Home

Download

Statistics

Examples

Help

Contact

	Gene Summary
	Translation studies in PubMed
	Exon Skipping Events
	Expression
	Expression Regulation
	Associated Genes
	Protein 3D Structure
	Protein-Protein Interaction
	Mutations
	Prognostic Analysis
	Gender Association
	Age Association
	Related Drugs
	Related Diseases

Translation Factor: SEPSECS (NCBI Gene ID:51091)

Gene Summary

Gene Summary

Gene Information	Gene Name: SEPSECS
	Gene ID: 51091
	Gene Symbol	SEPSECS
	Gene ID	51091
	Gene Name	Sep (O-phosphoserine) tRNA:Sec (selenocysteine) tRNA synthase
	Synonyms	LP\|PCH2D\|SLA\|SLA/LP
	Cytomap	4p15.2
	Type of Gene	protein-coding
	Description	O-phosphoseryl-tRNA(Sec) selenium transferaseSLA-p35SLA/LP autoantigenUGA suppressor tRNA-associated proteinliver-pancreas antigensoluble liver antigensoluble liver antigen/liver pancreas antigentRNA(Ser/Sec)-associated antigenic protein
	Modification date	20200313
	UniProtAcc	Q9HD40

Child GO biological process term(s) under GO:0006412

GO ID	GO term
GO:0006417	Regulation of translation
GO:0006414	Translational elongation
GO:0006412	Translation

Gene ontology of translaction factor with evidence of Inferred from Direct Assay (IDA) from Entrez

Partner

Gene

GO ID

GO term

PubMed ID

Inferred gene age of translation factor.

Gene	Inferred gene age group among (0 - 67.6], (67.6 - 355.7], (355.7 - 733], (733 - 1119.25], >1119.25
SEPSECS	(733 - 1119.25]

Top

Translation Studies in PubMed

We searched PubMed using 'SEPSECS[title] AND translation [title] AND human.'

Gene	Title	PMID
SEPSECS	.	.

Top

Exon Skipping Events

Skipped exons in TCGA and GTEx based on Ensembl gene isoform structure.
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.
For more annotations, please visit our ExonSkipDB.

Open reading frame (ORF) analsis of exon skipping events based on Ensembl gene isoform structure.
* Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser.

ENST	Exon skip start (DNA)	Exon Skip end (DNA)	ORF
ENST00000382103	25128885	25128979	Frame-shift
ENST00000382103	25146625	25146755	Frame-shift
ENST00000382103	25153581	25153684	Frame-shift
ENST00000382103	25160574	25160729	Frame-shift

Exon skipping position in the amino acid sequence.

ENST

Exon skip start (DNA)

Exon Skip end (DNA)

Len(transcript seq)

Exon skip start (mRNA)

Exon Skip end (mRNA)

Len(amino acid seq)

Exon skip start (AA)

Exon Skip end (AA)

Potentially (partially) lost protein functional features of UniProt.

UniProtAcc

Exon skip start (AA)

Exon Skip end (AA)

Function feature start (AA)

Function feature end (AA)

Functional feature type

Functional feature desc.

Top

Expression

Gene expression level across TCGA pancancer

Gene expression level across GTEx pantissue

Expression level of gene isoforms across TCGA pancancer

Expression level of gene isoforms across GTEx pantissue

Cancer(tissue) type-specific expression level of Translation factor using z-score distriution

Differential expression between tumor and matched normal (in the cancer types with more than 10 matched samples)

Cancer type	Translation factor	FC	adj.pval
BRCA	SEPSECS	-1.49569251700223	0.000941794422102645
CHOL	SEPSECS	-1.79794121924099	0.00390625
COAD	SEPSECS	-1.79606545257874	0.023610919713974

Top

Expression Regulation

Translation factor expression regulation through miRNA binding

Cancer type	Gene	miRNA	TargetScan binding score (Context++ score percentile)	Coefficient	Pvalue
KIRP	SEPSECS	hsa-miR-338-3p	93	-0.330233690360273	0.00309154756884204

Translation factor expression regulation through methylation in the promoter of Translation factor

Cancer type

Gene

methyl group b

methyl group a

DEG pval

avg methyl in b

avg methyl in a

avg exp in b

avg exp in a

Translation factor expression regulation through methylation in the gene body of Translation factor (positive regulation)

Cancer type	Gene	methyl group b	methyl group a	DEG pval	avg methyl in b	avg methyl in a	avg exp in b	avg exp in a
MESO	SEPSECS	2	3	0.0128249262660677	0.554743623188406	0.618435555555556	-0.119429105610957	0.1325568847272
OV	SEPSECS	2	1	0.00931761674637045	0.371020406504065	0.174445	0.24535112591911	0.0688604689560268

Translation factor expression regulation through copy number variation of Translation factor

Cancer type	Gene	Coefficient	Pvalue
TGCT	SEPSECS	-0.10056969	0.037228302
KIRC	SEPSECS	0.046383134	0.049323661

Top

Associated Genes

Strongly correlated genes belong to cellular important gene groups with SEPSECS (coefficient>0.8, pval<0.05, node color based on FC between tumor and matched normal). Significantly associated important genes in the individual cancer types. * Cell metabolism gene: cell metabolism genes from REACTOME (black edge), IUPHAR: drug target genes from IUPHAR (blue edge), Kinase: human kinase genes (brown edge), CGC: cancer gene census genes (orange edge), TSG: tumor suppresor genes (purple edge), Epifactor: epigenetic factors (light blue edge), TF: transcription factors (green)

Cancer type	Gene group	Translation factor	Correlated gene	Coefficient	Pvalue
CHOL	Cell metabolism gene	SEPSECS	CSAD	0.809684577	1.65E-11
CHOL	IUPHAR	SEPSECS	SLC26A1	0.802876616	3.26E-11
SKCM	TF	SEPSECS	ELF2	0.800252422	6.81E-107
THCA	TF	SEPSECS	ZNF518A	0.801988639	1.16E-129
THYM	CGC	SEPSECS	ARID2	0.814139555	4.17E-30
THYM	Epifactor	SEPSECS	MBTD1	0.810492707	1.19E-29
THYM	Epifactor	SEPSECS	ARID2	0.814139555	4.17E-30
THYM	TF	SEPSECS	ARID2	0.814139555	4.17E-30
THYM	TSG	SEPSECS	ARID2	0.814139555	4.17E-30
UCS	CGC	SEPSECS	ARID2	0.814139555	4.17E-30
UCS	Epifactor	SEPSECS	MBTD1	0.810492707	1.19E-29
UCS	Epifactor	SEPSECS	ARID2	0.814139555	4.17E-30
UCS	TF	SEPSECS	ARID2	0.814139555	4.17E-30
UCS	TSG	SEPSECS	ARID2	0.814139555	4.17E-30
UVM	Cell metabolism gene	SEPSECS	IDI1	0.800665617	4.94E-19
UVM	Cell metabolism gene	SEPSECS	AGL	0.801234878	4.47E-19
UVM	Cell metabolism gene	SEPSECS	NUPL2	0.802171742	3.79E-19
UVM	Cell metabolism gene	SEPSECS	ACADSB	0.806808186	1.65E-19
UVM	Cell metabolism gene	SEPSECS	NAMPT	0.807441688	1.47E-19
UVM	Cell metabolism gene	SEPSECS	GPAM	0.808541832	1.20E-19
UVM	Cell metabolism gene	SEPSECS	PPP1CB	0.808666359	1.18E-19
UVM	Cell metabolism gene	SEPSECS	SMG1	0.810086842	9.06E-20
UVM	Cell metabolism gene	SEPSECS	ARFGEF2	0.810220874	8.84E-20
UVM	Cell metabolism gene	SEPSECS	DBT	0.810621632	8.20E-20
UVM	Cell metabolism gene	SEPSECS	RANBP2	0.811762317	6.63E-20
UVM	Cell metabolism gene	SEPSECS	MED17	0.812411971	5.87E-20
UVM	Cell metabolism gene	SEPSECS	GXYLT1	0.812518926	5.76E-20
UVM	Cell metabolism gene	SEPSECS	FBXL5	0.813871146	4.46E-20
UVM	Cell metabolism gene	SEPSECS	TNPO1	0.814221341	4.18E-20
UVM	Cell metabolism gene	SEPSECS	ALG13	0.814283039	4.13E-20
UVM	Cell metabolism gene	SEPSECS	SACM1L	0.815367065	3.36E-20
UVM	Cell metabolism gene	SEPSECS	PLA2G12A	0.816479478	2.71E-20
UVM	Cell metabolism gene	SEPSECS	ACSL4	0.81657474	2.66E-20
UVM	Cell metabolism gene	SEPSECS	NUPL1	0.816861563	2.52E-20
UVM	Cell metabolism gene	SEPSECS	EDEM3	0.816966562	2.47E-20
UVM	Cell metabolism gene	SEPSECS	AGPS	0.818301395	1.91E-20
UVM	Cell metabolism gene	SEPSECS	MINPP1	0.822349995	8.60E-21
UVM	Cell metabolism gene	SEPSECS	COL4A3BP	0.823151528	7.33E-21
UVM	Cell metabolism gene	SEPSECS	CSGALNACT2	0.823403334	6.97E-21
UVM	Cell metabolism gene	SEPSECS	FPGT	0.823487341	6.85E-21
UVM	Cell metabolism gene	SEPSECS	NUP50	0.826157168	3.99E-21
UVM	Cell metabolism gene	SEPSECS	DCK	0.826398653	3.80E-21
UVM	Cell metabolism gene	SEPSECS	PSMC6	0.826461141	3.75E-21
UVM	Cell metabolism gene	SEPSECS	MANEA	0.826736395	3.54E-21
UVM	Cell metabolism gene	SEPSECS	LYPLA1	0.826840822	3.47E-21
UVM	Cell metabolism gene	SEPSECS	FBXL3	0.830788092	1.53E-21
UVM	Cell metabolism gene	SEPSECS	MTMR6	0.834121301	7.52E-22
UVM	Cell metabolism gene	SEPSECS	PDHX	0.834166698	7.45E-22
UVM	Cell metabolism gene	SEPSECS	GLS	0.837763643	3.41E-22
UVM	Cell metabolism gene	SEPSECS	GNPDA2	0.839552674	2.29E-22
UVM	Cell metabolism gene	SEPSECS	PNPLA8	0.840949431	1.68E-22
UVM	Cell metabolism gene	SEPSECS	RPE	0.8437876	8.78E-23
UVM	Cell metabolism gene	SEPSECS	PI4K2B	0.844756414	7.03E-23
UVM	Cell metabolism gene	SEPSECS	ALG10B	0.853465158	8.80E-24
UVM	Cell metabolism gene	SEPSECS	UGGT2	0.854260405	7.23E-24
UVM	Cell metabolism gene	SEPSECS	XPO1	0.863088963	7.53E-25
UVM	Cell metabolism gene	SEPSECS	PRKAA1	0.876685015	1.67E-26
UVM	Cell metabolism gene	SEPSECS	FAR1	0.887980702	4.91E-28
UVM	Cell metabolism gene	SEPSECS	ETNK1	0.906925765	5.17E-31
UVM	CGC	SEPSECS	ATRX	0.801513699	4.26E-19
UVM	CGC	SEPSECS	USP8	0.801758687	4.08E-19
UVM	CGC	SEPSECS	TRIM33	0.802067454	3.86E-19
UVM	CGC	SEPSECS	N4BP2	0.803024395	3.26E-19
UVM	CGC	SEPSECS	ARHGAP5	0.804293864	2.60E-19
UVM	CGC	SEPSECS	DICER1	0.806314781	1.81E-19
UVM	CGC	SEPSECS	TET2	0.807178465	1.54E-19
UVM	CGC	SEPSECS	BIRC6	0.80963331	9.85E-20
UVM	CGC	SEPSECS	JAK2	0.811427849	7.06E-20
UVM	CGC	SEPSECS	RANBP2	0.811762317	6.63E-20
UVM	CGC	SEPSECS	PTPN11	0.813161969	5.10E-20
UVM	CGC	SEPSECS	KRAS	0.816729244	2.59E-20
UVM	CGC	SEPSECS	STAG2	0.818864269	1.71E-20
UVM	CGC	SEPSECS	BAZ1A	0.820585813	1.22E-20
UVM	CGC	SEPSECS	DDX5	0.823222751	7.22E-21
UVM	CGC	SEPSECS	SS18L1	0.824858556	5.20E-21
UVM	CGC	SEPSECS	MLLT10	0.828133437	2.66E-21
UVM	CGC	SEPSECS	BMPR1A	0.832623634	1.04E-21
UVM	CGC	SEPSECS	ABI1	0.833230248	9.11E-22
UVM	CGC	SEPSECS	CDC73	0.833945358	7.81E-22
UVM	CGC	SEPSECS	PWWP2A	0.834769625	6.54E-22
UVM	CGC	SEPSECS	FBXO11	0.839174139	2.49E-22
UVM	CGC	SEPSECS	RAD17	0.839192696	2.48E-22
UVM	CGC	SEPSECS	ZMYM2	0.841821135	1.38E-22
UVM	CGC	SEPSECS	ATM	0.849320799	2.40E-23
UVM	CGC	SEPSECS	CREB1	0.856724678	3.90E-24
UVM	CGC	SEPSECS	XPO1	0.863088963	7.53E-25
UVM	CGC	SEPSECS	PMS1	0.866797411	2.78E-25
UVM	CGC	SEPSECS	SF3B1	0.867356025	2.38E-25
UVM	CGC	SEPSECS	ITGAV	0.870092658	1.12E-25
UVM	CGC	SEPSECS	KIF5B	0.872249804	6.06E-26
UVM	CGC	SEPSECS	KTN1	0.872849164	5.10E-26
UVM	CGC	SEPSECS	SUZ12	0.883190335	2.29E-27
UVM	CGC	SEPSECS	ETNK1	0.906925765	5.17E-31
UVM	Epifactor	SEPSECS	ARID4B	0.80100113	4.66E-19
UVM	Epifactor	SEPSECS	ATRX	0.801513699	4.26E-19
UVM	Epifactor	SEPSECS	TRIM33	0.802067454	3.86E-19
UVM	Epifactor	SEPSECS	NIPBL	0.80264593	3.48E-19
UVM	Epifactor	SEPSECS	TET2	0.807178465	1.54E-19
UVM	Epifactor	SEPSECS	BRWD3	0.807202581	1.54E-19
UVM	Epifactor	SEPSECS	JAK2	0.811427849	7.06E-20
UVM	Epifactor	SEPSECS	SP100	0.812643921	5.62E-20
UVM	Epifactor	SEPSECS	RMI1	0.813570888	4.72E-20
UVM	Epifactor	SEPSECS	CHUK	0.814443256	4.00E-20
UVM	Epifactor	SEPSECS	MBTD1	0.815241913	3.44E-20
UVM	Epifactor	SEPSECS	YEATS4	0.816941488	2.48E-20
UVM	Epifactor	SEPSECS	CDK17	0.818327665	1.90E-20
UVM	Epifactor	SEPSECS	CUL2	0.820049003	1.36E-20
UVM	Epifactor	SEPSECS	HCFC2	0.820212302	1.31E-20
UVM	Epifactor	SEPSECS	BAZ1A	0.820585813	1.22E-20
UVM	Epifactor	SEPSECS	TLK1	0.820888081	1.15E-20
UVM	Epifactor	SEPSECS	MYSM1	0.823354136	7.04E-21
UVM	Epifactor	SEPSECS	INO80D	0.824548165	5.53E-21
UVM	Epifactor	SEPSECS	SS18L1	0.824858556	5.20E-21
UVM	Epifactor	SEPSECS	SMARCAD1	0.825233347	4.82E-21
UVM	Epifactor	SEPSECS	CHD9	0.82530037	4.75E-21
UVM	Epifactor	SEPSECS	ARID4A	0.82543288	4.63E-21
UVM	Epifactor	SEPSECS	MLLT10	0.828133437	2.66E-21
UVM	Epifactor	SEPSECS	UCHL5	0.830342445	1.68E-21
UVM	Epifactor	SEPSECS	BAZ2B	0.831036545	1.45E-21
UVM	Epifactor	SEPSECS	CDC73	0.833945358	7.81E-22
UVM	Epifactor	SEPSECS	SMEK1	0.834289501	7.26E-22
UVM	Epifactor	SEPSECS	UHRF2	0.83625204	4.74E-22
UVM	Epifactor	SEPSECS	RLIM	0.841718718	1.41E-22
UVM	Epifactor	SEPSECS	ZMYM2	0.841821135	1.38E-22
UVM	Epifactor	SEPSECS	TDG	0.844128569	8.12E-23
UVM	Epifactor	SEPSECS	JMJD1C	0.848936101	2.63E-23
UVM	Epifactor	SEPSECS	ATM	0.849320799	2.40E-23
UVM	Epifactor	SEPSECS	PCGF6	0.849320821	2.40E-23
UVM	Epifactor	SEPSECS	HMGB1	0.849495606	2.31E-23
UVM	Epifactor	SEPSECS	OGT	0.850726538	1.72E-23
UVM	Epifactor	SEPSECS	EPC2	0.852548171	1.10E-23
UVM	Epifactor	SEPSECS	EID1	0.856504642	4.13E-24
UVM	Epifactor	SEPSECS	BRWD1	0.860410828	1.52E-24
UVM	Epifactor	SEPSECS	SF3B1	0.867356025	2.38E-25
UVM	Epifactor	SEPSECS	ATAD2B	0.875098953	2.66E-26
UVM	Epifactor	SEPSECS	PRKAA1	0.876685015	1.67E-26
UVM	Epifactor	SEPSECS	CUL5	0.878970076	8.41E-27
UVM	Epifactor	SEPSECS	SUZ12	0.883190335	2.29E-27
UVM	Epifactor	SEPSECS	SMEK2	0.886951641	6.87E-28
UVM	Epifactor	SEPSECS	USP15	0.912066019	6.22E-32
UVM	IUPHAR	SEPSECS	IDI1	0.800665617	4.94E-19
UVM	IUPHAR	SEPSECS	TRIM33	0.802067454	3.86E-19
UVM	IUPHAR	SEPSECS	USP14	0.802335164	3.68E-19
UVM	IUPHAR	SEPSECS	NEK1	0.804102136	2.69E-19
UVM	IUPHAR	SEPSECS	CSNK1A1	0.804233585	2.63E-19
UVM	IUPHAR	SEPSECS	TRPC1	0.805265185	2.18E-19
UVM	IUPHAR	SEPSECS	SLC25A46	0.805803779	1.98E-19
UVM	IUPHAR	SEPSECS	BRWD3	0.807202581	1.54E-19
UVM	IUPHAR	SEPSECS	PRPF4B	0.80868633	1.17E-19
UVM	IUPHAR	SEPSECS	BIRC6	0.80963331	9.85E-20
UVM	IUPHAR	SEPSECS	SMG1	0.810086842	9.06E-20
UVM	IUPHAR	SEPSECS	JAK2	0.811427849	7.06E-20
UVM	IUPHAR	SEPSECS	VRK2	0.81145134	7.03E-20
UVM	IUPHAR	SEPSECS	BMPR2	0.812409636	5.88E-20
UVM	IUPHAR	SEPSECS	SLK	0.812507546	5.77E-20
UVM	IUPHAR	SEPSECS	SP100	0.812643921	5.62E-20
UVM	IUPHAR	SEPSECS	CHUK	0.814443256	4.00E-20
UVM	IUPHAR	SEPSECS	CYP2R1	0.814624939	3.87E-20
UVM	IUPHAR	SEPSECS	PLA2G12A	0.816479478	2.71E-20
UVM	IUPHAR	SEPSECS	KRAS	0.816729244	2.59E-20
UVM	IUPHAR	SEPSECS	NR2C1	0.817882712	2.07E-20
UVM	IUPHAR	SEPSECS	NEK7	0.818001494	2.02E-20
UVM	IUPHAR	SEPSECS	CDK17	0.818327665	1.90E-20
UVM	IUPHAR	SEPSECS	BAZ1A	0.820585813	1.22E-20
UVM	IUPHAR	SEPSECS	TLK1	0.820888081	1.15E-20
UVM	IUPHAR	SEPSECS	ATP11C	0.82096355	1.13E-20
UVM	IUPHAR	SEPSECS	SLC4A7	0.822974548	7.59E-21
UVM	IUPHAR	SEPSECS	IRAK4	0.823596428	6.70E-21
UVM	IUPHAR	SEPSECS	BAZ2B	0.831036545	1.45E-21
UVM	IUPHAR	SEPSECS	BMPR1A	0.832623634	1.04E-21
UVM	IUPHAR	SEPSECS	ATP6V0A2	0.834300711	7.24E-22
UVM	IUPHAR	SEPSECS	RIOK3	0.836466717	4.53E-22
UVM	IUPHAR	SEPSECS	MAPK6	0.836591899	4.40E-22
UVM	IUPHAR	SEPSECS	GLS	0.837763643	3.41E-22
UVM	IUPHAR	SEPSECS	CLK1	0.838226001	3.08E-22
UVM	IUPHAR	SEPSECS	FBXO11	0.839174139	2.49E-22
UVM	IUPHAR	SEPSECS	BIRC2	0.843312892	9.79E-23
UVM	IUPHAR	SEPSECS	PI4K2B	0.844756414	7.03E-23
UVM	IUPHAR	SEPSECS	TBK1	0.844833349	6.90E-23
UVM	IUPHAR	SEPSECS	CLK4	0.847094212	4.07E-23
UVM	IUPHAR	SEPSECS	JMJD1C	0.848936101	2.63E-23
UVM	IUPHAR	SEPSECS	ATM	0.849320799	2.40E-23
UVM	IUPHAR	SEPSECS	XIAP	0.851324297	1.48E-23
UVM	IUPHAR	SEPSECS	TNKS2	0.855556752	5.24E-24
UVM	IUPHAR	SEPSECS	CSNK1G3	0.855990042	4.70E-24
UVM	IUPHAR	SEPSECS	TRPM7	0.856796514	3.83E-24
UVM	IUPHAR	SEPSECS	PKN2	0.859552574	1.90E-24
UVM	IUPHAR	SEPSECS	BRWD1	0.860410828	1.52E-24
UVM	IUPHAR	SEPSECS	XPO1	0.863088963	7.53E-25
UVM	IUPHAR	SEPSECS	ITGAV	0.870092658	1.12E-25
UVM	IUPHAR	SEPSECS	MAP3K2	0.872965268	4.94E-26
UVM	IUPHAR	SEPSECS	MAP4K3	0.873119294	4.72E-26
UVM	IUPHAR	SEPSECS	ATAD2B	0.875098953	2.66E-26
UVM	IUPHAR	SEPSECS	PRKAA1	0.876685015	1.67E-26
UVM	Kinase	SEPSECS	TRIM33	0.802067454	3.86E-19
UVM	Kinase	SEPSECS	NEK1	0.804102136	2.69E-19
UVM	Kinase	SEPSECS	CSNK1A1	0.804233585	2.63E-19
UVM	Kinase	SEPSECS	PAN3	0.806392104	1.78E-19
UVM	Kinase	SEPSECS	PRPF4B	0.80868633	1.17E-19
UVM	Kinase	SEPSECS	SMG1	0.810086842	9.06E-20
UVM	Kinase	SEPSECS	JAK2	0.811427849	7.06E-20
UVM	Kinase	SEPSECS	VRK2	0.81145134	7.03E-20
UVM	Kinase	SEPSECS	BMPR2	0.812409636	5.88E-20
UVM	Kinase	SEPSECS	SLK	0.812507546	5.77E-20
UVM	Kinase	SEPSECS	CHUK	0.814443256	4.00E-20
UVM	Kinase	SEPSECS	NEK7	0.818001494	2.02E-20
UVM	Kinase	SEPSECS	CDK17	0.818327665	1.90E-20
UVM	Kinase	SEPSECS	BAZ1A	0.820585813	1.22E-20
UVM	Kinase	SEPSECS	TLK1	0.820888081	1.15E-20
UVM	Kinase	SEPSECS	COL4A3BP	0.823151528	7.33E-21
UVM	Kinase	SEPSECS	IRAK4	0.823596428	6.70E-21
UVM	Kinase	SEPSECS	BMPR1A	0.832623634	1.04E-21
UVM	Kinase	SEPSECS	RIOK3	0.836466717	4.53E-22
UVM	Kinase	SEPSECS	MAPK6	0.836591899	4.40E-22
UVM	Kinase	SEPSECS	CLK1	0.838226001	3.08E-22
UVM	Kinase	SEPSECS	TBK1	0.844833349	6.90E-23
UVM	Kinase	SEPSECS	CLK4	0.847094212	4.07E-23
UVM	Kinase	SEPSECS	ATM	0.849320799	2.40E-23
UVM	Kinase	SEPSECS	CSNK1G3	0.855990042	4.70E-24
UVM	Kinase	SEPSECS	TRPM7	0.856796514	3.83E-24
UVM	Kinase	SEPSECS	PKN2	0.859552574	1.90E-24
UVM	Kinase	SEPSECS	MAP3K2	0.872965268	4.94E-26
UVM	Kinase	SEPSECS	MAP4K3	0.873119294	4.72E-26
UVM	Kinase	SEPSECS	PRKAA1	0.876685015	1.67E-26
UVM	TF	SEPSECS	ZNF148	0.800629458	4.97E-19
UVM	TF	SEPSECS	ZNF606	0.801256882	4.45E-19
UVM	TF	SEPSECS	ZFX	0.801315599	4.41E-19
UVM	TF	SEPSECS	ZNF770	0.801648875	4.16E-19
UVM	TF	SEPSECS	ZNF440	0.801694101	4.12E-19
UVM	TF	SEPSECS	ZBTB41	0.802345871	3.67E-19
UVM	TF	SEPSECS	ZNF761	0.803618238	2.93E-19
UVM	TF	SEPSECS	ZNF546	0.803764285	2.86E-19
UVM	TF	SEPSECS	ZNF224	0.805244028	2.19E-19
UVM	TF	SEPSECS	ZNF12	0.805398942	2.13E-19
UVM	TF	SEPSECS	ZBTB44	0.806266749	1.82E-19
UVM	TF	SEPSECS	ZNF33A	0.806371049	1.79E-19
UVM	TF	SEPSECS	ZNF101	0.806385953	1.78E-19
UVM	TF	SEPSECS	ZNF658	0.806451123	1.76E-19
UVM	TF	SEPSECS	ZNF44	0.806749932	1.67E-19
UVM	TF	SEPSECS	ZNF432	0.807136583	1.56E-19
UVM	TF	SEPSECS	TET2	0.807178465	1.54E-19
UVM	TF	SEPSECS	ZNF443	0.807296169	1.51E-19
UVM	TF	SEPSECS	ZNF24	0.808253747	1.27E-19
UVM	TF	SEPSECS	ZNF140	0.808997405	1.11E-19
UVM	TF	SEPSECS	ZNF430	0.809207728	1.07E-19
UVM	TF	SEPSECS	ZNF180	0.809809753	9.54E-20
UVM	TF	SEPSECS	BACH1	0.810265608	8.76E-20
UVM	TF	SEPSECS	ZNF567	0.810527311	8.35E-20
UVM	TF	SEPSECS	SP100	0.812643921	5.62E-20
UVM	TF	SEPSECS	ZMAT1	0.813212153	5.05E-20
UVM	TF	SEPSECS	ZNF84	0.813320079	4.95E-20
UVM	TF	SEPSECS	ZNF566	0.815168665	3.49E-20
UVM	TF	SEPSECS	ZNF484	0.816126034	2.90E-20
UVM	TF	SEPSECS	ZNF280D	0.817412542	2.27E-20
UVM	TF	SEPSECS	NR2C1	0.817882712	2.07E-20
UVM	TF	SEPSECS	ZNF234	0.818204978	1.94E-20
UVM	TF	SEPSECS	ZNF254	0.818836491	1.72E-20
UVM	TF	SEPSECS	ZNF680	0.819632365	1.47E-20
UVM	TF	SEPSECS	ZNF17	0.819950917	1.38E-20
UVM	TF	SEPSECS	ZNF260	0.820183071	1.32E-20
UVM	TF	SEPSECS	ZNF800	0.820889695	1.15E-20
UVM	TF	SEPSECS	ZNF780B	0.821396537	1.04E-20
UVM	TF	SEPSECS	LIN54	0.822853545	7.78E-21
UVM	TF	SEPSECS	ZNF28	0.822952608	7.63E-21
UVM	TF	SEPSECS	MYSM1	0.823354136	7.04E-21
UVM	TF	SEPSECS	ZNF701	0.824733212	5.33E-21
UVM	TF	SEPSECS	ZNF226	0.825092511	4.96E-21
UVM	TF	SEPSECS	GPBP1	0.825102479	4.95E-21
UVM	TF	SEPSECS	ZNF326	0.826934464	3.40E-21
UVM	TF	SEPSECS	ZBED5	0.827194368	3.23E-21
UVM	TF	SEPSECS	CEBPZ	0.827403673	3.09E-21
UVM	TF	SEPSECS	IKZF5	0.82752872	3.01E-21
UVM	TF	SEPSECS	BAZ2B	0.831036545	1.45E-21
UVM	TF	SEPSECS	TMF1	0.832602234	1.04E-21
UVM	TF	SEPSECS	ZNF558	0.832693224	1.02E-21
UVM	TF	SEPSECS	TOPORS	0.83450116	6.93E-22
UVM	TF	SEPSECS	ZNF527	0.835050544	6.16E-22
UVM	TF	SEPSECS	ZNF136	0.836259702	4.74E-22
UVM	TF	SEPSECS	ZNF181	0.836314636	4.68E-22
UVM	TF	SEPSECS	ZNF721	0.836516041	4.48E-22
UVM	TF	SEPSECS	ZNF26	0.83672466	4.28E-22
UVM	TF	SEPSECS	ZNF100	0.837262392	3.80E-22
UVM	TF	SEPSECS	NFXL1	0.837615088	3.52E-22
UVM	TF	SEPSECS	SP3	0.838826108	2.69E-22
UVM	TF	SEPSECS	ZNF267	0.839010148	2.58E-22
UVM	TF	SEPSECS	ZNF799	0.841896957	1.35E-22
UVM	TF	SEPSECS	ZNF141	0.843545956	9.29E-23
UVM	TF	SEPSECS	ZNF708	0.843892966	8.57E-23
UVM	TF	SEPSECS	EEA1	0.846871476	4.29E-23
UVM	TF	SEPSECS	FOXN2	0.847863935	3.40E-23
UVM	TF	SEPSECS	THAP6	0.848271087	3.09E-23
UVM	TF	SEPSECS	MEF2A	0.849115995	2.52E-23
UVM	TF	SEPSECS	PCGF6	0.849320821	2.40E-23
UVM	TF	SEPSECS	DMTF1	0.851040753	1.59E-23
UVM	TF	SEPSECS	ZNF431	0.85234234	1.16E-23
UVM	TF	SEPSECS	ZNF10	0.85300056	9.86E-24
UVM	TF	SEPSECS	ZNF195	0.854369311	7.04E-24
UVM	TF	SEPSECS	ZNF510	0.855875293	4.83E-24
UVM	TF	SEPSECS	ZNF25	0.855928022	4.77E-24
UVM	TF	SEPSECS	SMAD5	0.855982557	4.71E-24
UVM	TF	SEPSECS	CREB1	0.856724678	3.90E-24
UVM	TF	SEPSECS	ZNF182	0.859769726	1.79E-24
UVM	TF	SEPSECS	ZNF248	0.862658837	8.44E-25
UVM	TF	SEPSECS	ZNF780A	0.862868529	7.98E-25
UVM	TF	SEPSECS	ZNF43	0.862898982	7.92E-25
UVM	TF	SEPSECS	ZNF449	0.865375339	4.09E-25
UVM	TF	SEPSECS	ZNF675	0.865916618	3.53E-25
UVM	TF	SEPSECS	THAP5	0.865958948	3.49E-25
UVM	TF	SEPSECS	ZBTB1	0.866857426	2.73E-25
UVM	TF	SEPSECS	ZNF674	0.867113106	2.55E-25
UVM	TF	SEPSECS	CREBZF	0.874335	3.32E-26
UVM	TF	SEPSECS	ZNF700	0.87464549	3.04E-26
UVM	TF	SEPSECS	ZNF518A	0.877420932	1.34E-26
UVM	TF	SEPSECS	ZNF451	0.88348773	2.08E-27
UVM	TF	SEPSECS	ZNF441	0.886155028	8.90E-28
UVM	TSG	SEPSECS	PDS5B	0.80199307	3.91E-19
UVM	TSG	SEPSECS	CSNK1A1	0.804233585	2.63E-19
UVM	TSG	SEPSECS	RBBP8	0.80548145	2.10E-19
UVM	TSG	SEPSECS	DICER1	0.806314781	1.81E-19
UVM	TSG	SEPSECS	TET2	0.807178465	1.54E-19
UVM	TSG	SEPSECS	NEDD4	0.812106216	6.22E-20
UVM	TSG	SEPSECS	BMPR2	0.812409636	5.88E-20
UVM	TSG	SEPSECS	SP100	0.812643921	5.62E-20
UVM	TSG	SEPSECS	PTPN11	0.813161969	5.10E-20
UVM	TSG	SEPSECS	CHUK	0.814443256	4.00E-20
UVM	TSG	SEPSECS	USP33	0.819112957	1.63E-20
UVM	TSG	SEPSECS	CUL2	0.820049003	1.36E-20
UVM	TSG	SEPSECS	MLH3	0.823027789	7.51E-21
UVM	TSG	SEPSECS	ANXA7	0.828363043	2.54E-21
UVM	TSG	SEPSECS	DCLRE1A	0.828700121	2.36E-21
UVM	TSG	SEPSECS	PPM1A	0.828852927	2.29E-21
UVM	TSG	SEPSECS	SMCHD1	0.831367986	1.35E-21
UVM	TSG	SEPSECS	CCAR1	0.832078465	1.16E-21
UVM	TSG	SEPSECS	BMPR1A	0.832623634	1.04E-21
UVM	TSG	SEPSECS	CDC73	0.833945358	7.81E-22
UVM	TSG	SEPSECS	TOPORS	0.83450116	6.93E-22
UVM	TSG	SEPSECS	UHRF2	0.83625204	4.74E-22
UVM	TSG	SEPSECS	INTS6	0.840436033	1.88E-22
UVM	TSG	SEPSECS	TANK	0.846358484	4.84E-23
UVM	TSG	SEPSECS	ATM	0.849320799	2.40E-23
UVM	TSG	SEPSECS	DMTF1	0.851040753	1.59E-23
UVM	TSG	SEPSECS	APAF1	0.852905912	1.01E-23
UVM	TSG	SEPSECS	KRIT1	0.852960373	9.96E-24
UVM	TSG	SEPSECS	WDR11	0.860539731	1.47E-24
UVM	TSG	SEPSECS	FAM188A	0.869629896	1.27E-25
UVM	TSG	SEPSECS	ITGAV	0.870092658	1.12E-25
UVM	TSG	SEPSECS	RB1CC1	0.872208471	6.13E-26
UVM	TSG	SEPSECS	GORAB	0.873218967	4.59E-26
UVM	TSG	SEPSECS	PRKAA1	0.876685015	1.67E-26
UVM	TSG	SEPSECS	CUL5	0.878970076	8.41E-27
UVM	TSG	SEPSECS	SUZ12	0.883190335	2.29E-27

Top

Protein structure

Protein 3D structure
Visit iCn3D.

Top

Protein-Protein Interaction

Protein-protein interaction networks
* Overlap between up-regulated DEGs (log2FC<-1 and adj.P<0.05) and STRING PPI network (center: Translation factor, node: DEGs, edges: weighted by -log2(adj.P))

Overlap between down-regulated DEGs (log2FC>1 and adj.P<0.05) and STRING PPI network (center: Translation factor, node: DEGs, edges: weighted by -log2(adj.P))

* Edge colors based on TCGA cancer types.

* Overlap between DEGs (log2FC>1 and adj.P<0.05) and STRING PPI network per cancer (center: Translation factor, node: DEGs, node color: log2FC, edges: weighted by -log2(adj.P))

Cancer type	Translation factor	Interacting protein coding gene	FC	adj.pval
LIHC	SEPSECS	TRNAU1AP	-1.56635696696237	0.000137265065605683
BLCA	SEPSECS	SEPHS2	-1.9883328839393	0.000209808349609375
LUAD	SEPSECS	SEPHS1	-1.15313813873661	0.00138581293962089
STAD	SEPSECS	SEPHS1	-1.32510322974915	0.00179363833740354
HNSC	SEPSECS	SARS	-1.91174328607452	0.00194819542025471
COAD	SEPSECS	PSTK	-2.83493023793761	0.00197160243988037
LUSC	SEPSECS	PSTK	-1.10450833392405	0.00201130880831994
PRAD	SEPSECS	PSTK	1.42484344304779	0.00312472017787764
CHOL	SEPSECS	SEPHS2	-1.45963342788287	0.00390625
PRAD	SEPSECS	SEPHS1	-1.04625754899676	0.00620723523605432
KICH	SEPSECS	SEPHS1	-2.76385276724593	0.00806879997253418
KIRP	SEPSECS	SEPHS1	-1.66470232520337	0.0099095250479877
LIHC	SEPSECS	SEPHS1	1.50217088635667	0.0158079482509981
COAD	SEPSECS	SEPHS2	-1.01516153437197	0.0189773440361023
LIHC	SEPSECS	SECISBP2	-1.75320478083999	0.0244988885611231
CHOL	SEPSECS	TRNAU1AP	-1.36228203168816	0.02734375
UCEC	SEPSECS	SEPHS2	-3.10798770240601	0.03125
READ	SEPSECS	EEFSEC	-2.14513057008022	0.03125
LUAD	SEPSECS	SARS2	-1.6825303693262	1.52668366875458e-07
THCA	SEPSECS	TRNAU1AP	-2.34899508686103	1.55290879513537e-06
COAD	SEPSECS	EEFSEC	-9.71610086929807	1.59740447998047e-05
THCA	SEPSECS	SEPHS1	-2.02989763642632	1.83290316109399e-09
PRAD	SEPSECS	SEPHS2	-1.35334370834684	3.09428010368575e-05
PRAD	SEPSECS	SECISBP2	1.87774240131642	5.80245434965193e-05
KIRC	SEPSECS	SEPHS2	-1.2281351725597	5.81016338316469e-09
KIRC	SEPSECS	PSTK	2.45946657502431	7.59244533881681e-10
KIRC	SEPSECS	SARS2	1.02423405449982	8.65930768143138e-05

Protein-protein interactors with this translation factor (BIOGRID-3.4.160)

PPI interactors with SEPSECS

gag, SOX2, CPPED1, ABLIM1, XPO1, RBPJ, MTMR2, RFWD2, LZTFL1, HEXIM1, TNFAIP3, ITFG1, nsp8, DTX2, SNX29,

Top

Mutations

Clinically associated variants from ClinVar.

Gene	Chr	Position	RefSeq	VarSeq	RefSeeq	VarType	Pathogenic	Disease	VarInfo
SEPSECS	chr4	25121683	T	A	single_nucleotide_variant	Uncertain_significance	Pontocerebellar_hypoplasia_type_2D	SO:0001624\|3_prime_UTR_variant	SO:0001624\|3_prime_UTR_variant
SEPSECS	chr4	25121705	G	A	single_nucleotide_variant	Benign	Pontocerebellar_hypoplasia_type_2D	SO:0001624\|3_prime_UTR_variant	SO:0001624\|3_prime_UTR_variant
SEPSECS	chr4	25121778	T	C	single_nucleotide_variant	Benign	Pontocerebellar_hypoplasia_type_2D	SO:0001624\|3_prime_UTR_variant	SO:0001624\|3_prime_UTR_variant
SEPSECS	chr4	25122145	AATT	A	Microsatellite	Uncertain_significance	Pontoneocerebellar_hypoplasia	SO:0001624\|3_prime_UTR_variant	SO:0001624\|3_prime_UTR_variant
SEPSECS	chr4	25122151	T	C	single_nucleotide_variant	Likely_benign	Pontocerebellar_hypoplasia_type_2D	SO:0001624\|3_prime_UTR_variant	SO:0001624\|3_prime_UTR_variant
SEPSECS	chr4	25122319	A	T	single_nucleotide_variant	Uncertain_significance	Pontocerebellar_hypoplasia_type_2D	SO:0001624\|3_prime_UTR_variant	SO:0001624\|3_prime_UTR_variant
SEPSECS	chr4	25122419	G	T	single_nucleotide_variant	Uncertain_significance	Pontocerebellar_hypoplasia_type_2D	SO:0001624\|3_prime_UTR_variant	SO:0001624\|3_prime_UTR_variant
SEPSECS	chr4	25122471	T	C	single_nucleotide_variant	Uncertain_significance	Pontocerebellar_hypoplasia_type_2D	SO:0001624\|3_prime_UTR_variant	SO:0001624\|3_prime_UTR_variant
SEPSECS	chr4	25122563	C	G	single_nucleotide_variant	Uncertain_significance	Pontocerebellar_hypoplasia_type_2D	SO:0001624\|3_prime_UTR_variant	SO:0001624\|3_prime_UTR_variant
SEPSECS	chr4	25122587	T	C	single_nucleotide_variant	Benign	Pontocerebellar_hypoplasia_type_2D	SO:0001624\|3_prime_UTR_variant	SO:0001624\|3_prime_UTR_variant
SEPSECS	chr4	25122632	T	C	single_nucleotide_variant	Uncertain_significance	Pontocerebellar_hypoplasia_type_2D	SO:0001624\|3_prime_UTR_variant	SO:0001624\|3_prime_UTR_variant
SEPSECS	chr4	25122637	T	C	single_nucleotide_variant	Uncertain_significance	Pontocerebellar_hypoplasia_type_2D	SO:0001624\|3_prime_UTR_variant	SO:0001624\|3_prime_UTR_variant
SEPSECS	chr4	25122682	A	G	single_nucleotide_variant	Uncertain_significance	Pontocerebellar_hypoplasia_type_2D	SO:0001624\|3_prime_UTR_variant	SO:0001624\|3_prime_UTR_variant
SEPSECS	chr4	25122713	A	G	single_nucleotide_variant	Benign	Pontocerebellar_hypoplasia_type_2D	SO:0001624\|3_prime_UTR_variant	SO:0001624\|3_prime_UTR_variant
SEPSECS	chr4	25122845	C	T	single_nucleotide_variant	Uncertain_significance	Pontocerebellar_hypoplasia_type_2D	SO:0001624\|3_prime_UTR_variant	SO:0001624\|3_prime_UTR_variant
SEPSECS	chr4	25122859	T	C	single_nucleotide_variant	Likely_benign	Pontocerebellar_hypoplasia_type_2D	SO:0001624\|3_prime_UTR_variant	SO:0001624\|3_prime_UTR_variant
SEPSECS	chr4	25122908	T	C	single_nucleotide_variant	Uncertain_significance	Pontocerebellar_hypoplasia_type_2D	SO:0001624\|3_prime_UTR_variant	SO:0001624\|3_prime_UTR_variant
SEPSECS	chr4	25122935	G	T	single_nucleotide_variant	Uncertain_significance	Pontocerebellar_hypoplasia_type_2D	SO:0001624\|3_prime_UTR_variant	SO:0001624\|3_prime_UTR_variant
SEPSECS	chr4	25123073	A	C	single_nucleotide_variant	Uncertain_significance	Pontocerebellar_hypoplasia_type_2D	SO:0001624\|3_prime_UTR_variant	SO:0001624\|3_prime_UTR_variant
SEPSECS	chr4	25123253	T	C	single_nucleotide_variant	Uncertain_significance	Pontocerebellar_hypoplasia_type_2D	SO:0001624\|3_prime_UTR_variant	SO:0001624\|3_prime_UTR_variant
SEPSECS	chr4	25123303	T	C	single_nucleotide_variant	Uncertain_significance	Pontocerebellar_hypoplasia_type_2D	SO:0001624\|3_prime_UTR_variant	SO:0001624\|3_prime_UTR_variant
SEPSECS	chr4	25123344	T	C	single_nucleotide_variant	Likely_benign	Pontocerebellar_hypoplasia_type_2D	SO:0001624\|3_prime_UTR_variant	SO:0001624\|3_prime_UTR_variant
SEPSECS	chr4	25123374	A	G	single_nucleotide_variant	Uncertain_significance	Pontocerebellar_hypoplasia_type_2D	SO:0001624\|3_prime_UTR_variant	SO:0001624\|3_prime_UTR_variant
SEPSECS	chr4	25123430	T	C	single_nucleotide_variant	Benign	Pontocerebellar_hypoplasia_type_2D	SO:0001624\|3_prime_UTR_variant	SO:0001624\|3_prime_UTR_variant
SEPSECS	chr4	25123826	C	T	single_nucleotide_variant	Uncertain_significance	Pontocerebellar_hypoplasia_type_2D	SO:0001624\|3_prime_UTR_variant	SO:0001624\|3_prime_UTR_variant
SEPSECS	chr4	25123894	G	T	single_nucleotide_variant	Uncertain_significance	Pontocerebellar_hypoplasia_type_2D	SO:0001624\|3_prime_UTR_variant	SO:0001624\|3_prime_UTR_variant
SEPSECS	chr4	25123905	C	T	single_nucleotide_variant	Uncertain_significance	Pontocerebellar_hypoplasia_type_2D	SO:0001624\|3_prime_UTR_variant	SO:0001624\|3_prime_UTR_variant
SEPSECS	chr4	25123916	C	T	single_nucleotide_variant	Uncertain_significance	Pontocerebellar_hypoplasia_type_2D	SO:0001624\|3_prime_UTR_variant	SO:0001624\|3_prime_UTR_variant
SEPSECS	chr4	25123918	C	T	single_nucleotide_variant	Uncertain_significance	Pontocerebellar_hypoplasia_type_2D	SO:0001624\|3_prime_UTR_variant	SO:0001624\|3_prime_UTR_variant
SEPSECS	chr4	25123931	A	G	single_nucleotide_variant	Uncertain_significance	Pontocerebellar_hypoplasia_type_2D	SO:0001624\|3_prime_UTR_variant	SO:0001624\|3_prime_UTR_variant
SEPSECS	chr4	25123933	G	A	single_nucleotide_variant	Uncertain_significance	Pontocerebellar_hypoplasia_type_2D	SO:0001624\|3_prime_UTR_variant	SO:0001624\|3_prime_UTR_variant
SEPSECS	chr4	25123939	A	G	single_nucleotide_variant	Uncertain_significance	Pontocerebellar_hypoplasia_type_2D	SO:0001624\|3_prime_UTR_variant	SO:0001624\|3_prime_UTR_variant
SEPSECS	chr4	25123962	C	T	single_nucleotide_variant	Uncertain_significance	Pontocerebellar_hypoplasia_type_2D	SO:0001624\|3_prime_UTR_variant	SO:0001624\|3_prime_UTR_variant
SEPSECS	chr4	25123979	A	G	single_nucleotide_variant	Uncertain_significance	Pontocerebellar_hypoplasia_type_2D	SO:0001624\|3_prime_UTR_variant	SO:0001624\|3_prime_UTR_variant
SEPSECS	chr4	25124431	G	A	single_nucleotide_variant	Uncertain_significance	Pontocerebellar_hypoplasia_type_2D	SO:0001624\|3_prime_UTR_variant	SO:0001624\|3_prime_UTR_variant
SEPSECS	chr4	25124512	A	G	single_nucleotide_variant	Likely_benign	Pontocerebellar_hypoplasia_type_2D	SO:0001624\|3_prime_UTR_variant	SO:0001624\|3_prime_UTR_variant
SEPSECS	chr4	25124522	C	T	single_nucleotide_variant	Uncertain_significance	Pontocerebellar_hypoplasia_type_2D	SO:0001624\|3_prime_UTR_variant	SO:0001624\|3_prime_UTR_variant
SEPSECS	chr4	25124545	A	G	single_nucleotide_variant	Uncertain_significance	Pontocerebellar_hypoplasia_type_2D	SO:0001624\|3_prime_UTR_variant	SO:0001624\|3_prime_UTR_variant
SEPSECS	chr4	25124746	T	C	single_nucleotide_variant	Benign	Pontocerebellar_hypoplasia_type_2D	SO:0001624\|3_prime_UTR_variant	SO:0001624\|3_prime_UTR_variant
SEPSECS	chr4	25124872	T	G	single_nucleotide_variant	Benign	Pontocerebellar_hypoplasia_type_2D	SO:0001624\|3_prime_UTR_variant	SO:0001624\|3_prime_UTR_variant
SEPSECS	chr4	25124915	C	G	single_nucleotide_variant	Likely_benign	Pontocerebellar_hypoplasia_type_2D	SO:0001624\|3_prime_UTR_variant	SO:0001624\|3_prime_UTR_variant
SEPSECS	chr4	25124941	C	A	single_nucleotide_variant	Uncertain_significance	Pontocerebellar_hypoplasia_type_2D	SO:0001624\|3_prime_UTR_variant	SO:0001624\|3_prime_UTR_variant
SEPSECS	chr4	25124943	C	T	single_nucleotide_variant	Uncertain_significance	Pontocerebellar_hypoplasia_type_2D	SO:0001624\|3_prime_UTR_variant	SO:0001624\|3_prime_UTR_variant
SEPSECS	chr4	25125083	A	C	single_nucleotide_variant	Uncertain_significance	Pontocerebellar_hypoplasia_type_2D	SO:0001624\|3_prime_UTR_variant	SO:0001624\|3_prime_UTR_variant
SEPSECS	chr4	25125098	G	A	single_nucleotide_variant	Likely_benign	Pontocerebellar_hypoplasia_type_2D	SO:0001624\|3_prime_UTR_variant	SO:0001624\|3_prime_UTR_variant
SEPSECS	chr4	25125099	G	A	single_nucleotide_variant	Benign	Pontocerebellar_hypoplasia_type_2D	SO:0001624\|3_prime_UTR_variant	SO:0001624\|3_prime_UTR_variant
SEPSECS	chr4	25125133	C	G	single_nucleotide_variant	Uncertain_significance	Pontocerebellar_hypoplasia_type_2D	SO:0001624\|3_prime_UTR_variant	SO:0001624\|3_prime_UTR_variant
SEPSECS	chr4	25125180	ATT	A	Deletion	Likely_benign	Pontoneocerebellar_hypoplasia	SO:0001624\|3_prime_UTR_variant	SO:0001624\|3_prime_UTR_variant
SEPSECS	chr4	25125199	G	A	single_nucleotide_variant	Uncertain_significance	Pontocerebellar_hypoplasia_type_2D	SO:0001624\|3_prime_UTR_variant	SO:0001624\|3_prime_UTR_variant
SEPSECS	chr4	25125201	T	C	single_nucleotide_variant	Uncertain_significance	Pontocerebellar_hypoplasia_type_2D	SO:0001624\|3_prime_UTR_variant	SO:0001624\|3_prime_UTR_variant
SEPSECS	chr4	25125225	T	A	single_nucleotide_variant	Uncertain_significance	Pontocerebellar_hypoplasia_type_2D	SO:0001624\|3_prime_UTR_variant	SO:0001624\|3_prime_UTR_variant
SEPSECS	chr4	25125226	C	T	single_nucleotide_variant	Uncertain_significance	Pontocerebellar_hypoplasia_type_2D	SO:0001624\|3_prime_UTR_variant	SO:0001624\|3_prime_UTR_variant
SEPSECS	chr4	25125282	C	T	single_nucleotide_variant	Uncertain_significance	Pontocerebellar_hypoplasia_type_2D	SO:0001624\|3_prime_UTR_variant	SO:0001624\|3_prime_UTR_variant
SEPSECS	chr4	25125295	CTTAA	C	Deletion	Conflicting_interpretations_of_pathogenicity	Pontoneocerebellar_hypoplasia\|not_provided	SO:0001624\|3_prime_UTR_variant	SO:0001624\|3_prime_UTR_variant
SEPSECS	chr4	25125300	T	C	single_nucleotide_variant	Uncertain_significance	Pontocerebellar_hypoplasia_type_2D	SO:0001624\|3_prime_UTR_variant	SO:0001624\|3_prime_UTR_variant
SEPSECS	chr4	25125316	C	CAAA	Insertion	Likely_benign	Pontoneocerebellar_hypoplasia\|not_provided	SO:0001624\|3_prime_UTR_variant	SO:0001624\|3_prime_UTR_variant
SEPSECS	chr4	25125330	C	T	single_nucleotide_variant	Benign	Pontocerebellar_hypoplasia_type_2D	SO:0001624\|3_prime_UTR_variant	SO:0001624\|3_prime_UTR_variant
SEPSECS	chr4	25125441	A	G	single_nucleotide_variant	Uncertain_significance	Pontocerebellar_hypoplasia_type_2D	SO:0001624\|3_prime_UTR_variant	SO:0001624\|3_prime_UTR_variant
SEPSECS	chr4	25125547	C	T	single_nucleotide_variant	Uncertain_significance	Pontocerebellar_hypoplasia_type_2D	SO:0001624\|3_prime_UTR_variant	SO:0001624\|3_prime_UTR_variant
SEPSECS	chr4	25125554	C	T	single_nucleotide_variant	Uncertain_significance	Pontocerebellar_hypoplasia_type_2D	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
SEPSECS	chr4	25125562	A	C	single_nucleotide_variant	Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
SEPSECS	chr4	25125583	A	C	single_nucleotide_variant	Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
SEPSECS	chr4	25125593	T	A	single_nucleotide_variant	Uncertain_significance	Pontocerebellar_hypoplasia_type_2D\|not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
SEPSECS	chr4	25125595	T	C	single_nucleotide_variant	Likely_benign	not_specified\|not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
SEPSECS	chr4	25125598	T	G	single_nucleotide_variant	Uncertain_significance	Pontocerebellar_hypoplasia_type_2D	SO:0001583\|missense_variant	SO:0001583\|missense_variant
SEPSECS	chr4	25125604	A	G	single_nucleotide_variant	Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
SEPSECS	chr4	25125606	C	T	single_nucleotide_variant	Uncertain_significance	Pontocerebellar_hypoplasia_type_2D	SO:0001583\|missense_variant	SO:0001583\|missense_variant
SEPSECS	chr4	25125618	T	C	single_nucleotide_variant	Uncertain_significance	not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
SEPSECS	chr4	25125625	A	G	single_nucleotide_variant	Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
SEPSECS	chr4	25125665	C	T	single_nucleotide_variant	Benign	Pontocerebellar_hypoplasia_type_2D\|not_specified\|not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
SEPSECS	chr4	25125666	G	A	single_nucleotide_variant	Conflicting_interpretations_of_pathogenicity	Spastic_ataxia\|Pontocerebellar_hypoplasia_type_2D	SO:0001587\|nonsense	SO:0001587\|nonsense
SEPSECS	chr4	25125669	C	A	single_nucleotide_variant	Uncertain_significance	Pontocerebellar_hypoplasia_type_2D	SO:0001587\|nonsense	SO:0001587\|nonsense
SEPSECS	chr4	25125676	T	C	single_nucleotide_variant	Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
SEPSECS	chr4	25125702	T	G	single_nucleotide_variant	Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
SEPSECS	chr4	25125703	C	G	single_nucleotide_variant	Benign	Pontocerebellar_hypoplasia_type_2D\|not_specified\|not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
SEPSECS	chr4	25125708	T	C	single_nucleotide_variant	Uncertain_significance	Pontocerebellar_hypoplasia_type_2D	SO:0001583\|missense_variant	SO:0001583\|missense_variant
SEPSECS	chr4	25125715	G	A	single_nucleotide_variant	Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
SEPSECS	chr4	25125718	C	T	single_nucleotide_variant	Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
SEPSECS	chr4	25125733	C	T	single_nucleotide_variant	Uncertain_significance	Pontocerebellar_hypoplasia_type_2D	SO:0001583\|missense_variant	SO:0001583\|missense_variant
SEPSECS	chr4	25125739	G	A	single_nucleotide_variant	Likely_benign	Pontocerebellar_hypoplasia_type_2D\|not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
SEPSECS	chr4	25125768	A	C	single_nucleotide_variant	Likely_benign	Pontocerebellar_hypoplasia_type_2D\|not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
SEPSECS	chr4	25125769	A	G	single_nucleotide_variant	Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
SEPSECS	chr4	25125769	A	T	single_nucleotide_variant	Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
SEPSECS	chr4	25125783	T	C	single_nucleotide_variant	Uncertain_significance	Pontocerebellar_hypoplasia_type_2D\|not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
SEPSECS	chr4	25125785	T	C	single_nucleotide_variant	Uncertain_significance	Pontocerebellar_hypoplasia_type_2D	SO:0001583\|missense_variant	SO:0001583\|missense_variant
SEPSECS	chr4	25125788	G	T	single_nucleotide_variant	Uncertain_significance	not_specified	SO:0001587\|nonsense	SO:0001587\|nonsense
SEPSECS	chr4	25125793	A	G	single_nucleotide_variant	Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
SEPSECS	chr4	25125796	G	A	single_nucleotide_variant	Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
SEPSECS	chr4	25125802	G	C	single_nucleotide_variant	Uncertain_significance	Pontocerebellar_hypoplasia_type_2D	SO:0001583\|missense_variant	SO:0001583\|missense_variant
SEPSECS	chr4	25125809	T	C	single_nucleotide_variant	Uncertain_significance	Pontocerebellar_hypoplasia_type_2D	SO:0001583\|missense_variant	SO:0001583\|missense_variant
SEPSECS	chr4	25125837	G	A	single_nucleotide_variant	Uncertain_significance	Pontocerebellar_hypoplasia_type_2D	SO:0001583\|missense_variant	SO:0001583\|missense_variant
SEPSECS	chr4	25125844	A	G	single_nucleotide_variant	Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
SEPSECS	chr4	25125846	C	A	single_nucleotide_variant	Uncertain_significance	not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
SEPSECS	chr4	25125854	G	A	single_nucleotide_variant	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
SEPSECS	chr4	25125857	G	C	single_nucleotide_variant	Likely_benign	Pontocerebellar_hypoplasia_type_2D\|not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
SEPSECS	chr4	25127118	G	A	single_nucleotide_variant	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
SEPSECS	chr4	25127161	C	A	single_nucleotide_variant	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
SEPSECS	chr4	25127307	C	T	single_nucleotide_variant	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
SEPSECS	chr4	25127309	T	C	single_nucleotide_variant	Benign	Pontocerebellar_hypoplasia_type_2D\|not_specified\|not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
SEPSECS	chr4	25127336	G	A	single_nucleotide_variant	Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
SEPSECS	chr4	25127346	A	G	single_nucleotide_variant	Uncertain_significance	Pontocerebellar_hypoplasia_type_2D	SO:0001583\|missense_variant	SO:0001583\|missense_variant
SEPSECS	chr4	25127348	C	T	single_nucleotide_variant	Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
SEPSECS	chr4	25127378	G	GT	Duplication	Pathogenic	not_provided	SO:0001589\|frameshift_variant	SO:0001589\|frameshift_variant
SEPSECS	chr4	25127384	A	G	single_nucleotide_variant	Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
SEPSECS	chr4	25127399	T	C	single_nucleotide_variant	Benign/Likely_benign	Pontocerebellar_hypoplasia_type_2D\|not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
SEPSECS	chr4	25127407	C	A	single_nucleotide_variant	Likely_pathogenic	not_provided	SO:0001574\|splice_acceptor_variant	SO:0001574\|splice_acceptor_variant
SEPSECS	chr4	25128736	C	T	single_nucleotide_variant	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
SEPSECS	chr4	25128782	A	G	single_nucleotide_variant	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
SEPSECS	chr4	25128874	A	G	single_nucleotide_variant	Benign	Pontocerebellar_hypoplasia_type_2D\|not_specified\|not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
SEPSECS	chr4	25128878	G	T	single_nucleotide_variant	Uncertain_significance	Pontocerebellar_hypoplasia_type_2D	SO:0001627\|intron_variant	SO:0001627\|intron_variant
SEPSECS	chr4	25128884	ACCTAAAGATATGGGATTGTGAGGTGTATGCAACAGTCTTTCATTGTAGGCTTCTGACAACTTCTTTATTTGGTTGGACAAATATGAAAACATTT	A	Deletion	Likely_pathogenic	Cerebellar_ataxia\|Dysarthria\|Spastic_diplegia\|Neurodegeneration\|Elliptical_nystagmus\|Progressive_limb_weakness	SO:0001574\|splice_acceptor_variant,SO:0001575\|splice_donor_variant	SO:0001574\|splice_acceptor_variant,SO:0001575\|splice_donor_variant
SEPSECS	chr4	25128886	C	T	single_nucleotide_variant	Uncertain_significance	Pontocerebellar_hypoplasia_type_2D	SO:0001583\|missense_variant	SO:0001583\|missense_variant
SEPSECS	chr4	25128917	C	A	single_nucleotide_variant	Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
SEPSECS	chr4	25128917	C	T	single_nucleotide_variant	Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
SEPSECS	chr4	25128943	A	G	single_nucleotide_variant	Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
SEPSECS	chr4	25128968	T	C	single_nucleotide_variant	Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
SEPSECS	chr4	25128986	C	T	single_nucleotide_variant	Conflicting_interpretations_of_pathogenicity	Pontocerebellar_hypoplasia_type_2D\|not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
SEPSECS	chr4	25128988	A	G	single_nucleotide_variant	Likely_benign	Pontocerebellar_hypoplasia_type_2D\|not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
SEPSECS	chr4	25128996	T	C	single_nucleotide_variant	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
SEPSECS	chr4	25146172	T	C	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
SEPSECS	chr4	25146307	G	A	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
SEPSECS	chr4	25146388	A	G	single_nucleotide_variant	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
SEPSECS	chr4	25146399	T	C	single_nucleotide_variant	Benign/Likely_benign	Pontocerebellar_hypoplasia_type_2D\|not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
SEPSECS	chr4	25146400	C	T	single_nucleotide_variant	Uncertain_significance	not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
SEPSECS	chr4	25146421	T	C	single_nucleotide_variant	Pathogenic	Pontocerebellar_hypoplasia_type_2D\|not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
SEPSECS	chr4	25146422	A	G	single_nucleotide_variant	Uncertain_significance	Pontocerebellar_hypoplasia_type_2D	SO:0001583\|missense_variant	SO:0001583\|missense_variant
SEPSECS	chr4	25146447	A	C	single_nucleotide_variant	Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
SEPSECS	chr4	25146462	T	C	single_nucleotide_variant	Likely_benign	Pontocerebellar_hypoplasia_type_2D\|not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
SEPSECS	chr4	25146477	T	C	single_nucleotide_variant	Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
SEPSECS	chr4	25146483	T	C	single_nucleotide_variant	Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
SEPSECS	chr4	25146492	A	C	single_nucleotide_variant	Benign	Pontocerebellar_hypoplasia_type_2D\|not_specified\|not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
SEPSECS	chr4	25146613	CTTAT	C	Microsatellite	Likely_benign	not_provided	SO:0001575\|splice_donor_variant	SO:0001575\|splice_donor_variant
SEPSECS	chr4	25146641	T	C	single_nucleotide_variant	Likely_benign	Pontocerebellar_hypoplasia_type_2D\|not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
SEPSECS	chr4	25146657	T	G	single_nucleotide_variant	Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
SEPSECS	chr4	25146672	A	G	single_nucleotide_variant	Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
SEPSECS	chr4	25146714	C	T	single_nucleotide_variant	Conflicting_interpretations_of_pathogenicity	Pontocerebellar_hypoplasia_type_2D\|not_specified\|not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
SEPSECS	chr4	25146724	AC	A	Deletion	Pathogenic	not_provided	SO:0001589\|frameshift_variant	SO:0001589\|frameshift_variant
SEPSECS	chr4	25146737	T	C	single_nucleotide_variant	Uncertain_significance	Pontocerebellar_hypoplasia_type_2D	SO:0001583\|missense_variant	SO:0001583\|missense_variant
SEPSECS	chr4	25146741	A	G	single_nucleotide_variant	Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
SEPSECS	chr4	25146748	C	A	single_nucleotide_variant	Uncertain_significance	Pontocerebellar_hypoplasia_type_2D	SO:0001583\|missense_variant	SO:0001583\|missense_variant
SEPSECS	chr4	25146749	G	A	single_nucleotide_variant	Pathogenic	not_provided	SO:0001587\|nonsense	SO:0001587\|nonsense
SEPSECS	chr4	25146751	G	GC	Duplication	Pathogenic/Likely_pathogenic	Pontocerebellar_hypoplasia_type_2D\|not_provided
SEPSECS	chr4	25146753	C	G	single_nucleotide_variant	Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
SEPSECS	chr4	25147067	T	A	single_nucleotide_variant	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
SEPSECS	chr4	25153454	AAC	A	Microsatellite	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
SEPSECS	chr4	25153572	ACT	A	Microsatellite	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
SEPSECS	chr4	25153578	T	A	single_nucleotide_variant	Uncertain_significance	Pontocerebellar_hypoplasia_type_2D	SO:0001627\|intron_variant	SO:0001627\|intron_variant
SEPSECS	chr4	25153603	C	T	single_nucleotide_variant	Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
SEPSECS	chr4	25153606	T	C	single_nucleotide_variant	Conflicting_interpretations_of_pathogenicity	Pontocerebellar_hypoplasia_type_2D\|not_specified\|not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
SEPSECS	chr4	25153614	G	A	single_nucleotide_variant	Pathogenic	not_provided	SO:0001587\|nonsense	SO:0001587\|nonsense
SEPSECS	chr4	25153620	C	A	single_nucleotide_variant	Pathogenic/Likely_pathogenic	Pontocerebellar_hypoplasia_type_2D\|not_provided	SO:0001587\|nonsense	SO:0001587\|nonsense
SEPSECS	chr4	25153626	C	T	single_nucleotide_variant	Uncertain_significance	not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
SEPSECS	chr4	25153671	C	T	single_nucleotide_variant	Pathogenic/Likely_pathogenic	Pontocerebellar_hypoplasia_type_2D\|Pontoneocerebellar_hypoplasia\|not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
SEPSECS	chr4	25153680	CTAATCTA	C	Deletion	Likely_pathogenic	not_provided	SO:0001574\|splice_acceptor_variant	SO:0001574\|splice_acceptor_variant
SEPSECS	chr4	25153692	C	T	single_nucleotide_variant	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
SEPSECS	chr4	25153694	T	C	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
SEPSECS	chr4	25153976	TA	T	Deletion	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
SEPSECS	chr4	25156374	C	T	single_nucleotide_variant	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
SEPSECS	chr4	25156483	A	G	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
SEPSECS	chr4	25156610	A	T	single_nucleotide_variant	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
SEPSECS	chr4	25156613	C	A	single_nucleotide_variant	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
SEPSECS	chr4	25156637	A	C	single_nucleotide_variant	Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
SEPSECS	chr4	25156652	A	C	single_nucleotide_variant	Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
SEPSECS	chr4	25156655	A	G	single_nucleotide_variant	Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
SEPSECS	chr4	25156667	CAG	C	Deletion	Likely_pathogenic	not_provided	SO:0001589\|frameshift_variant	SO:0001589\|frameshift_variant
SEPSECS	chr4	25156682	C	T	single_nucleotide_variant	Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
SEPSECS	chr4	25156687	G	C	single_nucleotide_variant	Uncertain_significance	Pontocerebellar_hypoplasia_type_2D\|not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
SEPSECS	chr4	25156708	C	CT	Duplication	Pathogenic	Inborn_genetic_diseases	SO:0001589\|frameshift_variant	SO:0001589\|frameshift_variant
SEPSECS	chr4	25156733	G	A	single_nucleotide_variant	Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
SEPSECS	chr4	25156737	C	T	single_nucleotide_variant	Uncertain_significance	not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
SEPSECS	chr4	25156739	T	C	single_nucleotide_variant	Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
SEPSECS	chr4	25156774	C	T	single_nucleotide_variant	Uncertain_significance	not_provided	SO:0001574\|splice_acceptor_variant	SO:0001574\|splice_acceptor_variant
SEPSECS	chr4	25156958	G	A	single_nucleotide_variant	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
SEPSECS	chr4	25156970	C	T	single_nucleotide_variant	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
SEPSECS	chr4	25156986	T	G	single_nucleotide_variant	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
SEPSECS	chr4	25157649	C	T	single_nucleotide_variant	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
SEPSECS	chr4	25157671	T	C	single_nucleotide_variant	Uncertain_significance	not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
SEPSECS	chr4	25157675	T	C	single_nucleotide_variant	Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
SEPSECS	chr4	25157705	C	T	single_nucleotide_variant	Pathogenic	not_provided	SO:0001587\|nonsense	SO:0001587\|nonsense
SEPSECS	chr4	25157707	A	G	single_nucleotide_variant	Uncertain_significance	Pontocerebellar_hypoplasia_type_2D	SO:0001583\|missense_variant	SO:0001583\|missense_variant
SEPSECS	chr4	25157715	T	C	single_nucleotide_variant	Uncertain_significance	not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
SEPSECS	chr4	25157717	C	T	single_nucleotide_variant	Uncertain_significance	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
SEPSECS	chr4	25157732	T	C	single_nucleotide_variant	Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
SEPSECS	chr4	25157739	C	T	single_nucleotide_variant	Uncertain_significance	Pontocerebellar_hypoplasia_type_2D	SO:0001583\|missense_variant	SO:0001583\|missense_variant
SEPSECS	chr4	25157740	G	A	single_nucleotide_variant	Pathogenic	not_provided	SO:0001587\|nonsense	SO:0001587\|nonsense
SEPSECS	chr4	25157756	C	A	single_nucleotide_variant	Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
SEPSECS	chr4	25157756	C	CA	Duplication	Pathogenic	not_provided	SO:0001589\|frameshift_variant	SO:0001589\|frameshift_variant
SEPSECS	chr4	25157756	CAG	C	Microsatellite	Pathogenic	not_provided	SO:0001589\|frameshift_variant	SO:0001589\|frameshift_variant
SEPSECS	chr4	25157762	T	C	single_nucleotide_variant	Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
SEPSECS	chr4	25157762	T	TA	Duplication	Pathogenic	not_provided	SO:0001589\|frameshift_variant	SO:0001589\|frameshift_variant
SEPSECS	chr4	25157770	T	C	single_nucleotide_variant	Uncertain_significance	not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
SEPSECS	chr4	25157786	A	T	single_nucleotide_variant	Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
SEPSECS	chr4	25157817	C	T	single_nucleotide_variant	Uncertain_significance	not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
SEPSECS	chr4	25157818	C	T	single_nucleotide_variant	Likely_pathogenic	not_provided	SO:0001574\|splice_acceptor_variant	SO:0001574\|splice_acceptor_variant
SEPSECS	chr4	25157823	A	T	single_nucleotide_variant	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
SEPSECS	chr4	25157825	T	G	single_nucleotide_variant	Conflicting_interpretations_of_pathogenicity	Pontocerebellar_hypoplasia_type_2D\|not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
SEPSECS	chr4	25157827	A	G	single_nucleotide_variant	Conflicting_interpretations_of_pathogenicity	Pontocerebellar_hypoplasia_type_2D\|not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
SEPSECS	chr4	25157861	AC	A	Deletion	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
SEPSECS	chr4	25157869	T	C	single_nucleotide_variant	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
SEPSECS	chr4	25157955	A	C	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
SEPSECS	chr4	25158025	TA	T	Deletion	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
SEPSECS	chr4	25158222	C	T	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
SEPSECS	chr4	25158287	G	A	single_nucleotide_variant	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
SEPSECS	chr4	25158329	C	CA	Duplication	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
SEPSECS	chr4	25158329	C	CAA	Duplication	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
SEPSECS	chr4	25158329	CAAA	C	Deletion	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
SEPSECS	chr4	25158329	CAAAAAAAA	C	Deletion	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
SEPSECS	chr4	25158329	CAAAAAAAAAA	C	Deletion	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
SEPSECS	chr4	25158468	C	T	single_nucleotide_variant	Likely_benign	Pontocerebellar_hypoplasia_type_2D\|not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
SEPSECS	chr4	25158469	G	A	single_nucleotide_variant	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
SEPSECS	chr4	25158473	C	T	single_nucleotide_variant	Likely_pathogenic	Seizures\|Congenital_cerebellar_hypoplasia\|Arthrogryposis_multiplex_congenita\|Kyphosis\|Spinal_rigidity\|Cerebral_hypoplasia\|Severe_global_developmental_delay\|Pontocerebellar_hypoplasia_type_2D	SO:0001627\|intron_variant	SO:0001627\|intron_variant
SEPSECS	chr4	25158475	T	C	single_nucleotide_variant	Conflicting_interpretations_of_pathogenicity	Pontocerebellar_hypoplasia_type_2D\|not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
SEPSECS	chr4	25158484	G	A	single_nucleotide_variant	Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
SEPSECS	chr4	25158491	A	G	single_nucleotide_variant	Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
SEPSECS	chr4	25158499	G	A	single_nucleotide_variant	Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
SEPSECS	chr4	25158511	T	C	single_nucleotide_variant	Likely_pathogenic	Inborn_genetic_diseases	SO:0001583\|missense_variant	SO:0001583\|missense_variant
SEPSECS	chr4	25158553	G	A	single_nucleotide_variant	Pathogenic	not_provided	SO:0001587\|nonsense	SO:0001587\|nonsense
SEPSECS	chr4	25158572	G	A	single_nucleotide_variant	Likely_benign	not_specified\|not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
SEPSECS	chr4	25158577	G	A	single_nucleotide_variant	Pathogenic	not_provided	SO:0001587\|nonsense	SO:0001587\|nonsense
SEPSECS	chr4	25158587	A	G	single_nucleotide_variant	Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
SEPSECS	chr4	25158750	T	C	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
SEPSECS	chr4	25158896	C	A	single_nucleotide_variant	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
SEPSECS	chr4	25160490	A	C	single_nucleotide_variant	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
SEPSECS	chr4	25160562	TAAAA	T	Deletion	Conflicting_interpretations_of_pathogenicity	Pontoneocerebellar_hypoplasia\|not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
SEPSECS	chr4	25160580	A	T	single_nucleotide_variant	Uncertain_significance	Pontocerebellar_hypoplasia_type_2D	SO:0001583\|missense_variant	SO:0001583\|missense_variant
SEPSECS	chr4	25160588	G	A	single_nucleotide_variant	Uncertain_significance	Pontocerebellar_hypoplasia_type_2D	SO:0001583\|missense_variant	SO:0001583\|missense_variant
SEPSECS	chr4	25160597	G	A	single_nucleotide_variant	Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
SEPSECS	chr4	25160601	G	A	single_nucleotide_variant	Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
SEPSECS	chr4	25160603	A	G	single_nucleotide_variant	Uncertain_significance	not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
SEPSECS	chr4	25160616	T	C	single_nucleotide_variant	Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
SEPSECS	chr4	25160663	T	C	single_nucleotide_variant	Uncertain_significance	Pontocerebellar_hypoplasia_type_2D	SO:0001583\|missense_variant	SO:0001583\|missense_variant
SEPSECS	chr4	25160704	T	C	single_nucleotide_variant	Uncertain_significance	not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
SEPSECS	chr4	25160730	C	G	single_nucleotide_variant	Likely_pathogenic	not_provided	SO:0001574\|splice_acceptor_variant	SO:0001574\|splice_acceptor_variant
SEPSECS	chr4	25160732	T	TA	Duplication	Benign	not_specified\|not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
SEPSECS	chr4	25160732	TA	T	Deletion	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
SEPSECS	chr4	25160733	A	G	single_nucleotide_variant	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
SEPSECS	chr4	25160736	A	AG	Insertion	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
SEPSECS	chr4	25160964	CTGAGA	C	Deletion	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
SEPSECS	chr4	25161539	G	A	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
SEPSECS	chr4	25161715	G	C	single_nucleotide_variant	Benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
SEPSECS	chr4	25161794	G	A	single_nucleotide_variant	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
SEPSECS	chr4	25161870	C	G	single_nucleotide_variant	Likely_benign	not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
SEPSECS	chr4	25161875	T	C	single_nucleotide_variant	Likely_pathogenic	Neurodevelopmental_abnormality\|not_provided	SO:0001627\|intron_variant	SO:0001627\|intron_variant
SEPSECS	chr4	25161884	C	CTT	Insertion	Pathogenic	not_provided	SO:0001589\|frameshift_variant	SO:0001589\|frameshift_variant
SEPSECS	chr4	25161897	A	C	single_nucleotide_variant	Uncertain_significance	Pontocerebellar_hypoplasia_type_2D	SO:0001583\|missense_variant	SO:0001583\|missense_variant
SEPSECS	chr4	25161902	G	A	single_nucleotide_variant	Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
SEPSECS	chr4	25161908	A	G	single_nucleotide_variant	Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
SEPSECS	chr4	25161917	G	A	single_nucleotide_variant	Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
SEPSECS	chr4	25161918	C	A	single_nucleotide_variant	Uncertain_significance	not_provided	SO:0001583\|missense_variant	SO:0001583\|missense_variant
SEPSECS	chr4	25161932	C	T	single_nucleotide_variant	Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
SEPSECS	chr4	25161947	C	T	single_nucleotide_variant	Benign/Likely_benign	Pontocerebellar_hypoplasia_type_2D\|not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
SEPSECS	chr4	25161951	G	T	single_nucleotide_variant	Pathogenic	not_provided	SO:0001587\|nonsense	SO:0001587\|nonsense
SEPSECS	chr4	25161961	G	T	single_nucleotide_variant	Likely_benign	not_provided	SO:0001819\|synonymous_variant	SO:0001819\|synonymous_variant
SEPSECS	chr4	25161991	T	A	single_nucleotide_variant	Pathogenic	Pontocerebellar_hypoplasia_type_2D	SO:0001582\|initiatior_codon_variant,SO:0001583\|missense_variant	SO:0001582\|initiatior_codon_variant,SO:0001583\|missense_variant
SEPSECS	chr4	25161991	T	C	single_nucleotide_variant	Pathogenic	not_provided	SO:0001582\|initiatior_codon_variant,SO:0001583\|missense_variant	SO:0001582\|initiatior_codon_variant,SO:0001583\|missense_variant
SEPSECS	chr4	25162105	AAAAAC	A	Microsatellite	Uncertain_significance	Pontoneocerebellar_hypoplasia	SO:0002153\|genic_upstream_transcript_variant	SO:0002153\|genic_upstream_transcript_variant
SEPSECS	chr4	25162130	C	CA	Duplication	Benign/Likely_benign	Pontoneocerebellar_hypoplasia\|not_provided	SO:0002153\|genic_upstream_transcript_variant	SO:0002153\|genic_upstream_transcript_variant
SEPSECS	chr4	25162130	C	CAA	Duplication	Conflicting_interpretations_of_pathogenicity	Pontoneocerebellar_hypoplasia\|not_provided	SO:0002153\|genic_upstream_transcript_variant	SO:0002153\|genic_upstream_transcript_variant
SEPSECS	chr4	25162151	G	A	single_nucleotide_variant	Conflicting_interpretations_of_pathogenicity	Pontoneocerebellar_hypoplasia\|not_provided	SO:0002153\|genic_upstream_transcript_variant	SO:0002153\|genic_upstream_transcript_variant
SEPSECS	chr4	25162256	A	C	single_nucleotide_variant	Benign	not_provided
SEPSECS	chr4	25162380	G	T	single_nucleotide_variant	Benign	not_provided

nsSNVs with sample frequency (size of circle) from TCGA 33 cancers.

SNVs and Indels

Gene	Cancer type	Chromosome	Start	End	RefSeeq	MutSeq	Mutation type	AAchange	# samples
SEPSECS	BRCA	chr4	25160722	25160722	C	A	Missense_Mutation	p.C41F	3
SEPSECS	LIHC	chr4	25156728	25156728	A	G	Missense_Mutation	p.L198P	3
SEPSECS	PAAD	chr4	25158572	25158572	G	A	Silent	p.S98S	3
SEPSECS	LIHC	chr4	25156728	25156728	A	G	Missense_Mutation		3
SEPSECS	LIHC	chr4	25156767	25156767	T	G	Missense_Mutation		2
SEPSECS	UCEC	chr4	25128911	25128911	A	G	Silent	p.H286	2
SEPSECS	LUAD	chr4	25125605	25125605	G	C	Missense_Mutation	p.A485G	2
SEPSECS	SKCM	chr4	25125674	25125674	C	T	Missense_Mutation	p.R462K	2
SEPSECS	LIHC	chr4	25160666	25160666	T	A	Missense_Mutation	p.I60F	2
SEPSECS	UCEC	chr4	25128919	25128919	G	T	Missense_Mutation	p.L284M	2
SEPSECS	SKCM	chr4	25125709	25125709	G	A	Silent	p.F450F	2
SEPSECS	UCEC	chr4	25157662	25157662	C	T	Missense_Mutation	p.A103T	2
SEPSECS	LIHC	chr4	25160704	25160704	T	C	Missense_Mutation	p.D47G	2
SEPSECS	UCEC	chr4	25157669	25157669	C	A	Missense_Mutation	p.M100I	2
SEPSECS	CESC	chr4	25125703	25125703	C	G	Missense_Mutation		2
SEPSECS	STAD	chr4	25156725	25156725	C	T	Missense_Mutation		2
SEPSECS	LIHC	chr4	25160667	25160667	T	G	Silent	p.A59A	2
SEPSECS	UCEC	chr4	25157685	25157685	G	A	Missense_Mutation	p.S95F	2
SEPSECS	CESC	chr4	25125674	25125674	C	G	Missense_Mutation		2
SEPSECS	PAAD	chr4	25158572	25158572	G	A	Silent		2
SEPSECS	STAD	chr4	25156725	25156725	C	T	Missense_Mutation	p.R199H	2
SEPSECS	UCEC	chr4	25158481	25158481	C	T	Missense_Mutation	p.A50T	2
SEPSECS	STAD	chr4	25146678	25146678	T	C	Missense_Mutation	p.I294M	2
SEPSECS	UCEC	chr4	25158576	25158576	C	T	Missense_Mutation	p.R18Q	2
SEPSECS	COAD	chr4	25125665	25125665	C	T	Missense_Mutation	p.R465Q	2
SEPSECS	LIHC	chr4	25160667	25160667	T	G	Silent		2
SEPSECS	THCA	chr4	25125832	25125832	C	A	Silent	p.G409G	2
SEPSECS	BLCA	chr4	25160685	25160685	G	C	Silent	p.L53L	2
SEPSECS	COAD	chr4	25158571	25158571	C	T	Missense_Mutation	p.G99S	1
SEPSECS	SARC	chr4	25153670	25153670	G	T	Missense_Mutation		1
SEPSECS	UCEC	chr4	25157685	25157685	G	A	Missense_Mutation	p.S174F	1
SEPSECS	BLCA	chr4	25146650	25146650	G	A	Nonsense_Mutation	p.Q304*	1
SEPSECS	ESCA	chr4	25157773	25157773	C	A	Missense_Mutation	p.G145C	1
SEPSECS	LUAD	chr4	25160709	25160709	G	A	Silent	p.G45G	1
SEPSECS	GBM	chr4	25125641	25125641	T	C	Missense_Mutation	p.Y473C	1
SEPSECS	BRCA	chr4	25125665	25125665	C	T	Missense_Mutation	p.R386Q	1
SEPSECS	LUAD	chr4	25128906	25128906	G	A	Missense_Mutation	p.P367L	1
SEPSECS	GBM	chr4	25127315	25127315	C	T	Splice_Site	p.R404_splice	1
SEPSECS	SKCM	chr4	25125802	25125802	G	A	Silent	p.F419F	1
SEPSECS	BLCA	chr4	25146637	25146637	T	C	Missense_Mutation		1
SEPSECS	LUSC	chr4	25146715	25146715	A	T	Nonsense_Mutation	p.L282*	1
SEPSECS	GBM	chr4	25127315	25127315	C	T	Splice_Site		1
SEPSECS	BLCA	chr4	25146682	25146682	G	A	Missense_Mutation		1
SEPSECS	GBM	chr4	25125641	25125641	T	C	Missense_Mutation		1
SEPSECS	BLCA	chr4	25160685	25160685	G	C	Silent		1
SEPSECS	LIHC	chr4	25156767	25156767	T	G	Missense_Mutation	p.E185A	1
SEPSECS	CESC	chr4	25125674	25125674	C	G	Missense_Mutation	p.R462T	1
SEPSECS	GBM	chr4	25160704	25160704	T	C	Missense_Mutation		1
SEPSECS	BLCA	chr4	25157673	25157673	G	A	Missense_Mutation		1
SEPSECS	LIHC	chr4	25156682	25156682	C	-	Frame_Shift_Del	p.G213fs	1
SEPSECS	CHOL	chr4	25157778	25157778	G	A	Missense_Mutation		1
SEPSECS	READ	chr4	25156721	25156721	T	A	Silent	p.T200T	1
SEPSECS	KIRP	chr4	25156760	25156760	C	A	Silent		1
SEPSECS	THCA	chr4	25125832	25125832	C	A	Silent		1
SEPSECS	BLCA	chr4	25146637	25146637	T	C	Missense_Mutation	p.K308R	1
SEPSECS	LIHC	chr4	25128952	25128952	T	-	Frame_Shift_Del	p.I352fs	1
SEPSECS	READ	chr4	25160601	25160601	G	A	Silent	p.S81S	1
SEPSECS	BLCA	chr4	25146682	25146682	G	A	Missense_Mutation	p.A293V	1
SEPSECS	LIHC	chr4	25146666	25146666	A	-	Frame_Shift_Del	p.F298fs	1
SEPSECS	READ	chr4	25128891	25128891	G	T	Missense_Mutation	p.S372Y	1
SEPSECS	COAD	chr4	25153615	25153615	C	T	Silent	p.V257V	1
SEPSECS	LIHC	chr4	25160716	25160716	T	C	Missense_Mutation		1
SEPSECS	THCA	chr4	25160718	25160718	T	C	Silent	p.P42P	1
SEPSECS	LIHC	chr4	25146706	25146706	T	-	Frame_Shift_Del	p.N285fs	1
SEPSECS	COAD	chr4	25153622	25153622	T	C	Missense_Mutation	p.Y255C	1
SEPSECS	READ	chr4	25156669	25156669	G	T	Missense_Mutation	p.L218M	1
SEPSECS	THYM	chr4	25158541	25158541	C	T	Missense_Mutation	p.A109T	1
SEPSECS	BLCA	chr4	25157673	25157673	G	A	Missense_Mutation	p.S178F	1
SEPSECS	LIHC	chr4	25160641	25160641	C	-	Frame_Shift_Del	p.G68fs	1

Copy number variation (CNV) of SEPSECS
* Click on the image to open the original image in a new window.

Fusion gene breakpoints (product of the structural variants (SVs)) across SEPSECS
* Click on the image to open the UCSC genome browser with custom track showing this image in a new window.

Fusion genes with this translation factor from FusionGDB2.0.

FusionGDB2 ID	Disease	Sample	Hgene	Hchr	Hbp	Hstrand	Tgene	Tchr	Tbp	Tstrand
58189	BRCA	TCGA-BH-A0AY-01A	GNPTG	chr16	1402307	+	SEPSECS	chr4	25160729	-
58189	STAD	TCGA-BR-8284	NDUFB6	chr9	32570957	-	SEPSECS	chr4	25160729	-
58189	STAD	TCGA-BR-8284-01A	NDUFB6	chr9	32570958	-	SEPSECS	chr4	25160729	-

Top

Prognostic Analysis

Kaplan-Meier plots with logrank tests of overall survival (OS)

Cancer type

Translation factor

Coefficent

Hazard ratio

Wald test pval

Likelihool ratio pval

Logrank test pval

# samples

Top

Translation factor and Gender

Differential gene expression between female and male. (Wilcoxon test, pval<0.05)

Cancer type	Translation factor	pval	adj.p
TGCT	SEPSECS	0.00020414291785027	0.0055
THYM	SEPSECS	0.0160442832515704	0.42
KIRC	SEPSECS	0.0478269135975108	1
KIRP	SEPSECS	3.13331093908635e-05	0.00088

Top

Translation factor and Age

Differential gene expression between young and old age groups (Wilcoxon test, pval<0.05)

Cancer type	Translation factor	pval	adj.p
LIHC	SEPSECS	0.0102196641089562	0.31
STAD	SEPSECS	0.000508908577701968	0.016
KIRC	SEPSECS	0.037743483874534	1
BRCA	SEPSECS	0.0215956497129977	0.63
ESCA	SEPSECS	0.0495842836687369	1
BLCA	SEPSECS	0.00501693459711171	0.16
SARC	SEPSECS	5.71388440036106e-06	0.00019

Top

Related Drugs

Drugs targeting genes involved in this translation factor.
(DrugBank Version 5.1.8 2021-05-08)

UniProtAcc	DrugBank ID	Drug name	Drug activity	Drug type	Drug status
Q9HD40	DB00114	Pyridoxal phosphate	Cofactor	Small molecule	Approved\|Investigational\|Nutraceutical
Q9HD40	DB00114	Pyridoxal phosphate	Cofactor

Top

Related Diseases

Diseases associated with this translation factor.
(DisGeNet 4.0)

Disease ID	Disease Name	# PubMeds	Disease source
C3151140	PONTOCEREBELLAR HYPOPLASIA, TYPE 2D	5	CTD_human;GENOMICS_ENGLAND;UNIPROT
C0266468	Congenital pontocerebellar hypoplasia	2	GENOMICS_ENGLAND
C2932714	Pontocerebellar Hypoplasia Type 2	1	ORPHANET