|
||||||
|
Translation Factor: NANOS1 (NCBI Gene ID:340719) |
|
 Gene Summary |
| Gene Information | Gene Name: NANOS1 | Gene ID: 340719 | Gene Symbol | NANOS1 | Gene ID | 340719 |
| Gene Name | nanos C2HC-type zinc finger 1 | |
| Synonyms | EC_Rep1a|NOS-1|NOS1|SPGF12|ZC2HC12A | |
| Cytomap | 10q26.11 | |
| Type of Gene | protein-coding | |
| Description | nanos homolog 1 | |
| Modification date | 20200313 | |
| UniProtAcc | Q8WY41 | |
| Child GO biological process term(s) under GO:0006412 |
| GO ID | GO term |
| GO:0017148 | Negative regulation of translation |
| GO:0006417 | Regulation of translation |
| GO:0006412 | Translation |
| Gene ontology of translaction factor with evidence of Inferred from Direct Assay (IDA) from Entrez |
| Partner | Gene | GO ID | GO term | PubMed ID |
| Hgene | NANOS1 | GO:0010608 | posttranscriptional regulation of gene expression | 25100735 |
| Hgene | NANOS1 | GO:0010631 | epithelial cell migration | 17047063 |
| Hgene | NANOS1 | GO:0016477 | cell migration | 18223680 |
| Hgene | NANOS1 | GO:0017148 | negative regulation of translation | 24736845 |
| Hgene | NANOS1 | GO:1900153 | positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay | 24736845 |
| Inferred gene age of translation factor. |
| Gene | Inferred gene age group among (0 - 67.6], (67.6 - 355.7], (355.7 - 733], (733 - 1119.25], >1119.25 |
| NANOS1 | (733 - 1119.25] |
Top |
|
| We searched PubMed using 'NANOS1[title] AND translation [title] AND human.' |
| Gene | Title | PMID |
| NANOS1 | Maternal Dead-end 1 promotes translation of nanos1 by binding the eIF3 complex | 28870987 |
Top |
|
| Skipped exons in TCGA and GTEx based on Ensembl gene isoform structure. * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. For more annotations, please visit our ExonSkipDB. |
 |
| Open reading frame (ORF) analsis of exon skipping events based on Ensembl gene isoform structure. * Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser. |
| ENST | Exon skip start (DNA) | Exon Skip end (DNA) | ORF |
| Exon skipping position in the amino acid sequence. |
| ENST | Exon skip start (DNA) | Exon Skip end (DNA) | Len(transcript seq) | Exon skip start (mRNA) | Exon Skip end (mRNA) | Len(amino acid seq) | Exon skip start (AA) | Exon Skip end (AA) |
| Potentially (partially) lost protein functional features of UniProt. |
| UniProtAcc | Exon skip start (AA) | Exon Skip end (AA) | Function feature start (AA) | Function feature end (AA) | Functional feature type | Functional feature desc. |
Top |
|
| Gene expression level across TCGA pancancer |
 |
| Gene expression level across GTEx pantissue |
 |
| Expression level of gene isoforms across TCGA pancancer |
 |
| Expression level of gene isoforms across GTEx pantissue |
 |
| Cancer(tissue) type-specific expression level of Translation factor using z-score distriution |
 |
| Differential expression between tumor and matched normal (in the cancer types with more than 10 matched samples) |
 |
| Cancer type | Translation factor | FC | adj.pval |
| LUAD | NANOS1 | -1.26823330280835 | 0.00598625106474388 |
| BRCA | NANOS1 | -1.41685984384344 | 2.51697598290495e-14 |
Top |
|
| Translation factor expression regulation through miRNA binding |
| Cancer type | Gene | miRNA | TargetScan binding score (Context++ score percentile) | Coefficient | Pvalue |
| Translation factor expression regulation through methylation in the promoter of Translation factor |
 |
| Cancer type | Gene | methyl group b | methyl group a | DEG pval | avg methyl in b | avg methyl in a | avg exp in b | avg exp in a |
| Translation factor expression regulation through methylation in the gene body of Translation factor (positive regulation) |
 |
| Cancer type | Gene | methyl group b | methyl group a | DEG pval | avg methyl in b | avg methyl in a | avg exp in b | avg exp in a |
| BRCA | NANOS1 | 2 | 3 | 0.0428537305604756 | 0.51510332008245 | 0.639782267441861 | 0.0141791605527407 | -0.152257409831451 |
| Translation factor expression regulation through copy number variation of Translation factor |
 |
| Cancer type | Gene | Coefficient | Pvalue |
| CHOL | NANOS1 | -0.040811405 | 0.010848358 |
| BLCA | NANOS1 | 0.044479152 | 0.021230422 |
| COAD | NANOS1 | 0.010124391 | 0.039252403 |
Top |
|
| Strongly correlated genes belong to cellular important gene groups with NANOS1 (coefficient>0.8, pval<0.05, node color based on FC between tumor and matched normal). Significantly associated important genes in the individual cancer types. * Cell metabolism gene: cell metabolism genes from REACTOME (black edge), IUPHAR: drug target genes from IUPHAR (blue edge), Kinase: human kinase genes (brown edge), CGC: cancer gene census genes (orange edge), TSG: tumor suppresor genes (purple edge), Epifactor: epigenetic factors (light blue edge), TF: transcription factors (green) |
| Cancer type | Gene group | Translation factor | Correlated gene | Coefficient | Pvalue |
Top |
|
| Protein 3D structure Visit iCn3D. |
Top |
|
| Protein-protein interaction networks * Overlap between up-regulated DEGs (log2FC<-1 and adj.P<0.05) and STRING PPI network (center: Translation factor, node: DEGs, edges: weighted by -log2(adj.P)) |
| Overlap between down-regulated DEGs (log2FC>1 and adj.P<0.05) and STRING PPI network (center: Translation factor, node: DEGs, edges: weighted by -log2(adj.P)) |
 * Edge colors based on TCGA cancer types. |
| * Overlap between DEGs (log2FC>1 and adj.P<0.05) and STRING PPI network per cancer (center: Translation factor, node: DEGs, node color: log2FC, edges: weighted by -log2(adj.P)) |
| Cancer type | Translation factor | Interacting protein coding gene | FC | adj.pval |
| Protein-protein interactors with this translation factor (BIOGRID-3.4.160) |
| PPI interactors with NANOS1 |
| PUM2, CNOT1, CNOT3, AGO2, C17orf70, PAK1, CNOT10, CNOT7, TNKS1BP1, CNOT6, CNOT11, KLHDC8B, CNOT8, PHYH, CNOT2, FHL2, CNOT6L, |
Top |
|
| Clinically associated variants from ClinVar. |
| Gene | Chr | Position | RefSeq | VarSeq | RefSeeq | VarType | Pathogenic | Disease | VarInfo |
| NANOS1 | chr10 | 120789263 | G | C | single_nucleotide_variant | Benign | not_provided | SO:0001623|5_prime_UTR_variant | SO:0001623|5_prime_UTR_variant |
| NANOS1 | chr10 | 120789413 | C | A | single_nucleotide_variant | Benign | not_provided | SO:0001583|missense_variant | SO:0001583|missense_variant |
| NANOS1 | chr10 | 120789542 | CCCT | C | Microsatellite | Conflicting_interpretations_of_pathogenicity | Spermatogenic_failure_12 | SO:0001822|inframe_deletion | SO:0001822|inframe_deletion |
| NANOS1 | chr10 | 120789548 | T | A | single_nucleotide_variant | Benign | not_provided | SO:0001583|missense_variant | SO:0001583|missense_variant |
| NANOS1 | chr10 | 120789795 | TGCTGCTGGGCTGCGCGCCCGCCGCCGCCGC | T | Deletion | Uncertain_significance | not_provided | SO:0001822|inframe_deletion | SO:0001822|inframe_deletion |
| NANOS1 | chr10 | 120789812 | C | CCCGCCG | Microsatellite | Benign | not_provided | SO:0001821|inframe_insertion | SO:0001821|inframe_insertion |
| NANOS1 | chr10 | 120789812 | CCCG | C | Microsatellite | Pathogenic | Spermatogenic_failure_12 | SO:0001822|inframe_deletion | SO:0001822|inframe_deletion |
| NANOS1 | chr10 | 120790050 | G | A | single_nucleotide_variant | SO:0001583|missense_variant | SO:0001583|missense_variant | ||
| NANOS1 | chr10 | 120790060 | T | C | single_nucleotide_variant | Benign | not_provided | SO:0001819|synonymous_variant | SO:0001819|synonymous_variant |
| NANOS1 | chr10 | 120790139 | CG | TA | Indel | SO:0001583|missense_variant | SO:0001583|missense_variant | ||
| NANOS1 | chr10 | 120790159 | C | T | single_nucleotide_variant | Likely_benign | not_provided | SO:0001819|synonymous_variant | SO:0001819|synonymous_variant |
| nsSNVs with sample frequency (size of circle) from TCGA 33 cancers. |
 |
| SNVs and Indels |
| Gene | Cancer type | Chromosome | Start | End | RefSeeq | MutSeq | Mutation type | AAchange | # samples |
| NANOS1 | LGG | chr10 | 120789635 | 120789637 | GAC | - | In_Frame_Del | p.D112del | 2 |
| NANOS1 | LUAD | chr10 | 120790054 | 120790054 | C | A | Nonsense_Mutation | p.Y247* | 2 |
| NANOS1 | GBM | chr10 | 120790044 | 120790044 | T | A | Missense_Mutation | p.L244Q | 1 |
| NANOS1 | KIRP | chr10 | 120789990 | 120789990 | T | A | Missense_Mutation | p.L226H | 1 |
| NANOS1 | LGG | chr10 | 120790031 | 120790031 | C | T | Silent | p.L240L | 1 |
| NANOS1 | MESO | chr10 | 120789830 | 120789830 | G | A | Missense_Mutation | 1 | |
| NANOS1 | MESO | chr10 | 120789516 | 120789516 | G | A | Missense_Mutation | 1 | |
| NANOS1 | SKCM | chr10 | 120789672 | 120789672 | G | A | Missense_Mutation | p.G120D | 1 |
| Copy number variation (CNV) of NANOS1 * Click on the image to open the original image in a new window. |
 |
| Fusion gene breakpoints (product of the structural variants (SVs)) across NANOS1 * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
 |
| Fusion genes with this translation factor from FusionGDB2.0. |
| FusionGDB2 ID | Disease | Sample | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand |
| 57168 | N/A | AV681647 | NANOS1 | chr10 | 120791016 | + | GPR35 | chr2 | 241556152 | + |
Top |
|
| Kaplan-Meier plots with logrank tests of overall survival (OS) |
 |
| Cancer type | Translation factor | Coefficent | Hazard ratio | Wald test pval | Likelihool ratio pval | Logrank test pval | # samples |
Top |
|
| Differential gene expression between female and male. (Wilcoxon test, pval<0.05) |
 |
| Cancer type | Translation factor | pval | adj.p |
| TGCT | NANOS1 | 0.00207212515281303 | 0.058 |
| LGG | NANOS1 | 0.00351015100431277 | 0.095 |
| THCA | NANOS1 | 0.00412490092001732 | 0.11 |
| THYM | NANOS1 | 0.0149526990442852 | 0.37 |
Top |
|
| Differential gene expression between young and old age groups (Wilcoxon test, pval<0.05) |
| Cancer type | Translation factor | pval | adj.p |
| TGCT | NANOS1 | 0.00623512641317821 | 0.19 |
| LIHC | NANOS1 | 0.00135771732449023 | 0.043 |
| LGG | NANOS1 | 0.00111876454951257 | 0.037 |
| OV | NANOS1 | 0.00150224084771522 | 0.047 |
Top |
|
| Drugs targeting genes involved in this translation factor. (DrugBank Version 5.1.8 2021-05-08) |
| UniProtAcc | DrugBank ID | Drug name | Drug activity | Drug type | Drug status |
Top |
|
| Diseases associated with this translation factor. (DisGeNet 4.0) |
| Disease ID | Disease Name | # PubMeds | Disease source |
| C0345967 | Malignant mesothelioma | 1 | CTD_human |
| C4706677 | Male infertility with teratozoospermia due to single gene mutation | 1 | ORPHANET |
Copyright 2021-Present -The University of Texas Health Science Center at Houston (UTHealth)
Web File Viewing | Emergency Information |Campus Carry|Site Policies