Home

Download

Statistics

Examples

Help

Contact

	Gene Summary
	Translation studies in PubMed
	Exon Skipping Events
	Expression
	Expression Regulation
	Associated Genes
	Protein 3D Structure
	Protein-Protein Interaction
	Mutations
	Prognostic Analysis
	Gender Association
	Age Association
	Related Drugs
	Related Diseases

Translation Factor: FTSJ1 (NCBI Gene ID:24140)

Gene Summary

Gene Summary

Gene Information	Gene Name: FTSJ1
	Gene ID: 24140
	Gene Symbol	FTSJ1
	Gene ID	24140
	Gene Name	FtsJ RNA 2'-O-methyltransferase 1
	Synonyms	CDLIV\|JM23\|MRX44\|MRX9\|SPB1\|TRMT7
	Cytomap	Xp11.23
	Type of Gene	protein-coding
	Description	putative tRNA (cytidine(32)/guanosine(34)-2'-O)-methyltransferase2'-O-ribose RNA methyltransferase TRM7 homologFtsJ RNA methyltransferase homolog 1FtsJ-like protein 1cell division proteinputative ribosomal RNA methyltransferase 1rRNA (uridine-2'-O-)
	Modification date	20200313
	UniProtAcc	Q9UET6

Child GO biological process term(s) under GO:0006412

GO ID	GO term
GO:0002181	Cytoplasmic translation
GO:0006412	Translation

Gene ontology of translaction factor with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner

Gene

GO ID

GO term

PubMed ID

Inferred gene age of translation factor.

Gene	Inferred gene age group among (0 - 67.6], (67.6 - 355.7], (355.7 - 733], (733 - 1119.25], >1119.25
FTSJ1	>1119.25

Top

Translation Studies in PubMed

We searched PubMed using 'FTSJ1[title] AND translation [title] AND human.'

Gene	Title	PMID
FTSJ1	Loss of Ftsj1 perturbs codon-specific translation efficiency in the brain and is associated with X-linked intellectual disability	33771871

Top

Exon Skipping Events

Skipped exons in TCGA and GTEx based on Ensembl gene isoform structure.
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.
For more annotations, please visit our ExonSkipDB.

Open reading frame (ORF) analsis of exon skipping events based on Ensembl gene isoform structure.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.

ENST	Exon skip start (DNA)	Exon Skip end (DNA)	ORF
ENST00000348411	48337004	48337095	Frame-shift
ENST00000348411	48337425	48337504	Frame-shift
ENST00000348411	48339538	48339591	Frame-shift
ENST00000348411	48340019	48340103	In-frame
ENST00000348411	48340984	48341182	In-frame

Exon skipping position in the amino acid sequence.

ENST	Exon skip start (DNA)	Exon Skip end (DNA)	Len(transcript seq)	Exon skip start (mRNA)	Exon Skip end (mRNA)	Len(amino acid seq)	Exon skip start (AA)	Exon Skip end (AA)
ENST00000348411	48340019	48340103	1909	895	978	329	190	218
ENST00000348411	48340984	48341182	1909	1083	1280	329	253	319

Potentially (partially) lost protein functional features of UniProt.

UniProtAcc	Exon skip start (AA)	Exon Skip end (AA)	Function feature start (AA)	Function feature end (AA)	Functional feature type	Functional feature desc.
Q9UET6	253	319	1	329	Chain	ID=PRO_0000155575;Note=Putative tRNA (cytidine(32)/guanosine(34)-2'-O)-methyltransferase
Q9UET6	190	218	1	329	Chain	ID=PRO_0000155575;Note=Putative tRNA (cytidine(32)/guanosine(34)-2'-O)-methyltransferase
Q9UET6	253	319	271	271	Modified residue	Note=Phosphoserine;Ontology_term=ECO:0000244;evidence=ECO:0000244\|PubMed:23186163;Dbxref=PMID:23186163

Top

Expression

Gene expression level across TCGA pancancer

Gene expression level across GTEx pantissue

Expression level of gene isoforms across TCGA pancancer

Expression level of gene isoforms across GTEx pantissue

Cancer(tissue) type-specific expression level of Translation factor using z-score distriution

Differential expression between tumor and matched normal (in the cancer types with more than 10 matched samples)

Cancer type	Translation factor	FC	adj.pval
CHOL	FTSJ1	-3.25220415659806	0.00390625
BRCA	FTSJ1	-2.30401801932705	3.67157769892739e-21
HNSC	FTSJ1	1.44084557286369	7.51780044083718e-06

Top

Expression Regulation

Translation factor expression regulation through miRNA binding

Cancer type

Gene

miRNA

TargetScan binding score (Context++ score percentile)

Coefficient

Pvalue

Translation factor expression regulation through methylation in the promoter of Translation factor

Cancer type

Gene

methyl group b

methyl group a

DEG pval

avg methyl in b

avg methyl in a

avg exp in b

avg exp in a

Translation factor expression regulation through methylation in the gene body of Translation factor (positive regulation)

Cancer type	Gene	methyl group b	methyl group a	DEG pval	avg methyl in b	avg methyl in a	avg exp in b	avg exp in a
KIRP	FTSJ1	2	3	0.0336718929140305	0.479787726449275	0.632595478723404	-0.0492700100366942	0.134098360299438
LUSC	FTSJ1	2	3	0.0481154521577766	0.496679863379863	0.627701190476191	-0.280120291003032	-0.0968913264614889

Translation factor expression regulation through copy number variation of Translation factor

Cancer type	Gene	Coefficient	Pvalue
THCA	FTSJ1	0.055121085	0.023087804

Top

Associated Genes

Strongly correlated genes belong to cellular important gene groups with FTSJ1 (coefficient>0.8, pval<0.05, node color based on FC between tumor and matched normal). Significantly associated important genes in the individual cancer types. * Cell metabolism gene: cell metabolism genes from REACTOME (black edge), IUPHAR: drug target genes from IUPHAR (blue edge), Kinase: human kinase genes (brown edge), CGC: cancer gene census genes (orange edge), TSG: tumor suppresor genes (purple edge), Epifactor: epigenetic factors (light blue edge), TF: transcription factors (green)

Cancer type	Gene group	Translation factor	Correlated gene	Coefficient	Pvalue
CHOL	Cell metabolism gene	FTSJ1	IMPDH1	0.813449427	1.12E-11
CHOL	Cell metabolism gene	FTSJ1	SLC16A3	0.817084954	7.60E-12
CHOL	Cell metabolism gene	FTSJ1	MTHFD1L	0.833808794	1.16E-12
CHOL	IUPHAR	FTSJ1	IMPDH1	0.813449427	1.12E-11
CHOL	IUPHAR	FTSJ1	SLC16A3	0.817084954	7.60E-12
CHOL	IUPHAR	FTSJ1	PORCN	0.838650225	6.44E-13
CHOL	IUPHAR	FTSJ1	ATP13A2	0.859183575	4.28E-14
CHOL	TSG	FTSJ1	DOK1	0.805970255	2.40E-11
READ	Epifactor	FTSJ1	SUV39H1	0.819382083	1.23E-26
READ	IUPHAR	FTSJ1	SUV39H1	0.819382083	1.23E-26

Top

Protein structure

Protein 3D structure
Visit iCn3D.

Top

Protein-Protein Interaction

Protein-protein interaction networks
* Overlap between up-regulated DEGs (log2FC<-1 and adj.P<0.05) and STRING PPI network (center: Translation factor, node: DEGs, edges: weighted by -log2(adj.P))

Overlap between down-regulated DEGs (log2FC>1 and adj.P<0.05) and STRING PPI network (center: Translation factor, node: DEGs, edges: weighted by -log2(adj.P))

* Edge colors based on TCGA cancer types.

* Overlap between DEGs (log2FC>1 and adj.P<0.05) and STRING PPI network per cancer (center: Translation factor, node: DEGs, node color: log2FC, edges: weighted by -log2(adj.P))

Cancer type	Translation factor	Interacting protein coding gene	FC	adj.pval
KIRP	FTSJ1	TRMT5	1.32530216969252	0.000177780166268349
KIRP	FTSJ1	TRMT6	2.38633822741832	0.000306400004774332
LIHC	FTSJ1	THADA	-1.13339097028465	0.000492443176754602
KICH	FTSJ1	WDR12	1.27437010311891	0.000631332397460937
PRAD	FTSJ1	TRMT1	-1.09561440158795	0.000670334620795339
ESCA	FTSJ1	TRMT6	-3.11677766247045	0.0009765625
KICH	FTSJ1	NIP7	1.61593435997618	0.00181567668914795
ESCA	FTSJ1	WDR12	-4.50085604434153	0.001953125
HNSC	FTSJ1	WDR4	1.40430290315404	0.00289519683178696
LIHC	FTSJ1	NIP7	1.00838669083295	0.0029470290722562
STAD	FTSJ1	THADA	-1.57331994372488	0.0038655917160213
ESCA	FTSJ1	TRMT1	-1.05301872345036	0.0048828125
KIRP	FTSJ1	WDR4	-1.07321171369349	0.00608485564589501
CHOL	FTSJ1	WDR4	-4.70215860652879	0.0078125
BLCA	FTSJ1	NSUN2	-2.51121902266229	0.0180816650390625
CHOL	FTSJ1	TRMT11	-1.83882690193514	0.01953125
HNSC	FTSJ1	TRMT1	-2.49406344112889	0.0273726439852453
PRAD	FTSJ1	TRMT11	1.06087533610535	0.0291755363147523
READ	FTSJ1	THADA	-5.31783758832206	0.03125
BRCA	FTSJ1	TRMT5	-1.86961197293306	1.08510546514812e-15
THCA	FTSJ1	THADA	-1.55083308133603	1.17810920709243e-05
STAD	FTSJ1	TRMT1	-1.43099332827803	1.17812305688858e-07
STAD	FTSJ1	TRMT6	-5.42863470282606	1.42958015203476e-07
KICH	FTSJ1	NSUN2	-2.58200515291966	1.50799751281738e-05
KIRP	FTSJ1	TRMT1	-4.30019224127311	1.72760337591171e-07
LUSC	FTSJ1	WDR6	1.89763401280828	1.79996309233889e-05
LIHC	FTSJ1	TRMT1	-4.9843251745464	2.24402029682138e-06
LIHC	FTSJ1	WDR12	-3.16467679630325	2.54824448841554e-08
LUAD	FTSJ1	WDR4	-2.64746986542802	3.31565482735716e-09
LIHC	FTSJ1	TRMT6	-1.33049543742613	3.4520382341717e-07
PRAD	FTSJ1	NSUN2	-2.36603815702603	4.53339406712827e-08
KICH	FTSJ1	TRMT1	-3.45641483703651	4.54187393188476e-05
THCA	FTSJ1	TRMT1	-1.63955402041224	5.23348875771721e-06
KIRP	FTSJ1	NIP7	-4.87841949895948	5.4334755986929e-05
LUAD	FTSJ1	TRMT5	-5.3715861736951	5.47570214265305e-08
LIHC	FTSJ1	WDR4	-3.79209228883491	6.11213149202698e-08
KICH	FTSJ1	THADA	1.91638215821306	6.55651092529297e-06
STAD	FTSJ1	WDR12	-2.46721337744962	6.79492950439454e-06
LUSC	FTSJ1	TRMT1	-2.07250103719564	7.24218086307245e-08

Protein-protein interactors with this translation factor (BIOGRID-3.4.160)

PPI interactors with FTSJ1

DMWD, CUL3, APP, WDR6, TMEM17, DYSF, CDC37, USP43, IBTK, SIRT6, GNL3L, MRM1, ZFP91, RPS19BP1, Cdc37, CHRM3, ORF28, DCAF13, NRAS, KRAS, APEX1, SUN2, WWP2, COL4A3BP, PLEKHA4, M, nsp4, ORF3a, ORF7b, S, HSCB, KIF14, PIK3R1, DNAJC5B, DNAJC5, PRKACA, ARF6, CXADR, LAMP1, LAMTOR1, CX3CL1, HCST, WDR5B, RPL36AL, NRP1, DPP4, TMPRSS11B,

Top

Mutations

Clinically associated variants from ClinVar.

Gene	Chr	Position	RefSeq	VarSeq	RefSeeq	VarType	Pathogenic	Disease	VarInfo
FTSJ1	chrX	48336469	T	A	single_nucleotide_variant	Pathogenic	Inborn_genetic_diseases	SO:0001583\|missense_variant,SO:0001627\|intron_variant	SO:0001583\|missense_variant,SO:0001627\|intron_variant
FTSJ1	chrX	48336491	ATGGC	A	Microsatellite	Pathogenic	not_provided	SO:0001589\|frameshift_variant,SO:0001627\|intron_variant	SO:0001589\|frameshift_variant,SO:0001627\|intron_variant
FTSJ1	chrX	48336565	C	G	single_nucleotide_variant	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
FTSJ1	chrX	48336876	G	C	single_nucleotide_variant	Likely_pathogenic	Inborn_genetic_diseases	SO:0001583\|missense_variant,SO:0001627\|intron_variant	SO:0001583\|missense_variant,SO:0001627\|intron_variant
FTSJ1	chrX	48336902	A	G	single_nucleotide_variant	Uncertain_significance	Inborn_genetic_diseases	SO:0001583\|missense_variant,SO:0001627\|intron_variant	SO:0001583\|missense_variant,SO:0001627\|intron_variant
FTSJ1	chrX	48336905	G	A	single_nucleotide_variant	Benign	not_provided	SO:0001583\|missense_variant,SO:0001627\|intron_variant	SO:0001583\|missense_variant,SO:0001627\|intron_variant
FTSJ1	chrX	48336965	G	A	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
FTSJ1	chrX	48337003	A	G	single_nucleotide_variant	Pathogenic	Mental_retardation_9,_X-linked	SO:0001574\|splice_acceptor_variant,SO:0001627\|intron_variant	SO:0001574\|splice_acceptor_variant,SO:0001627\|intron_variant
FTSJ1	chrX	48337009	C	T	single_nucleotide_variant	Pathogenic	Mental_retardation_9,_X-linked	SO:0001587\|nonsense,SO:0001627\|intron_variant	SO:0001587\|nonsense,SO:0001627\|intron_variant
FTSJ1	chrX	48337018	G	T	single_nucleotide_variant	Uncertain_significance	History_of_neurodevelopmental_disorder	SO:0001583\|missense_variant,SO:0001627\|intron_variant	SO:0001583\|missense_variant,SO:0001627\|intron_variant
FTSJ1	chrX	48337054	C	G	single_nucleotide_variant	Uncertain_significance	not_provided	SO:0001583\|missense_variant,SO:0001627\|intron_variant	SO:0001583\|missense_variant,SO:0001627\|intron_variant
FTSJ1	chrX	48337067	TG	T	Deletion	Pathogenic	Mental_retardation_9,_X-linked	SO:0001589\|frameshift_variant,SO:0001627\|intron_variant	SO:0001589\|frameshift_variant,SO:0001627\|intron_variant
FTSJ1	chrX	48337083	G	T	single_nucleotide_variant	Benign	History_of_neurodevelopmental_disorder\|not_specified\|not_provided	SO:0001819\|synonymous_variant,SO:0001627\|intron_variant	SO:0001819\|synonymous_variant,SO:0001627\|intron_variant
FTSJ1	chrX	48337086	C	T	single_nucleotide_variant	Likely_benign	not_provided	SO:0001819\|synonymous_variant,SO:0001627\|intron_variant	SO:0001819\|synonymous_variant,SO:0001627\|intron_variant
FTSJ1	chrX	48337234	T	C	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
FTSJ1	chrX	48337446	C	T	single_nucleotide_variant	Benign	not_provided	SO:0001819\|synonymous_variant,SO:0001623\|5_prime_UTR_variant	SO:0001819\|synonymous_variant,SO:0001623\|5_prime_UTR_variant
FTSJ1	chrX	48337447	A	T	single_nucleotide_variant	Benign	not_provided	SO:0001583\|missense_variant,SO:0001623\|5_prime_UTR_variant	SO:0001583\|missense_variant,SO:0001623\|5_prime_UTR_variant
FTSJ1	chrX	48337450	C	G	single_nucleotide_variant	Benign/Likely_benign	History_of_neurodevelopmental_disorder\|not_specified\|not_provided	SO:0001583\|missense_variant,SO:0001623\|5_prime_UTR_variant	SO:0001583\|missense_variant,SO:0001623\|5_prime_UTR_variant
FTSJ1	chrX	48337468	C	T	single_nucleotide_variant	Uncertain_significance	not_provided	SO:0001583\|missense_variant,SO:0001623\|5_prime_UTR_variant	SO:0001583\|missense_variant,SO:0001623\|5_prime_UTR_variant
FTSJ1	chrX	48337472	C	T	single_nucleotide_variant	Uncertain_significance	not_provided	SO:0001583\|missense_variant,SO:0001623\|5_prime_UTR_variant	SO:0001583\|missense_variant,SO:0001623\|5_prime_UTR_variant
FTSJ1	chrX	48339287	G	A	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
FTSJ1	chrX	48339537	A	T	single_nucleotide_variant	Pathogenic	Intellectual_disability	SO:0001574\|splice_acceptor_variant,SO:0001627\|intron_variant	SO:0001574\|splice_acceptor_variant,SO:0001627\|intron_variant
FTSJ1	chrX	48339586	C	T	single_nucleotide_variant	Benign	History_of_neurodevelopmental_disorder\|not_provided	SO:0001819\|synonymous_variant,SO:0001627\|intron_variant	SO:0001819\|synonymous_variant,SO:0001627\|intron_variant
FTSJ1	chrX	48339696	A	G	single_nucleotide_variant	Uncertain_significance	not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
FTSJ1	chrX	48339730	G	A	single_nucleotide_variant	Uncertain_significance	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
FTSJ1	chrX	48339780	CCTCACCCGCTGTCTTTGCCT	C	Deletion	Uncertain_significance	Intellectual_disability	SO:0001627\|intron_variant	SO:0001627\|intron_variant
FTSJ1	chrX	48339807	C	T	single_nucleotide_variant	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
FTSJ1	chrX	48339828	G	A	single_nucleotide_variant	Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
FTSJ1	chrX	48339840	C	T	single_nucleotide_variant	Benign	History_of_neurodevelopmental_disorder\|not_specified\|not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
FTSJ1	chrX	48339985	C	T	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
FTSJ1	chrX	48340012	C	T	single_nucleotide_variant	Benign	not_specified	SO:0001627\|intron_variant	SO:0001627\|intron_variant
FTSJ1	chrX	48340028	G	A	single_nucleotide_variant	Likely_benign	History_of_neurodevelopmental_disorder	SO:0001583\|missense_variant	SO:0001583\|missense_variant
FTSJ1	chrX	48340048	C	A	single_nucleotide_variant	Likely_benign	not_specified	SO:0001583\|missense_variant	SO:0001583\|missense_variant
FTSJ1	chrX	48340102	C	T	single_nucleotide_variant	Benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
FTSJ1	chrX	48340785	C	G	single_nucleotide_variant	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
FTSJ1	chrX	48340873	G	A	single_nucleotide_variant	Benign/Likely_benign	History_of_neurodevelopmental_disorder\|not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
FTSJ1	chrX	48340877	C	T	single_nucleotide_variant	Uncertain_significance	Mental_retardation_9,_X-linked	SO:0001583\|missense_variant	SO:0001583\|missense_variant
FTSJ1	chrX	48340987	A	G	single_nucleotide_variant	Conflicting_interpretations_of_pathogenicity	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
FTSJ1	chrX	48340994	G	A	single_nucleotide_variant	Uncertain_significance	not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
FTSJ1	chrX	48341086	C	G	single_nucleotide_variant	Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
FTSJ1	chrX	48341097	G	A	single_nucleotide_variant	Benign	not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
FTSJ1	chrX	48341097	G	GC	Duplication	Likely_pathogenic	not_provided	SO:0001589\|frameshift_variant	SO:0001589\|frameshift_variant
FTSJ1	chrX	48341118	G	A	single_nucleotide_variant	Benign	History_of_neurodevelopmental_disorder\|not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
FTSJ1	chrX	48341166	C	A	single_nucleotide_variant	Uncertain_significance	not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
FTSJ1	chrX	48341414	C	T	single_nucleotide_variant	Likely_benign	Intellectual_disability	SO:0001624\|3_prime_UTR_variant	SO:0001624\|3_prime_UTR_variant

nsSNVs with sample frequency (size of circle) from TCGA 33 cancers.

SNVs and Indels

Gene	Cancer type	Chromosome	Start	End	RefSeeq	MutSeq	Mutation type	AAchange	# samples
FTSJ1	LUAD	chrX	48340805	48340805	C	A	Missense_Mutation	p.Q222K	3
FTSJ1	PAAD	chrX	48339583	48339583	C	T	Missense_Mutation	p.L136F	3
FTSJ1	LUAD	chrX	48336506	48336506	G	T	Missense_Mutation	p.R24L	2
FTSJ1	LUAD	chrX	48339704	48339704	A	-	Frame_Shift_Del	p.K148fs	2
FTSJ1	SKCM	chrX	48336904	48336904	C	T	Silent	p.I63I	2
FTSJ1	UCEC	chrX	48337472	48337472	C	T	Missense_Mutation	p.A110V	2
FTSJ1	UCEC	chrX	48337491	48337491	C	T	Silent	p.D116	2
FTSJ1	UCEC	chrX	48339714	48339714	G	A	Missense_Mutation	p.G151D	2
FTSJ1	UCEC	chrX	48340102	48340102	C	T	Silent	p.Y218	2
FTSJ1	BLCA	chrX	48340027	48340027	C	T	Silent	p.F193F	2
FTSJ1	PAAD	chrX	48339583	48339583	C	T	Missense_Mutation		2
FTSJ1	LGG	chrX	48339829	48339829	G	T	Missense_Mutation	p.D162Y	2
FTSJ1	LUAD	chrX	48341100	48341100	C	A	Missense_Mutation	p.P290H	2
FTSJ1	UCEC	chrX	48340894	48340894	C	T	Silent	p.D253	2
FTSJ1	PAAD	chrX	48340860	48340860	G	T	Missense_Mutation		2
FTSJ1	STAD	chrX	48337473	48337473	G	A	Silent	p.A110A	2
FTSJ1	UCEC	chrX	48341093	48341093	A	G	Missense_Mutation	p.I290V	2
FTSJ1	PAAD	chrX	48340860	48340860	G	T	Missense_Mutation	p.S242I	2
FTSJ1	UCEC	chrX	48341096	48341096	C	T	Missense_Mutation	p.R291C	2
FTSJ1	LGG	chrX	48337056	48337056	A	G	Silent		2
FTSJ1	LGG	chrX	48339829	48339829	G	T	Missense_Mutation		2
FTSJ1	LUAD	chrX	48339578	48339578	A	C	Missense_Mutation	p.Q134P	2
FTSJ1	GBM	chrX	48337070	48337070	T	C	Missense_Mutation	p.V86A	1
FTSJ1	SKCM	chrX	48340019	48340019	G	A	Splice_Site	.	1
FTSJ1	LIHC	chrX	48341400	48341400	A	G	Silent		1
FTSJ1	THYM	chrX	48340028	48340028	G	A	Missense_Mutation	p.A194T	1
FTSJ1	GBM	chrX	48337447	48337447	A	T	Missense_Mutation	p.I102F	1
FTSJ1	LIHC	chrX	48341394	48341394	T	C	Silent	p.S326S	1
FTSJ1	LUAD	chrX	48340805	48340805	C	A	Missense_Mutation	p.Q224K	1
FTSJ1	GBM	chrX	48336460	48336460	C	T	Missense_Mutation		1
FTSJ1	SKCM	chrX	48341135	48341135	C	T	Missense_Mutation	p.P302S	1
FTSJ1	LIHC	chrX	48337080	48337080	G	-	Frame_Shift_Del	p.Q89fs	1
FTSJ1	LUSC	chrX	48340063	48340063	C	T	Silent	p.F205F	1
FTSJ1	GBM	chrX	48341022	48341022	C	A	Missense_Mutation		1
FTSJ1	SKCM	chrX	48340019	48340019	G	A	Splice_Site		1
FTSJ1	LUAD	chrX	48340055	48340055	G	T	Nonsense_Mutation	p.E203*	1
FTSJ1	BLCA	chrX	48340027	48340027	C	T	Silent		1
FTSJ1	OV	chrX	48225817	48225817	G	T	Silent	p.S246	1
FTSJ1	KIRP	chrX	48336439	48336439	G	T	Nonsense_Mutation		1
FTSJ1	SKCM	chrX	48341089	48341089	G	A	Silent	p.K286K	1
FTSJ1	LUAD	chrX	48339589	48339589	G	T	Missense_Mutation	p.A138S	1
FTSJ1	SKCM	chrX	48337027	48337027	G	A	Missense_Mutation	p.V72M	1
FTSJ1	COAD	chrX	48340102	48340102	C	A	Nonsense_Mutation	p.Y218X	1
FTSJ1	LGG	chrX	48337016	48337016	C	T	Missense_Mutation	p.S68F	1
FTSJ1	LUAD	chrX	48339684	48339684	A	T	Missense_Mutation	p.N141I	1
FTSJ1	COAD	chrX	48340877	48340877	C	T	Missense_Mutation	p.R246C	1
FTSJ1	LGG	chrX	48337056	48337056	A	G	Silent	p.P81P	1
FTSJ1	STAD	chrX	48339902	48339902	G	A	Missense_Mutation	p.R186Q	1
FTSJ1	COAD	chrX	48340994	48340994	G	A	Missense_Mutation	p.G255S	1
FTSJ1	STAD	chrX	48340054	48340054	C	T	Silent	p.P202P	1
FTSJ1	LUAD	chrX	48339835	48339835	A	G	Missense_Mutation	p.T164A	1
FTSJ1	ESCA	chrX	48340858	48340858	G	T	Silent	p.L241	1
FTSJ1	PAAD	chrX	48340860	48340860	G	T	Missense_Mutation	p.S240I	1
FTSJ1	THCA	chrX	48340054	48340054	C	A	Silent		1
FTSJ1	ESCA	chrX	48340858	48340858	G	T	Silent		1
FTSJ1	SARC	chrX	48336889	48336889	G	T	Silent		1
FTSJ1	LGG	chrX	48337016	48337016	C	T	Missense_Mutation		1
FTSJ1	THYM	chrX	48340028	48340028	G	A	Missense_Mutation		1

Copy number variation (CNV) of FTSJ1
* Click on the image to open the original image in a new window.

Fusion gene breakpoints (product of the structural variants (SVs)) across FTSJ1
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion genes with this translation factor from FusionGDB2.0.

FusionGDB2 ID	Disease	Sample	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand
80236	N/A	AI557383	FTSJ1	chrX	48339564	-	FTSJ1	chrX	48339807	+
73255	PCPG	TCGA-QR-A6GW-01A	FTSJ1	chrX	48337504	+	QTRT1	chr19	10822837	+
80236	N/A	AI094968	GABRB3	chr15	26831828	-	FTSJ1	chrX	48344693	-
80236	N/A	AI675401	NDUFAF7	chr2	37460764	-	FTSJ1	chrX	48344687	-

Top

Prognostic Analysis

Kaplan-Meier plots with logrank tests of overall survival (OS)

Cancer type

Translation factor

Coefficent

Hazard ratio

Wald test pval

Likelihool ratio pval

Logrank test pval

# samples

Top

Translation factor and Gender

Differential gene expression between female and male. (Wilcoxon test, pval<0.05)

Cancer type	Translation factor	pval	adj.p
KIRP	FTSJ1	0.00809966814198768	0.23
KIRC	FTSJ1	0.0146884238785556	0.4
SARC	FTSJ1	0.0170192651201649	0.44
COAD	FTSJ1	0.0324529229447455	0.81

Top

Translation factor and Age

Differential gene expression between young and old age groups (Wilcoxon test, pval<0.05)

Cancer type	Translation factor	pval	adj.p
LUAD	FTSJ1	0.0477007943971697	1
CESC	FTSJ1	0.0221627799871943	0.7
UCEC	FTSJ1	0.0258114812712554	0.77
THYM	FTSJ1	0.0217930785819886	0.7
SARC	FTSJ1	8.50797765869055e-05	0.0028

Top

Related Drugs

Drugs targeting genes involved in this translation factor.
(DrugBank Version 5.1.8 2021-05-08)

UniProtAcc

DrugBank ID

Drug name

Drug activity

Drug type

Drug status

Top

Related Diseases

Diseases associated with this translation factor.
(DisGeNet 4.0)

Disease ID	Disease Name	# PubMeds	Disease source
C3501611	Mental Retardation, X-Linked Nonsyndromic	7	CLINGEN
C0796215	Mental Retardation, X-Linked 9	1	CTD_human;GENOMICS_ENGLAND
C2931498	Mental Retardation, X-Linked 1	1	ORPHANET