SO:0001623\|5_prime_UTR_variant,SO:0001627\|intron_variant
WARS2	chr1	119619178	T	C	single_nucleotide_variant	Uncertain_significance	Inborn_genetic_diseases	SO:0001583\|missense_variant,SO:0001623\|5_prime_UTR_variant,SO:0001627\|intron_variant	SO:0001583\|missense_variant,SO:0001623\|5_prime_UTR_variant,SO:0001627\|intron_variant
WARS2	chr1	119619187	C	A	single_nucleotide_variant	Pathogenic	Neurodevelopmental_disorder,_mitochondrial,_with_abnormal_movements_and_lactic_acidosis,_with_or_without_seizures	SO:0001583\|missense_variant,SO:0001623\|5_prime_UTR_variant,SO:0001627\|intron_variant	SO:0001583\|missense_variant,SO:0001623\|5_prime_UTR_variant,SO:0001627\|intron_variant
WARS2	chr1	119619448	G	T	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
WARS2	chr1	119683063	G	A	single_nucleotide_variant	Benign	not_provided	SO:0001619\|non-coding_transcript_variant,SO:0001623\|5_prime_UTR_variant,SO:0001627\|intron_variant	SO:0001619\|non-coding_transcript_variant,SO:0001623\|5_prime_UTR_variant,SO:0001627\|intron_variant
WARS2	chr1	119683231	A	C	single_nucleotide_variant	Conflicting_interpretations_of_pathogenicity	Neurodevelopmental_disorder,_mitochondrial,_with_abnormal_movements_and_lactic_acidosis,_with_or_without_seizures\|not_provided	SO:0001583\|missense_variant,SO:0001619\|non-coding_transcript_variant,SO:0001623\|5_prime_UTR_variant	SO:0001583\|missense_variant,SO:0001619\|non-coding_transcript_variant,SO:0001623\|5_prime_UTR_variant
WARS2	chr1	119683390	G	A	single_nucleotide_variant	Benign	not_provided	SO:0001619\|non-coding_transcript_variant	SO:0001619\|non-coding_transcript_variant

nsSNVs with sample frequency (size of circle) from TCGA 33 cancers.

SNVs and Indels

Gene	Cancer type	Chromosome	Start	End	RefSeeq	MutSeq	Mutation type	AAchange	# samples
WARS2	LUAD	chr1	119619185	119619185	T	C	Missense_Mutation	p.I46V	7
WARS2	SARC	chr1	119575715	119575715	C	T	Missense_Mutation	p.R301H	4
WARS2	BRCA	chr1	119683237	119683237	C	A	Nonsense_Mutation	p.E11*	4
WARS2	COAD	chr1	119575743	119575743	G	A	Missense_Mutation	p.R292C	4
WARS2	LGG	chr1	119576827	119576827	G	A	Silent	p.H175H	3
WARS2	ESCA	chr1	119575957	119575957	T	C	Silent	p.L220L	3
WARS2	HNSC	chr1	119683180	119683180	G	A	Nonsense_Mutation	p.Q30*	3
WARS2	HNSC	chr1	119575787	119575787	G	A	Missense_Mutation	p.A277V	3
WARS2	UCEC	chr1	119575637	119575637	T	C	Missense_Mutation	p.D327G	3
WARS2	ACC	chr1	119683258	119683258	G	A	Missense_Mutation	p.H4Y	3
WARS2	LIHC	chr1	119575613	119575613	A	-	Frame_Shift_Del	p.L335fs	3
WARS2	STAD	chr1	119575767	119575767	C	T	Missense_Mutation		2
WARS2	SKCM	chr1	119575949	119575949	G	A	Missense_Mutation	p.P223L	2
WARS2	STAD	chr1	119619106	119619106	C	T	Missense_Mutation		2
WARS2	STAD	chr1	119575803	119575803	C	T	Missense_Mutation	p.V272M	2
WARS2	HNSC	chr1	119619197	119619197	G	T	Missense_Mutation	p.Q42K	2
WARS2	SKCM	chr1	119576822	119576822	G	A	Missense_Mutation	p.P177L	2
WARS2	STAD	chr1	119575767	119575767	C	T	Missense_Mutation	p.G284R	2
WARS2	STAD	chr1	119575732	119575732	C	T	Silent	p.A295A	2
WARS2	SKCM	chr1	119619093	119619093	G	A	Silent	p.L76L	2
WARS2	LGG	chr1	119576827	119576827	G	A	Silent		2
WARS2	STAD	chr1	119619106	119619106	C	T	Missense_Mutation	p.S72N	2
WARS2	HNSC	chr1	119619152	119619152	C	G	Missense_Mutation	p.E57Q	2
WARS2	SKCM	chr1	119575597	119575597	T	C	Silent	p.A340A	2
WARS2	STAD	chr1	119575812	119575812	G	A	Missense_Mutation	p.R269C	2
WARS2	LUAD	chr1	119575683	119575683	C	A	Nonsense_Mutation	p.E312*	2
WARS2	STAD	chr1	119584963	119584963	T	C	Missense_Mutation	p.T147A	2
WARS2	HNSC	chr1	119575733	119575733	G	A	Missense_Mutation	p.A295V	2
WARS2	STAD	chr1	119575742	119575742	C	T	Missense_Mutation	p.R292H	2
WARS2	HNSC	chr1	119575893	119575893	C	A	Missense_Mutation	p.D242Y	2
WARS2	STAD	chr1	119575586	119575586	T	G	Missense_Mutation	p.E344A	2
WARS2	UCEC	chr1	119575710	119575710	T	C	Missense_Mutation	p.K303E	2
WARS2	ESCA	chr1	119683180	119683180	G	T	Missense_Mutation	p.Q30K	2
WARS2	STAD	chr1	119575804	119575804	G	A	Silent	p.G271G	2
WARS2	UCEC	chr1	119584944	119584944	C	T	Missense_Mutation	p.G153D	2
WARS2	LGG	chr1	119683216	119683216	C	T	Missense_Mutation	p.A18T	2
WARS2	STAD	chr1	119619170	119619170	T	C	Missense_Mutation	p.N51D	2
WARS2	SARC	chr1	119575715	119575715	C	T	Missense_Mutation		2
WARS2	UCEC	chr1	119588247	119588247	G	A	Silent	p.C129	2
WARS2	ESCA	chr1	119683180	119683180	G	T	Missense_Mutation		2
WARS2	LUAD	chr1	119576771	119576771	T	A	Missense_Mutation	p.Q194L	2
WARS2	STAD	chr1	119575735	119575735	G	A	Silent	p.S294S	2
WARS2	HNSC	chr1	119575875	119575875	C	A	Missense_Mutation	p.V248L	1
WARS2	OV	chr1	119377371	119377371	C	G	Missense_Mutation	p.D257H	1
WARS2	LUAD	chr1	119575582	119575582	T	C	Silent	p.L345L	1
WARS2	STAD	chr1	119575543	119575543	A	G	Silent	p.G358G	1
WARS2	HNSC	chr1	119575854	119575854	C	T	Missense_Mutation	p.V255M	1
WARS2	PCPG	chr1	119575971	119575971	T	A	Nonsense_Mutation	p.K216X	1
WARS2	CESC	chr1	119683254	119683254	G	A	Missense_Mutation		1
WARS2	LGG	chr1	119618995	119618996	-	T	Frame_Shift_Ins	p.H109fs	1
WARS2	ESCA	chr1	119575742	119575742	C	A	Missense_Mutation		1
WARS2	PCPG	chr1	119575971	119575971	T	A	Nonsense_Mutation	p.K216*	1
WARS2	CESC	chr1	119683254	119683254	G	A	Missense_Mutation	p.S5L	1
WARS2	LGG	chr1	119575933	119575933	C	T	Silent		1
WARS2	HNSC	chr1	119575893	119575893	C	A	Missense_Mutation		1
WARS2	LUAD	chr1	119575634	119575634	T	C	Missense_Mutation	p.K328R	1
WARS2	PCPG	chr1	119575971	119575971	T	A	Nonsense_Mutation		1
WARS2	COAD	chr1	119575775	119575775	G	A	Missense_Mutation	p.A281V	1
WARS2	HNSC	chr1	119575875	119575875	C	A	Missense_Mutation		1
WARS2	LUAD	chr1	119575563	119575563	C	A	Nonsense_Mutation	p.E352*	1
WARS2	STAD	chr1	119575832	119575832	A	G	Missense_Mutation	p.V262A	1
WARS2	PRAD	chr1	119584902	119584902	T	C	Missense_Mutation	p.D167G	1
WARS2	COAD	chr1	119575862	119575862	C	T	Missense_Mutation	p.R252H	1
WARS2	LGG	chr1	119683216	119683216	C	T	Missense_Mutation		1
WARS2	HNSC	chr1	119619152	119619152	C	G	Missense_Mutation		1
WARS2	UCEC	chr1	119588247	119588247	G	A	Silent	p.C129C	1
WARS2	PRAD	chr1	119575758	119575758	C	T	Missense_Mutation	p.V287M	1
WARS2	SKCM	chr1	119575560	119575560	C	T	Missense_Mutation	p.V353M	1
WARS2	COAD	chr1	119575923	119575923	G	T	Missense_Mutation	p.P232T	1
WARS2	LIHC	chr1	119575853	119575853	A	G	Missense_Mutation		1
WARS2	HNSC	chr1	119619197	119619197	G	T	Missense_Mutation		1
WARS2	LUAD	chr1	119575622	119575622	T	A	Missense_Mutation	p.E332V	1
WARS2	SKCM	chr1	119575778	119575778	G	A	Missense_Mutation	p.A280V	1
WARS2	COAD	chr1	119619180	119619180	G	T	Silent	p.L47L	1
WARS2	LIHC	chr1	119683215	119683215	G	T	Missense_Mutation	p.A18E	1
WARS2	HNSC	chr1	119584949	119584949	G	A	Silent		1
WARS2	LUAD	chr1	119575623	119575623	C	G	Missense_Mutation	p.E332Q	1
WARS2	READ	chr1	119576743	119576743	G	T	Missense_Mutation	p.F203L	1
WARS2	UCEC	chr1	119575967	119575968	-	C	Frame_Shift_Ins	p.V217fs	1
WARS2	SKCM	chr1	119575764	119575764	G	A	Missense_Mutation	p.L285F	1
WARS2	LIHC	chr1	119619130	119619131	-	C	Frame_Shift_Ins	p.*64fs	1
WARS2	HNSC	chr1	119575733	119575733	G	A	Missense_Mutation		1
WARS2	LUSC	chr1	119575726	119575726	C	T	Missense_Mutation	p.M297I	1
WARS2	READ	chr1	119619219	119619219	C	A	Missense_Mutation	p.K34N	1
WARS2	SKCM	chr1	119575903	119575903	G	A	Silent	p.V238V	1
WARS2	KIRC	chr1	119575670	119575670	G	C	Missense_Mutation	p.P316R	1
WARS2	HNSC	chr1	119575854	119575854	C	T	Missense_Mutation		1
WARS2	LUSC	chr1	119584928	119584928	G	A	Silent	p.L158L	1
WARS2	SARC	chr1	119575960	119575960	G	T	Silent		1
WARS2	SKCM	chr1	119575902	119575902	G	A	Nonsense_Mutation	p.R239*	1
WARS2	BLCA	chr1	119618975	119618975	G	C	Missense_Mutation		1
WARS2	ESCA	chr1	119575742	119575742	C	A	Missense_Mutation	p.R292L	1
WARS2	LIHC	chr1	119619206	119619206	A	-	Frame_Shift_Del	p.S39fs	1
WARS2	HNSC	chr1	119575787	119575787	G	A	Missense_Mutation		1
WARS2	LUSC	chr1	119575589	119575589	T	C	Missense_Mutation	p.K343R	1
WARS2	LGG	chr1	119575933	119575933	C	T	Silent	p.S228S	1
WARS2	SKCM	chr1	119619088	119619088	G	A	Missense_Mutation	p.S78F	1
WARS2	BLCA	chr1	119588231	119588231	G	A	Nonsense_Mutation	p.R135*	1

Copy number variation (CNV) of WARS2
* Click on the image to open the original image in a new window.

Fusion gene breakpoints (product of the structural variants (SVs)) across WARS2
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion genes with this translation factor from FusionGDB2.0.

FusionGDB2 ID	Disease	Sample	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand
97953	TGCT	TCGA-2G-AAG3	FAM157C	chr16	90182891	+	WARS2	chr1	119619230	-
97953	HNSC	TCGA-CV-6937-01A	KIAA1549L	chr11	33596419	+	WARS2	chr1	119619230	-
97953	BRCA	TCGA-BH-A0B2-01A	PPP1R21	chr2	48725874	+	WARS2	chr1	119619230	-
97953	SKCM	TCGA-WE-AAA3-06A	SEC22B	chr1	145096621	-	WARS2	chr1	119619230	-
97954	N/A	AI672033	VAV3	chr1	108417521	-	WARS2	chr1	119588287	-
98706	BRCA	TCGA-B6-A0IG-01A	WARS2	chr1	119618972	-	ASIC2	chr17	31749746	+
98706	N/A	AF179143	WARS2	chr1	119612650	+	CDKN1B	chr12	12871392	+
100995	LUAD	TCGA-55-A490-01A	WARS2	chr1	119683178	-	DLG2	chr11	84865695	-
98706	LIHC	TCGA-BC-A216-01A	WARS2	chr1	119584887	-	HMGCS2	chr1	120307249	-
98706	SKCM	TCGA-D3-A5GS-06A	WARS2	chr1	119618973	-	NTNG1	chr1	107979287	+
98706	SKCM	TCGA-D3-A5GS-06A	WARS2	chr1	119618973	-	NTNG1	chr1	108023233	+
102365	BLCA	TCGA-G2-A3IE-01A	WARS2	chr1	119683178	-	OXR1	chr8	107371704	+
100805	LUSC	TCGA-60-2725-01A	WARS2	chr1	119618973	-	PHGDH	chr1	120263793	+
99889	KIRC	TCGA-CJ-4894-01A	WARS2	chr1	119683178	-	REG4	chr1	120337308	-
98706	DLBC	TCGA-GR-7353	WARS2	chr1	119683177	-	RPF1	chr1	84961564	+
98706	DLBC	TCGA-GR-7353-01A	WARS2	chr1	119683178	-	RPF1	chr1	84961565	+
98706	PRAD	TCGA-HC-8265	WARS2	chr1	119683177	-	SEC22B	chr1	145103907	+
98706	ACC	TCGA-OR-A5LO-01A	WARS2	chr1	119576718	-	TBX15	chr1	119474455	-
98706	BRCA	TCGA-AO-A12B-01A	WARS2	chr1	119584887	-	TBX15	chr1	119474455	-
98706	LUSC	TCGA-22-4591	WARS2	chr1	119683178	-	TBX15	chr1	119474455	-
98706	CESC	TCGA-C5-A7X5-01A	WARS2	chr1	119618973	-	TMEM87B	chr2	112832489	+
98706	CESC	TCGA-C5-A7X5-01A	WARS2	chr1	119618973	-	TMEM87B	chr2	112838634	+
102208	BRCA	TCGA-E9-A243	WARS2	chr1	119618972	-	TPST1	chr7	65817491	+
102208	BRCA	TCGA-E9-A243-01A	WARS2	chr1	119618973	-	TPST1	chr7	65817492	+
98706	CESC	TCGA-C5-A7X5-01A	WARS2	chr1	119618973	-	ZAR1	chr4	48496118	+

Top

Prognostic Analysis

Kaplan-Meier plots with logrank tests of overall survival (OS)

Cancer type

Translation factor

Coefficent

Hazard ratio

Wald test pval

Likelihool ratio pval

Logrank test pval

# samples

Top

Translation factor and Gender

Differential gene expression between female and male. (Wilcoxon test, pval<0.05)

Cancer type	Translation factor	pval	adj.p
LUAD	WARS2	0.00266890131030878	0.075
HNSC	WARS2	0.0298965000007549	0.81

Top

Translation factor and Age

Differential gene expression between young and old age groups (Wilcoxon test, pval<0.05)

Cancer type	Translation factor	pval	adj.p
TGCT	WARS2	0.048558483969533	1
THCA	WARS2	0.00403409813072414	0.13
KICH	WARS2	0.0074993502901798	0.24
LAML	WARS2	0.0136208386534913	0.42
ACC	WARS2	0.0134647621256628	0.42

Top

Related Drugs

Drugs targeting genes involved in this translation factor.
(DrugBank Version 5.1.8 2021-05-08)

UniProtAcc

DrugBank ID

Drug name

Drug activity

Drug type

Drug status

Top

Related Diseases

Diseases associated with this translation factor.
(DisGeNet 4.0)

Disease ID	Disease Name	# PubMeds	Disease source
C4540192	NEURODEVELOPMENTAL DISORDER, MITOCHONDRIAL, WITH ABNORMAL MOVEMENTS AND LACTIC ACIDOSIS, WITH OR WITHOUT SEIZURES	3	GENOMICS_ENGLAND;UNIPROT