|
Translation Factor: RARA (NCBI Gene ID:5914) |
|
Gene Summary |
Gene Information | Gene Name: RARA | Gene ID: 5914 | Gene Symbol | RARA | Gene ID | 5914 |
Gene Name | retinoic acid receptor alpha | |
Synonyms | NR1B1|RAR | |
Cytomap | 17q21.2 | |
Type of Gene | protein-coding | |
Description | retinoic acid receptor alphaRAR-alphanuclear receptor subfamily 1 group B member 1nucleophosmin-retinoic acid receptor alpha fusion protein NPM-RAR long formretinoic acid nuclear receptor alpha variant 1retinoic acid nuclear receptor alpha variant 2 | |
Modification date | 20200327 | |
UniProtAcc | P10276 |
Child GO biological process term(s) under GO:0006412 |
GO ID | GO term |
GO:0017148 | Negative regulation of translation |
GO:0006417 | Regulation of translation |
GO:0006412 | Translation |
Gene ontology of translaction factor with evidence of Inferred from Direct Assay (IDA) from Entrez |
Partner | Gene | GO ID | GO term | PubMed ID |
Hgene | RARA | GO:0007165 | signal transduction | 2825025 |
Hgene | RARA | GO:0030853 | negative regulation of granulocyte differentiation | 19917671 |
Hgene | RARA | GO:0032689 | negative regulation of interferon-gamma production | 18416830 |
Hgene | RARA | GO:0032720 | negative regulation of tumor necrosis factor production | 18416830 |
Hgene | RARA | GO:0032736 | positive regulation of interleukin-13 production | 18416830 |
Hgene | RARA | GO:0032753 | positive regulation of interleukin-4 production | 18416830 |
Hgene | RARA | GO:0032754 | positive regulation of interleukin-5 production | 18416830 |
Hgene | RARA | GO:0045630 | positive regulation of T-helper 2 cell differentiation | 18416830 |
Hgene | RARA | GO:0045892 | negative regulation of transcription, DNA-templated | 20080953 |
Hgene | RARA | GO:0045893 | positive regulation of transcription, DNA-templated | 18845237|19850744|20080953 |
Hgene | RARA | GO:0045944 | positive regulation of transcription by RNA polymerase II | 19850744|21131358 |
Hgene | RARA | GO:0071300 | cellular response to retinoic acid | 19917671 |
Hgene | RARA | GO:0071391 | cellular response to estrogen stimulus | 20080953 |
Inferred gene age of translation factor. |
Gene | Inferred gene age group among (0 - 67.6], (67.6 - 355.7], (355.7 - 733], (733 - 1119.25], >1119.25 |
Top |
|
We searched PubMed using 'RARA[title] AND translation [title] AND human.' |
Gene | Title | PMID |
RARA | . | . |
Top |
|
Skipped exons in TCGA and GTEx based on Ensembl gene isoform structure. * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. For more annotations, please visit our ExonSkipDB. |
Open reading frame (ORF) analsis of exon skipping events based on Ensembl gene isoform structure. * Click on the break point to see the gene structure around the break point region using the UCSC Genome Browser. |
ENST | Exon skip start (DNA) | Exon Skip end (DNA) | ORF |
ENST00000254066 | 38487108 | 38487648 | 5CDS-5UTR |
ENST00000394089 | 38487108 | 38487648 | 5CDS-5UTR |
ENST00000254066 | 38504567 | 38504716 | Frame-shift |
ENST00000394089 | 38504567 | 38504716 | Frame-shift |
Exon skipping position in the amino acid sequence. |
ENST | Exon skip start (DNA) | Exon Skip end (DNA) | Len(transcript seq) | Exon skip start (mRNA) | Exon Skip end (mRNA) | Len(amino acid seq) | Exon skip start (AA) | Exon Skip end (AA) |
Potentially (partially) lost protein functional features of UniProt. |
UniProtAcc | Exon skip start (AA) | Exon Skip end (AA) | Function feature start (AA) | Function feature end (AA) | Functional feature type | Functional feature desc. |
Top |
|
Gene expression level across TCGA pancancer |
Gene expression level across GTEx pantissue |
Expression level of gene isoforms across TCGA pancancer |
Expression level of gene isoforms across GTEx pantissue |
Cancer(tissue) type-specific expression level of Translation factor using z-score distriution |
Differential expression between tumor and matched normal (in the cancer types with more than 10 matched samples) |
Cancer type | Translation factor | FC | adj.pval |
LIHC | RARA | 1.13748187698501 | 0.0180274774396286 |
PRAD | RARA | 1.34219419296503 | 2.33522234893958e-05 |
LUAD | RARA | -2.47510375703787 | 2.71315593655732e-08 |
KICH | RARA | 2.81171799556023 | 8.80360603332519e-05 |
Top |
|
Translation factor expression regulation through miRNA binding |
Cancer type | Gene | miRNA | TargetScan binding score (Context++ score percentile) | Coefficient | Pvalue |
ACC | RARA | hsa-miR-218-5p | 98 | -0.347103213242454 | 0.00182600029771333 |
UCS | RARA | hsa-miR-135b-5p | 93 | -0.321394395078606 | 0.0160854310601084 |
UCS | RARA | hsa-miR-205-5p | 82 | -0.315721120984279 | 0.0181420571550535 |
Translation factor expression regulation through methylation in the promoter of Translation factor |
Cancer type | Gene | methyl group b | methyl group a | DEG pval | avg methyl in b | avg methyl in a | avg exp in b | avg exp in a |
Translation factor expression regulation through methylation in the gene body of Translation factor (positive regulation) |
Cancer type | Gene | methyl group b | methyl group a | DEG pval | avg methyl in b | avg methyl in a | avg exp in b | avg exp in a |
HNSC | RARA | 2 | 1 | 0.0346316420320247 | 0.333868161634103 | 0.172883203125 | -0.518380225576395 | -0.1267179365 |
Translation factor expression regulation through copy number variation of Translation factor |
Cancer type | Gene | Coefficient | Pvalue |
BRCA | RARA | -0.086135549 | 0.004545151 |
TGCT | RARA | -0.065206716 | 0.027489439 |
Top |
|
Strongly correlated genes belong to cellular important gene groups with RARA (coefficient>0.8, pval<0.05, node color based on FC between tumor and matched normal). Significantly associated important genes in the individual cancer types. * Cell metabolism gene: cell metabolism genes from REACTOME (black edge), IUPHAR: drug target genes from IUPHAR (blue edge), Kinase: human kinase genes (brown edge), CGC: cancer gene census genes (orange edge), TSG: tumor suppresor genes (purple edge), Epifactor: epigenetic factors (light blue edge), TF: transcription factors (green) |
Cancer type | Gene group | Translation factor | Correlated gene | Coefficient | Pvalue |
KICH | CGC | RARA | LMNA | 0.804537047 | 7.56E-22 |
KICH | TF | RARA | ARID5A | 0.838159258 | 3.72E-25 |
TGCT | Cell metabolism gene | RARA | F10 | 0.80680449 | 5.05E-37 |
TGCT | Cell metabolism gene | RARA | PDK2 | 0.808715867 | 2.54E-37 |
TGCT | Cell metabolism gene | RARA | PRKD1 | 0.814628775 | 2.89E-38 |
TGCT | Cell metabolism gene | RARA | FMOD | 0.823419795 | 9.85E-40 |
TGCT | Cell metabolism gene | RARA | SMARCD3 | 0.871711127 | 1.44E-49 |
TGCT | CGC | RARA | SPOP | 0.842350687 | 3.44E-43 |
TGCT | Epifactor | RARA | PHC2 | 0.826601803 | 2.77E-40 |
TGCT | Epifactor | RARA | SPOP | 0.842350687 | 3.44E-43 |
TGCT | Epifactor | RARA | SMARCD3 | 0.871711127 | 1.44E-49 |
TGCT | IUPHAR | RARA | F10 | 0.80680449 | 5.05E-37 |
TGCT | IUPHAR | RARA | DDAH2 | 0.807484289 | 3.96E-37 |
TGCT | IUPHAR | RARA | PDK2 | 0.808715867 | 2.54E-37 |
TGCT | IUPHAR | RARA | CPZ | 0.812243961 | 7.01E-38 |
TGCT | IUPHAR | RARA | PRKD1 | 0.814628775 | 2.89E-38 |
TGCT | IUPHAR | RARA | IL11RA | 0.815315843 | 2.23E-38 |
TGCT | IUPHAR | RARA | GHR | 0.822980865 | 1.17E-39 |
TGCT | Kinase | RARA | PDK2 | 0.808715867 | 2.54E-37 |
TGCT | Kinase | RARA | PRKD1 | 0.814628775 | 2.89E-38 |
TGCT | TF | RARA | MEIS1 | 0.817263428 | 1.07E-38 |
TGCT | TF | RARA | ZBTB47 | 0.831578874 | 3.60E-41 |
TGCT | TSG | RARA | SPOP | 0.842350687 | 3.44E-43 |
TGCT | TSG | RARA | NDRG2 | 0.842496657 | 3.22E-43 |
Top |
|
Protein 3D structure Visit iCn3D. |
Top |
|
Protein-protein interaction networks * Overlap between up-regulated DEGs (log2FC<-1 and adj.P<0.05) and STRING PPI network (center: Translation factor, node: DEGs, edges: weighted by -log2(adj.P)) |
Overlap between down-regulated DEGs (log2FC>1 and adj.P<0.05) and STRING PPI network (center: Translation factor, node: DEGs, edges: weighted by -log2(adj.P)) |
* Edge colors based on TCGA cancer types. |
* Overlap between DEGs (log2FC>1 and adj.P<0.05) and STRING PPI network per cancer (center: Translation factor, node: DEGs, node color: log2FC, edges: weighted by -log2(adj.P)) |
Cancer type | Translation factor | Interacting protein coding gene | FC | adj.pval |
STAD | RARA | NCOR2 | 1.33883515600974 | 0.000133869703859091 |
LIHC | RARA | RXRB | -3.41865186450969 | 0.000201991820198738 |
LUSC | RARA | NCOA1 | -1.9753943184964 | 0.000251881966259792 |
COAD | RARA | PML | -1.42773390537814 | 0.00028228759765625 |
STAD | RARA | NCOA1 | -1.51648746101119 | 0.000394813584722933 |
STAD | RARA | RXRA | -2.26359423205792 | 0.00133262807503343 |
BRCA | RARA | NCOA3 | 1.28478455677002 | 0.00280496871821729 |
LUSC | RARA | NCOR1 | -5.66830212737562 | 0.00339826502432084 |
CHOL | RARA | NCOR2 | -6.56543632349982 | 0.00390625 |
CHOL | RARA | PML | -2.8303429721064 | 0.00390625 |
LUAD | RARA | NCOR2 | -1.17884595496404 | 0.00627510264512955 |
STAD | RARA | PML | 1.11096265710256 | 0.00879816571250558 |
LUAD | RARA | NCOA3 | 1.46493869373337 | 0.00907618026044385 |
BLCA | RARA | NCOA3 | 1.61306211717493 | 0.0108261108398438 |
LUSC | RARA | NCOA3 | 1.30984143728679 | 0.0112279623107666 |
THCA | RARA | NCOR1 | -2.23607860124535 | 0.0143126941356972 |
KICH | RARA | NCOA3 | -2.64018815864966 | 0.0147220492362976 |
CHOL | RARA | NCOA3 | -2.60421993730511 | 0.01953125 |
BLCA | RARA | NCOR2 | 1.29630073916838 | 0.0229873657226562 |
LUAD | RARA | NCOR1 | -4.5432022154879 | 0.0232982643302131 |
KICH | RARA | NCOA1 | -2.41215844059557 | 0.0236499309539795 |
CHOL | RARA | RXRG | 1.94121467442801 | 0.0390625 |
COAD | RARA | NCOA3 | -2.47913041207233 | 0.0463311672210694 |
LUSC | RARA | RXRB | 1.15588083356984 | 0.047424622014057 |
HNSC | RARA | NCOA2 | -1.27957339544492 | 0.0497394773084908 |
HNSC | RARA | PML | 1.9717462727518 | 1.07480439055508e-05 |
THCA | RARA | NCOA1 | 1.27209246249683 | 1.09911109570944e-05 |
KIRC | RARA | NCOA1 | -1.69189826474347 | 2.99328726847022e-10 |
HNSC | RARA | NCOA3 | 1.89098442725377 | 3.84812503853028e-05 |
THCA | RARA | RXRA | -1.62554508939589 | 4.0132266032018e-09 |
KIRP | RARA | RXRG | 1.22336088149455 | 4.20957803726197e-07 |
PRAD | RARA | NRIP1 | 1.9306455964487 | 5.16517456395129e-05 |
HNSC | RARA | RXRB | 1.82489918701145 | 5.97184352955084e-05 |
THCA | RARA | RXRG | 2.69954829028774 | 6.78994241272255e-11 |
COAD | RARA | NCOR1 | -2.29343025369613 | 7.02440738677979e-05 |
KIRC | RARA | NCOR2 | -1.71674966024156 | 9.2516163152192e-11 |
Protein-protein interactors with this translation factor (BIOGRID-3.4.160) |
PPI interactors with RARA |
NRBF2, ZBTB16, MECR, RXRG, RXRB, NCOA6, GADD45G, GADD45A, Gadd45b, NRIP1, KAT2B, HDAC3, HDAC4, TDG, Nsd1, PML, TRIP4, KDM5A, RXRA, POU2F1, NCOR2, NR0B2, Nr0b2, BAG1, TADA3, NCOR1, NKX2-1, TRIM24, IRX4, SP1, NPAS2, CLOCK, ARNTL, NR2E3, CCND3, NCOA2, SRC, AJUBA, LIMD1, WTIP, SKI, HR, PIN1, SUV39H1, PSMC5, EP300, PARP1, MED6, TOP2B, SAP130, HNRNPU, RFC4, NPM1, MRTO4, SNRNP40, MED1, NCOA1, HMGA1, RUVBL1, RUNX1, SIAH1, RARA, HDAC2, NCOA3, CREBBP, LRIF1, KLF5, SMARCD3, ARID1A, SPI1, Pdia3, PRDX6, NR1H2, ITGB1BP2, MED25, MAPK6, FOXO1, MAPK1, TRIM32, PHF8, TNIP1, HACE1, SQSTM1, UBQLN1, ARID5A, UBE3A, PRAM1, FAS, PRAME, TBL1XR1, SUZ12, EZH2, USP7, TMEM54, MMS19, AKT1, FN1, WWOX, E2F1, MBD3, MTA2, CBX5, CEBPA, HDAC1, NSD1, TEKT4, SNW1, SIRT1, ACTN4, SRF, MDM2, ZNF131, RARG, RARB, TRIM25, FGFR1, Nr4a1, TRIB3, HSPA9, PIK3R1, PIK3CG, DSG4, FABP5, HSPA8, HSPB1, ATP8B2, PKP3, S100A3, SELENBP1, RPS27A, CEP83, H2AFY2, H1F0, HIST1H2AC, HIST2H2AB, H2AFV, HIST1H2BC, HIST3H3, RSL1D1, GTF2I, HNRNPK, KHDRBS1, LRRC15, PSPC1, RBM3, SNRNP70, HIST1H2AA, HNRNPA0, NR2C1, PPARG, BBS4, CCNDBP1, PLEKHF2, ALOX15B, ALX1, MCRS1, VCP, E7, TRIM37, |
Top |
|
Clinically associated variants from ClinVar. |
Gene | Chr | Position | RefSeq | VarSeq | RefSeeq | VarType | Pathogenic | Disease | VarInfo |
RARA | chr17 | 38487542 | C | T | single_nucleotide_variant | Likely_benign | not_provided | SO:0001819|synonymous_variant | SO:0001819|synonymous_variant |
RARA | chr17 | 38506186 | C | T | single_nucleotide_variant | Benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
RARA | chr17 | 38508235 | G | A | single_nucleotide_variant | Likely_benign | not_provided | SO:0001819|synonymous_variant | SO:0001819|synonymous_variant |
RARA | chr17 | 38510572 | C | T | single_nucleotide_variant | Uncertain_significance,_drug_response | Tretinoin_response|not_provided | SO:0001583|missense_variant | SO:0001583|missense_variant |
RARA | chr17 | 38510573 | G | A | single_nucleotide_variant | Likely_pathogenic | Inborn_genetic_diseases | SO:0001583|missense_variant | SO:0001583|missense_variant |
RARA | chr17 | 38510583 | C | T | single_nucleotide_variant | Benign | not_provided | SO:0001819|synonymous_variant | SO:0001819|synonymous_variant |
RARA | chr17 | 38511509 | C | T | single_nucleotide_variant | Benign | not_provided | SO:0001627|intron_variant | SO:0001627|intron_variant |
RARA | chr17 | 38512313 | TCTCATCCAGGAAATGTTGGAGAACTCAGAGGGCCTGGACACTCTGAGCGGACAGCCGGGGGGTGGGGGGCGGGACGGGGGTGGCCTGGCCCCCCCGCCAGGCAGCTGTAGCCCCAGCCTCAGCCCCAGCTCCAACAGAAGCAGCCCGGCCACCCACTCCCCGTGA | T | Deletion | drug_response | Tretinoin_response | SO:0001578|stop_lost | SO:0001578|stop_lost |
RARA | chr17 | 38512388 | C | T | single_nucleotide_variant | Likely_benign | not_provided | SO:0001819|synonymous_variant | SO:0001819|synonymous_variant |
nsSNVs with sample frequency (size of circle) from TCGA 33 cancers. |
SNVs and Indels |
Gene | Cancer type | Chromosome | Start | End | RefSeeq | MutSeq | Mutation type | AAchange | # samples |
RARA | KIRC | chr17 | 38506145 | 38506145 | A | G | Missense_Mutation | p.Q146R | 5 |
RARA | BLCA | chr17 | 38510626 | 38510626 | C | T | Missense_Mutation | p.R294W | 3 |
RARA | BLCA | chr17 | 38510642 | 38510642 | A | G | Missense_Mutation | p.N299S | 3 |
RARA | BRCA | chr17 | 38510603 | 38510603 | T | C | Missense_Mutation | p.F286S | 3 |
RARA | BRCA | chr17 | 38508182 | 38508184 | AAG | - | In_Frame_Del | p.K167in_frame_del | 3 |
RARA | STAD | chr17 | 38506076 | 38506076 | C | T | Missense_Mutation | p.T123M | 3 |
RARA | CESC | chr17 | 38508602 | 38508602 | G | A | Missense_Mutation | 3 | |
RARA | HNSC | chr17 | 38487504 | 38487504 | G | T | Missense_Mutation | p.G12W | 2 |
RARA | BLCA | chr17 | 38512341 | 38512341 | G | A | Missense_Mutation | p.E418K | 2 |
RARA | STAD | chr17 | 38511645 | 38511645 | T | C | Silent | 2 | |
RARA | LUAD | chr17 | 38510598 | 38510598 | G | A | Missense_Mutation | p.M284I | 2 |
RARA | STAD | chr17 | 38511645 | 38511645 | T | C | Silent | p.I381I | 2 |
RARA | SKCM | chr17 | 38498981 | 38498981 | G | A | Missense_Mutation | p.G9S | 2 |
RARA | STAD | chr17 | 38508602 | 38508602 | G | C | Missense_Mutation | p.R217P | 2 |
RARA | BLCA | chr17 | 38498963 | 38498963 | G | C | Missense_Mutation | p.E3Q | 2 |
RARA | SKCM | chr17 | 38487555 | 38487555 | C | T | Missense_Mutation | p.P29S | 2 |
RARA | UCEC | chr17 | 38506177 | 38506177 | T | C | Missense_Mutation | p.S157P | 2 |
RARA | BRCA | chr17 | 38508726 | 38508726 | C | T | Silent | p.I258 | 2 |
RARA | HNSC | chr17 | 38508182 | 38508184 | AAG | - | In_Frame_Del | p.K167del | 2 |
RARA | STAD | chr17 | 38487554 | 38487554 | C | - | Frame_Shift_Del | p.F28fs | 2 |
RARA | ESCA | chr17 | 38508238 | 38508238 | G | A | Silent | 2 | |
RARA | ESCA | chr17 | 38508238 | 38508238 | G | A | Silent | p.P182P | 2 |
RARA | LUAD | chr17 | 38487528 | 38487528 | C | T | Missense_Mutation | p.P20S | 2 |
RARA | CHOL | chr17 | 38510560 | 38510560 | C | T | Missense_Mutation | 2 | |
RARA | SARC | chr17 | 38511541 | 38511541 | C | T | Missense_Mutation | p.R347W | 2 |
RARA | CHOL | chr17 | 38510560 | 38510560 | C | T | Missense_Mutation | p.R272W | 2 |
RARA | HNSC | chr17 | 38510721 | 38510721 | G | C | Missense_Mutation | 1 | |
RARA | LUAD | chr17 | 38510602 | 38510603 | TT | AC | Missense_Mutation | p.F286T | 1 |
RARA | SKCM | chr17 | 38508593 | 38508593 | C | T | Missense_Mutation | p.S214L | 1 |
RARA | TGCT | chr17 | 38512394 | 38512394 | T | G | Silent | p.G435G | 1 |
RARA | KIRC | chr17 | 38510748 | 38510748 | C | T | Silent | p.L334L | 1 |
RARA | SKCM | chr17 | 38512373 | 38512373 | G | C | Silent | p.G331G | 1 |
RARA | COAD | chr17 | 38487587 | 38487587 | C | T | Silent | p.G39G | 1 |
RARA | LIHC | chr17 | 38504606 | 38504606 | C | - | Frame_Shift_Del | p.P73fs | 1 |
RARA | LUSC | chr17 | 38510742 | 38510742 | C | T | Silent | p.I332I | 1 |
RARA | STAD | chr17 | 38506076 | 38506076 | C | T | Missense_Mutation | 1 | |
RARA | LUSC | chr17 | 38504711 | 38504711 | T | A | Missense_Mutation | p.C108S | 1 |
RARA | THCA | chr17 | 38508725 | 38508726 | - | - | Frame_Shift_Ins | 1 | |
RARA | SKCM | chr17 | 38508593 | 38508593 | C | T | Missense_Mutation | p.S117L | 1 |
RARA | COAD | chr17 | 38498977 | 38498977 | G | - | Frame_Shift_Del | p.V7fs | 1 |
RARA | LIHC | chr17 | 38504615 | 38504615 | C | - | Frame_Shift_Del | p.P76fs | 1 |
RARA | HNSC | chr17 | 38511548 | 38511548 | A | G | Missense_Mutation | p.D349G | 1 |
RARA | MESO | chr17 | 38510722 | 38510722 | A | T | Missense_Mutation | 1 | |
RARA | THCA | chr17 | 38508725 | 38508726 | - | A | Frame_Shift_Ins | p.I258fs | 1 |
RARA | KIRC | chr17 | 38508302 | 38508302 | C | A | Missense_Mutation | p.Q204K | 1 |
RARA | COAD | chr17 | 38504623 | 38504624 | - | C | Frame_Shift_Ins | p.P78fs | 1 |
RARA | SKCM | chr17 | 38508701 | 38508701 | C | T | Missense_Mutation | p.T153I | 1 |
RARA | HNSC | chr17 | 38512358 | 38512358 | G | A | Silent | p.L423L | 1 |
RARA | MESO | chr17 | 38504635 | 38504635 | C | A | Silent | 1 | |
RARA | THCA | chr17 | 38508725 | 38508726 | - | A | Frame_Shift_Ins | p.N258fs | 1 |
RARA | BLCA | chr17 | 38499089 | 38499089 | C | T | Missense_Mutation | p.R45W | 1 |
RARA | KIRC | chr17 | 38508596 | 38508596 | A | G | Missense_Mutation | p.E215G | 1 |
RARA | COAD | chr17 | 38510560 | 38510560 | C | T | Missense_Mutation | p.R175W | 1 |
RARA | LUAD | chr17 | 38487490 | 38487490 | C | T | Missense_Mutation | p.S7F | 1 |
RARA | BLCA | chr17 | 38508601 | 38508601 | C | T | Missense_Mutation | 1 | |
RARA | HNSC | chr17 | 38510721 | 38510721 | G | C | Missense_Mutation | p.E325D | 1 |
RARA | MESO | chr17 | 38510722 | 38510722 | A | T | Missense_Mutation | p.T326S | 1 |
RARA | THYM | chr17 | 38506115 | 38506115 | C | T | Missense_Mutation | 1 | |
RARA | LIHC | chr17 | 38510578 | 38510578 | A | G | Missense_Mutation | 1 | |
RARA | COAD | chr17 | 38510698 | 38510698 | C | T | Missense_Mutation | p.P221S | 1 |
RARA | LUAD | chr17 | 38487575 | 38487575 | C | G | Silent | p.L35L | 1 |
RARA | BLCA | chr17 | 38510626 | 38510626 | C | T | Missense_Mutation | 1 | |
RARA | HNSC | chr17 | 38508322 | 38508322 | G | A | Splice_Site | p.T210_splice | 1 |
RARA | STAD | chr17 | 38499018 | 38499018 | A | G | Missense_Mutation | p.Y21C | 1 |
RARA | OV | chr17 | 38511642 | 38511642 | G | C | Missense_Mutation | p.K380N | 1 |
RARA | LIHC | chr17 | 38512266 | 38512266 | G | A | Missense_Mutation | 1 | |
RARA | COAD | chr17 | 38511518 | 38511518 | G | A | Missense_Mutation | p.R242H | 1 |
RARA | LUAD | chr17 | 38506137 | 38506137 | C | T | Silent | p.C143C | 1 |
RARA | SKCM | chr17 | 38508718 | 38508718 | G | A | Missense_Mutation | p.D159N | 1 |
RARA | STAD | chr17 | 38499007 | 38499007 | G | T | Silent | p.V17V | 1 |
RARA | BLCA | chr17 | 38510642 | 38510642 | A | G | Missense_Mutation | 1 | |
RARA | PRAD | chr17 | 38508633 | 38508633 | G | T | Missense_Mutation | p.K227N | 1 |
RARA | LIHC | chr17 | 38508601 | 38508601 | C | A | Missense_Mutation | p.R217S | 1 |
RARA | ESCA | chr17 | 38508238 | 38508238 | G | A | Silent | p.P182 | 1 |
RARA | LUAD | chr17 | 38510602 | 38510602 | T | A | Missense_Mutation | p.F286I | 1 |
RARA | SKCM | chr17 | 38512295 | 38512295 | C | T | Silent | p.I402I | 1 |
RARA | BLCA | chr17 | 38499089 | 38499089 | C | T | Missense_Mutation | 1 | |
RARA | HNSC | chr17 | 38508322 | 38508322 | G | A | Silent | p.T210T | 1 |
RARA | READ | chr17 | 38508267 | 38508267 | G | A | Missense_Mutation | p.R95H | 1 |
RARA | LIHC | chr17 | 38512266 | 38512266 | G | A | Missense_Mutation | p.E393K | 1 |
RARA | LUAD | chr17 | 38508718 | 38508718 | G | T | Missense_Mutation | p.D256Y | 1 |
RARA | SKCM | chr17 | 38512373 | 38512373 | G | C | Silent | p.G428G | 1 |
RARA | BLCA | chr17 | 38498963 | 38498963 | G | C | Missense_Mutation | 1 | |
RARA | KICH | chr17 | 38512460 | 38512460 | G | T | Silent | 1 | |
RARA | SARC | chr17 | 38508222 | 38508222 | G | T | Missense_Mutation | 1 | |
RARA | LIHC | chr17 | 38510697 | 38510698 | - | C | Frame_Shift_Ins | p.LP317fs | 1 |
RARA | SKCM | chr17 | 38508718 | 38508718 | G | A | Missense_Mutation | p.D256N | 1 |
RARA | STAD | chr17 | 38506123 | 38506123 | C | A | Missense_Mutation | p.R139S | 1 |
RARA | BLCA | chr17 | 38508647 | 38508647 | C | A | Missense_Mutation | 1 | |
RARA | KICH | chr17 | 38512460 | 38512460 | G | T | Silent | p.P360P | 1 |
RARA | SARC | chr17 | 38511541 | 38511541 | C | T | Missense_Mutation | 1 | |
RARA | LIHC | chr17 | 38511612 | 38511612 | C | - | Frame_Shift_Del | p.R370fs | 1 |
RARA | HNSC | chr17 | 38487504 | 38487504 | G | T | Missense_Mutation | 1 | |
RARA | LUAD | chr17 | 38510648 | 38510648 | G | T | Missense_Mutation | p.G301V | 1 |
RARA | SKCM | chr17 | 38508701 | 38508701 | C | T | Missense_Mutation | p.T250I | 1 |
RARA | STAD | chr17 | 38510653 | 38510653 | G | A | Missense_Mutation | p.G303S | 1 |
RARA | BLCA | chr17 | 38508601 | 38508601 | C | T | Missense_Mutation | p.R217C | 1 |
RARA | KICH | chr17 | 38512460 | 38512460 | G | T | Silent | p.P457P | 1 |
RARA | LIHC | chr17 | 38512331 | 38512331 | G | - | Frame_Shift_Del | p.L414fs | 1 |
Copy number variation (CNV) of RARA * Click on the image to open the original image in a new window. |
Fusion gene breakpoints (product of the structural variants (SVs)) across RARA * Click on the image to open the UCSC genome browser with custom track showing this image in a new window. |
Fusion genes with this translation factor from FusionGDB2.0. |
FusionGDB2 ID | Disease | Sample | Hgene | Hchr | Hbp | Hstrand | Tgene | Tchr | Tbp | Tstrand |
100461 | STAD | TCGA-BR-8483 | ACACA | chr17 | 35696763 | - | RARA | chr17 | 38487108 | + |
100461 | STAD | TCGA-BR-8483-01A | ACACA | chr17 | 35687113 | - | RARA | chr17 | 38487109 | + |
100461 | STAD | TCGA-BR-8680 | ACACA | chr17 | 35687112 | - | RARA | chr17 | 38487108 | + |
100461 | READ | TCGA-AG-3581 | ATP6V0A1 | chr17 | 40642655 | + | RARA | chr17 | 38487108 | + |
100461 | READ | TCGA-AG-3581 | ATP6V0A1 | chr17 | 40642655 | + | RARA | chr17 | 38487109 | + |
100461 | acute myeloid leukemia | HM597846 | BCOR | chrX | 39937182 | RARA | chr17 | 38504566 | ||
100461 | . | . | BCOR | chrX | 39914766 | - | RARA | chr17 | 39914766 | + |
100461 | N/A | HM597846 | BCOR | chrX | 39914621 | - | RARA | chr17 | 38504566 | + |
100461 | Non-Cancer | ERR315486 | CXCR4 | chr2 | 136875616 | - | RARA | chr17 | 38504568 | + |
100461 | . | . | FIP1L1 | chr4 | 54310214 | + | RARA | chr17 | 54310214 | + |
100461 | . | . | GTF2I | chr7 | 74114935 | + | RARA | chr17 | 74114935 | + |
100461 | N/A | KP100665 | GTF2I | chr7 | 74114964 | + | RARA | chr17 | 38504565 | + |
100461 | N/A | BE794377 | H2AFV | chr7 | 44880525 | - | RARA | chr17 | 38506148 | + |
100461 | COAD | TCGA-AY-4070-01A | IKZF3 | chr17 | 37944511 | - | RARA | chr17 | 38487109 | + |
100461 | . | . | IRF2BP2 | chr1 | 234743598 | - | RARA | chr17 | 234743598 | + |
100461 | . | . | IRF2BP2 | chr1 | 234745271 | - | RARA | chr17 | 234745271 | + |
100461 | STAD | TCGA-FP-8210-01A | JHDM1D | chr7 | 139876544 | - | RARA | chr17 | 38504568 | + |
100461 | OV | TCGA-29-2428 | MUC16 | chr19 | 9045563 | - | RARA | chr17 | 38487108 | + |
100461 | OV | TCGA-29-2428-01A | MUC16 | chr19 | 9045564 | - | RARA | chr17 | 38487109 | + |
100461 | CESC | TCGA-VS-A8EJ-01A | MYO18A | chr17 | 27507331 | - | RARA | chr17 | 38504568 | + |
100461 | . | . | NABP1 | chr2 | 192548955 | + | RARA | chr17 | 192548955 | + |
100461 | acute non lymphocytic leukemia | U41743 | NPM1 | chr5 | 170818803 | RARA | chr17 | 38504565 | ||
100461 | . | . | NPM1 | chr5 | 170818803 | + | RARA | chr17 | 38504567 | + |
100461 | N/A | U41743 | NPM1 | chr5 | 170818803 | + | RARA | chr17 | 38504565 | + |
100461 | acute promyelocytic leukemia | AF012304 | NUMA1 | chr11 | 71717270 | RARA | chr17 | 38504544 | ||
100461 | . | . | NUMA1 | chr11 | 71717080 | - | RARA | chr17 | 38504567 | + |
100461 | N/A | AF012304 | NUMA1 | chr11 | 71717081 | - | RARA | chr17 | 38504544 | + |
100461 | acute promyelocytic leukemia | AB067754 | PML | chr15 | 74325609 | RARA | chr17 | 38503513 | ||
100461 | LAML | TCGA-AB-2803-03A | PML | chr15 | 74325755 | + | RARA | chr17 | 38504568 | + |
100461 | LAML | TCGA-AB-2803-03A | PML | chr15 | 74326174 | + | RARA | chr17 | 38494414 | + |
100461 | LAML | TCGA-AB-2823-03A | PML | chr15 | 74315748 | + | RARA | chr17 | 38499047 | + |
100461 | LAML | TCGA-AB-2823-03A | PML | chr15 | 74315748 | + | RARA | chr17 | 38504567 | + |
100461 | LAML | TCGA-AB-2823-03A | PML | chr15 | 74315749 | + | RARA | chr17 | 38504568 | + |
100461 | LAML | TCGA-AB-2841-03B | PML | chr15 | 74317268 | + | RARA | chr17 | 38504568 | + |
100461 | LAML | TCGA-AB-2862 | PML | chr15 | 74325755 | + | RARA | chr17 | 38504567 | + |
100461 | LAML | TCGA-AB-2862-03A | PML | chr15 | 74325754 | + | RARA | chr17 | 38504567 | + |
100461 | LAML | TCGA-AB-2862-03A | PML | chr15 | 74325762 | + | RARA | chr17 | 38504567 | + |
100461 | LAML | TCGA-AB-2862-03A | PML | chr15 | 74326513 | + | RARA | chr17 | 38502175 | + |
100461 | LAML | TCGA-AB-2872-03A | PML | chr15 | 74325947 | + | RARA | chr17 | 38492306 | + |
100461 | LAML | TCGA-AB-2897-03A | PML | chr15 | 74317267 | + | RARA | chr17 | 38504567 | + |
100461 | LAML | TCGA-AB-2897-03A | PML | chr15 | 74325861 | + | RARA | chr17 | 38495607 | + |
100461 | LAML | TCGA-AB-2982-03B | PML | chr15 | 74326442 | + | RARA | chr17 | 38496872 | + |
100461 | LAML | TCGA-AB-2994-03A | PML | chr15 | 74326459 | + | RARA | chr17 | 38498831 | + |
100461 | LAML | TCGA-AB-2999_61YB3AAXX_4 | PML | chr15 | 74325056 | + | RARA | chr17 | 38504568 | + |
100461 | LAML | TCGA-AB-3001-03A | PML | chr15 | 74315748 | + | RARA | chr17 | 38499005 | + |
100461 | LAML | TCGA-AB-3001-03A | PML | chr15 | 74315749 | + | RARA | chr17 | 38499006 | + |
100461 | LAML | TCGA-AB-3007 | PML | chr15 | 74315749 | + | RARA | chr17 | 38504567 | + |
100461 | . | . | PML | chr15 | 74326146 | + | RARA | chr17 | 38504568 | + |
100461 | . | . | PML | chr15 | 74326417 | + | RARA | chr17 | 38504568 | + |
100461 | . | . | PML | chr15 | 74326871 | + | RARA | chr17 | 38504567 | + |
100461 | . | . | PML | chr15 | 74326146 | + | RARA | chr17 | 38504568 | + |
100461 | N/A | AB067754 | PML | chr15 | 74325609 | + | RARA | chr17 | 38503513 | + |
100461 | N/A | AJ417079 | PML | chr15 | 74325616 | + | RARA | chr17 | 38499056 | + |
100461 | N/A | EF535849 | PML | chr15 | 74317268 | + | RARA | chr17 | 38504567 | + |
100461 | N/A | M61110 | PML | chr15 | 74326417 | + | RARA | chr17 | 38504195 | + |
100461 | N/A | M73779 | PML | chr15 | 74315749 | + | RARA | chr17 | 38504566 | + |
100461 | N/A | S50916 | PML | chr15 | 74325755 | + | RARA | chr17 | 38504566 | + |
100461 | N/A | S57796 | PML | chr15 | 74326821 | + | RARA | chr17 | 38503921 | + |
100461 | N/A | S76373 | PML | chr15 | 74326146 | + | RARA | chr17 | 38504542 | + |
100461 | N/A | S76375 | PML | chr15 | 74326245 | + | RARA | chr17 | 38503275 | + |
100461 | N/A | S76382 | PML | chr15 | 74326354 | + | RARA | chr17 | 38504168 | + |
100461 | N/A | S76389 | PML | chr15 | 74326417 | + | RARA | chr17 | 38502790 | + |
100461 | N/A | S76402 | PML | chr15 | 74326633 | + | RARA | chr17 | 38502991 | + |
100461 | acute promyelocytic leukemia | EF428110 | PRKAR1A | chr17 | 66518996 | RARA | chr17 | 38504566 | ||
100461 | . | . | PRKAR1A | chr17 | 64023312 | + | RARA | chr17 | 35758091 | + |
100461 | . | . | PRKAR1A | chr17 | 64030591 | + | RARA | chr17 | 35758091 | + |
100461 | N/A | EF428110 | PRKAR1A | chr17 | 66518996 | + | RARA | chr17 | 38504566 | + |
100461 | N/A | EF428111 | PRKAR1A | chr17 | 66511717 | + | RARA | chr17 | 38504566 | + |
98429 | BRCA | TCGA-E9-A22D-01A | RARA | chr17 | 38474699 | + | ANKFN1 | chr17 | 54367287 | - |
102079 | N/A | BU154393 | RARA | chr17 | 38487646 | + | BRD4 | chr19 | 15367035 | - |
100106 | BRCA | TCGA-AN-A046 | RARA | chr17 | 38487648 | + | C16orf45 | chr16 | 15609161 | + |
102776 | BRCA | TCGA-A8-A0A7-01A | RARA | chr17 | 38474700 | + | CA10 | chr17 | 50149753 | - |
99263 | BRCA | TCGA-AR-A254-01A | RARA | chr17 | 38487648 | + | CDC6 | chr17 | 38450202 | + |
99263 | BRCA | TCGA-AR-A254-01A | RARA | chr17 | 38499119 | + | CDC6 | chr17 | 38450202 | + |
99263 | LUAD | TCGA-95-7948-01A | RARA | chr17 | 38465538 | + | CDC6 | chr17 | 38457080 | + |
99264 | BRCA | TCGA-A2-A04W | RARA | chr17 | 38465538 | + | CDK12 | chr17 | 37646809 | + |
99264 | BRCA | TCGA-A2-A04W | RARA | chr17 | 38474700 | + | CDK12 | chr17 | 37646809 | + |
99264 | BRCA | TCGA-A2-A04W-01A | RARA | chr17 | 38465538 | + | CDK12 | chr17 | 37646810 | + |
99264 | BRCA | TCGA-A2-A04W-01A | RARA | chr17 | 38474700 | + | CDK12 | chr17 | 37646810 | + |
99264 | BRCA | TCGA-AC-A2FB-01A | RARA | chr17 | 38474700 | + | CDK12 | chr17 | 37700502 | + |
99264 | OV | TCGA-3P-A9WA | RARA | chr17 | 38504716 | + | CDK12 | chr17 | 37686856 | + |
99264 | OV | TCGA-3P-A9WA | RARA | chr17 | 38504716 | + | CDK12 | chr17 | 37686883 | + |
99264 | OV | TCGA-3P-A9WA-01A | RARA | chr17 | 38504716 | + | CDK12 | chr17 | 37686857 | + |
99264 | OV | TCGA-3P-A9WA-01A | RARA | chr17 | 38504716 | + | CDK12 | chr17 | 37686884 | + |
99264 | OV | TCGA-3P-A9WA-01A | RARA | chr17 | 38504716 | + | CDK12 | chr17 | 37700502 | + |
102358 | UCEC | TCGA-2E-A9G8 | RARA | chr17 | 38465538 | + | CERS4 | chr19 | 8315960 | + |
102358 | UCEC | TCGA-2E-A9G8 | RARA | chr17 | 38474700 | + | CERS4 | chr19 | 8315928 | + |
102358 | UCEC | TCGA-2E-A9G8 | RARA | chr17 | 38474700 | + | CERS4 | chr19 | 8319383 | + |
102358 | UCEC | TCGA-2E-A9G8-01A | RARA | chr17 | 38474700 | + | CERS4 | chr19 | 8315960 | + |
72327 | BRCA | TCGA-EW-A6S9-01A | RARA | chr17 | 38487648 | + | COL10A1 | chr6 | 116446670 | - |
99033 | STAD | TCGA-RD-A7BT | RARA | chr17 | 38487648 | + | DAZAP1 | chr19 | 1417498 | + |
82052 | BRCA | TCGA-AO-A12D-01A | RARA | chr17 | 38508759 | - | HOXB3 | chr17 | 46632980 | - |
82052 | BRCA | TCGA-AO-A12D-01A | RARA | chr17 | 38510568 | + | HOXB3 | chr17 | 46643200 | + |
96400 | BRCA | TCGA-B6-A1KN-01A | RARA | chr17 | 38487648 | + | IGFBP4 | chr17 | 38609237 | + |
102716 | STAD | TCGA-CG-5724-01A | RARA | chr17 | 38487648 | + | IMMP2L | chr7 | 111201979 | - |
99272 | STAD | TCGA-EQ-8122 | RARA | chr17 | 38465538 | + | JUP | chr17 | 39923832 | - |
99272 | STAD | TCGA-RD-A7BT | RARA | chr17 | 38487648 | + | JUP | chr17 | 39928114 | - |
72327 | STAD | TCGA-RD-A7BT | RARA | chr17 | 38487648 | + | LEPREL4 | chr17 | 39967536 | - |
72327 | BRCA | TCGA-C8-A8HP-01A | RARA | chr17 | 38465538 | + | LGALS16 | chr19 | 40148468 | + |
72327 | BRCA | TCGA-C8-A8HP-01A | RARA | chr17 | 38465538 | - | LGALS16 | chr19 | 40148523 | + |
100815 | UCEC | TCGA-AJ-A3QS-01A | RARA | chr17 | 38474700 | + | LTBP1 | chr2 | 33447147 | + |
100822 | STAD | TCGA-RD-A7BT-01A | RARA | chr17 | 38487648 | + | LYRM9 | chr17 | 26207392 | - |
100822 | STAD | TCGA-RD-A7BT-01A | RARA | chr17 | 38487648 | + | LYRM9 | chr17 | 26209738 | - |
100822 | STAD | TCGA-RD-A7BT-01A | RARA | chr17 | 38499119 | + | LYRM9 | chr17 | 26209738 | - |
99278 | BRCA | TCGA-AR-A254 | RARA | chr17 | 38487648 | + | MSL1 | chr17 | 38282435 | + |
99278 | BRCA | TCGA-AR-A254-01A | RARA | chr17 | 38487647 | + | MSL1 | chr17 | 38282435 | + |
99278 | BRCA | TCGA-AR-A254-01A | RARA | chr17 | 38487648 | + | MSL1 | chr17 | 38282436 | + |
100670 | BRCA | TCGA-A8-A09I-01A | RARA | chr17 | 38487647 | + | MYO1D | chr17 | 31107801 | - |
100670 | BRCA | TCGA-A8-A09I-01A | RARA | chr17 | 38487648 | + | MYO1D | chr17 | 31107802 | - |
100670 | BRCA | TCGA-A8-A09I-01A | RARA | chr17 | 38487648 | + | MYO1D | chr17 | 31113810 | - |
90848 | BRCA | TCGA-A1-A0SM-01A | RARA | chr17 | 38487648 | + | NARS2 | chr11 | 78282489 | - |
97362 | BRCA | TCGA-A2-A0D4-01A | RARA | chr17 | 38474700 | + | PCTP | chr17 | 53848467 | + |
97362 | BRCA | TCGA-AN-A0FV | RARA | chr17 | 38465538 | + | PCTP | chr17 | 53848466 | + |
97362 | BRCA | TCGA-AN-A0FV | RARA | chr17 | 38474700 | + | PCTP | chr17 | 53848466 | + |
97362 | BRCA | TCGA-AN-A0FV-01A | RARA | chr17 | 38465537 | + | PCTP | chr17 | 53848466 | + |
97362 | BRCA | TCGA-AN-A0FV-01A | RARA | chr17 | 38465538 | + | PCTP | chr17 | 53848467 | + |
97362 | BRCA | TCGA-AN-A0FV-01A | RARA | chr17 | 38474699 | + | PCTP | chr17 | 53848466 | + |
99077 | BRCA | TCGA-A8-A08B-01A | RARA | chr17 | 38474700 | + | PGAP3 | chr17 | 37842272 | - |
99077 | BRCA | TCGA-A8-A08B-01A | RARA | chr17 | 38474700 | - | PGAP3 | chr17 | 37830932 | - |
97894 | N/A | XX000008 | RARA | chr17 | 38465538 | + | PKIA | chr8 | 79485043 | + |
86231 | UCEC | TCGA-A5-A7WK-01A | RARA | chr17 | 38487648 | + | PLEKHA6 | chr1 | 204243937 | - |
72327 | LAML | TCGA-AB-2840_61GAFAAXX_2 | RARA | chr17 | 38487648 | + | PML | chr15 | 74317198 | + |
72327 | LAML | TCGA-AB-2872_70417AAXX_3 | RARA | chr17 | 38487648 | + | PML | chr15 | 74326819 | + |
72327 | LAML | TCGA-AB-2994 | RARA | chr17 | 38487648 | + | PML | chr15 | 74326818 | + |
72327 | LAML | TCGA-AB-2994_700F8AAXX_2 | RARA | chr17 | 38498669 | + | PML | chr15 | 74326819 | + |
72327 | LAML | TCGA-AB-2998_700D6AAXX_3 | RARA | chr17 | 38487648 | + | PML | chr15 | 74325497 | + |
72327 | LAML | TCGA-AB-2998_700HWAAXX_3 | RARA | chr17 | 38487648 | + | PML | chr15 | 74324913 | + |
72327 | LAML | TCGA-AB-3001 | RARA | chr17 | 38487648 | + | PML | chr15 | 74317197 | + |
72327 | LAML | TCGA-AB-3012 | RARA | chr17 | 38499119 | + | PML | chr15 | 74326818 | + |
72327 | LAML | TCGA-AB-3012_61LMEAAXX_6 | RARA | chr17 | 38499119 | + | PML | chr15 | 74326819 | + |
72327 | N/A | M82827 | RARA | chr17 | 38487648 | + | PML | chr15 | 74317198 | + |
72327 | N/A | S57797 | RARA | chr17 | 38503920 | + | PML | chr15 | 74326822 | + |
72327 | N/A | S76370 | RARA | chr17 | 38504435 | + | PML | chr15 | 74325745 | + |
72327 | N/A | S76372 | RARA | chr17 | 38503830 | + | PML | chr15 | 74325747 | + |
72327 | N/A | S76379 | RARA | chr17 | 38503278 | + | PML | chr15 | 74326239 | + |
72327 | N/A | S76387 | RARA | chr17 | 38504165 | + | PML | chr15 | 74326351 | + |
72327 | N/A | S76395 | RARA | chr17 | 38502793 | + | PML | chr15 | 74326423 | + |
72327 | N/A | S76399 | RARA | chr17 | 38503054 | + | PML | chr15 | 74326518 | + |
72327 | N/A | S76405 | RARA | chr17 | 38502990 | + | PML | chr15 | 74326627 | + |
92589 | BRCA | TCGA-A2-A0D1-01A | RARA | chr17 | 38487648 | + | POLDIP2 | chr17 | 26681611 | - |
103131 | STAD | TCGA-D7-8573 | RARA | chr17 | 38474700 | + | PPP1R1B | chr17 | 37785422 | + |
103131 | STAD | TCGA-D7-8573-01A | RARA | chr17 | 38474700 | + | PPP1R1B | chr17 | 37785423 | + |
98206 | BRCA | TCGA-A2-A0YG | RARA | chr17 | 38465538 | + | PRR11 | chr17 | 57247108 | + |
98206 | BRCA | TCGA-A2-A0YG | RARA | chr17 | 38474700 | + | PRR11 | chr17 | 57247108 | + |
98206 | BRCA | TCGA-A2-A0YG | RARA | chr17 | 38474700 | + | PRR11 | chr17 | 57262414 | + |
98206 | BRCA | TCGA-A2-A0YG-01A | RARA | chr17 | 38465537 | + | PRR11 | chr17 | 57247108 | + |
98206 | BRCA | TCGA-A2-A0YG-01A | RARA | chr17 | 38465538 | + | PRR11 | chr17 | 57247109 | + |
98206 | BRCA | TCGA-A2-A0YG-01A | RARA | chr17 | 38474699 | + | PRR11 | chr17 | 57240959 | + |
98206 | BRCA | TCGA-A2-A0YG-01A | RARA | chr17 | 38474699 | + | PRR11 | chr17 | 57247108 | + |
98206 | BRCA | TCGA-A2-A0YG-01A | RARA | chr17 | 38474699 | + | PRR11 | chr17 | 57262414 | + |
98206 | BRCA | TCGA-A2-A0YG-01A | RARA | chr17 | 38474700 | + | PRR11 | chr17 | 57247109 | + |
99282 | BRCA | TCGA-EW-A1J3 | RARA | chr17 | 38487648 | + | PSMD3 | chr17 | 38151206 | + |
99282 | BRCA | TCGA-EW-A1J3 | RARA | chr17 | 38499119 | + | PSMD3 | chr17 | 38151206 | + |
99282 | BRCA | TCGA-EW-A1J3-01A | RARA | chr17 | 38487647 | + | PSMD3 | chr17 | 38151206 | + |
99282 | BRCA | TCGA-EW-A1J3-01A | RARA | chr17 | 38487648 | + | PSMD3 | chr17 | 38151207 | + |
72327 | BRCA | TCGA-AN-A041-01A | RARA | chr17 | 38512898 | + | PSME3 | chr17 | 40989666 | + |
100461 | N/A | X06538 | RARA | chr17 | 38474639 | - | RARA | chr17 | 38487504 | + |
72327 | BRCA | TCGA-BH-A0DD-01A | RARA | chr17 | 38474700 | - | RP11-1407O15.2 | chr17 | 36359042 | - |
102865 | BRCA | TCGA-BH-A202-01A | RARA | chr17 | 38487648 | + | SEPT9 | chr17 | 75483506 | + |
94101 | BRCA | TCGA-A2-A0YG-01A | RARA | chr17 | 38465537 | + | SKA2 | chr17 | 57232183 | + |
94101 | BRCA | TCGA-A2-A0YG-01A | RARA | chr17 | 38474699 | + | SKA2 | chr17 | 57232183 | + |
92287 | BRCA | TCGA-B6-A0IN | RARA | chr17 | 38487648 | + | SKAP1 | chr17 | 46211178 | - |
92287 | BRCA | TCGA-B6-A0IN | RARA | chr17 | 38499119 | + | SKAP1 | chr17 | 46214699 | - |
92287 | BRCA | TCGA-B6-A0IN-01A | RARA | chr17 | 38487647 | + | SKAP1 | chr17 | 46211177 | - |
92287 | BRCA | TCGA-B6-A0IN-01A | RARA | chr17 | 38487647 | + | SKAP1 | chr17 | 46214698 | - |
92287 | BRCA | TCGA-B6-A0IN-01A | RARA | chr17 | 38487648 | + | SKAP1 | chr17 | 46214699 | - |
91508 | UCS | TCGA-N8-A4PQ-01A | RARA | chr17 | 38508759 | + | SLC9A3R1 | chr17 | 72758151 | + |
72327 | LUAD | TCGA-55-1592-01A | RARA | chr17 | 38474700 | + | STAC2 | chr17 | 37374426 | - |
96866 | BRCA | TCGA-EW-A1J3-01A | RARA | chr17 | 38465537 | + | STAT3 | chr17 | 40500537 | - |
96866 | BRCA | TCGA-EW-A1J3-01A | RARA | chr17 | 38465537 | + | STAT3 | chr17 | 40500556 | - |
96866 | BRCA | TCGA-EW-A1J3-01A | RARA | chr17 | 38465538 | + | STAT3 | chr17 | 40500538 | - |
96866 | BRCA | TCGA-EW-A1J3-01A | RARA | chr17 | 38465538 | - | STAT3 | chr17 | 40500557 | - |
72327 | BRCA | TCGA-BH-A0DD | RARA | chr17 | 38474700 | + | TBC1D3B | chr17 | 34502411 | - |
85105 | BRCA | TCGA-BH-A0DD | RARA | chr17 | 38474700 | + | TBC1D3F | chr17 | 36285543 | + |
85105 | BRCA | TCGA-BH-A1EV | RARA | chr17 | 38508759 | + | TBC1D3F | chr17 | 36289993 | + |
88962 | BRCA | TCGA-BH-A1EV-01A | RARA | chr17 | 38508759 | + | TBC1D3H | chr17 | 34751022 | - |
99290 | BRCA | TCGA-GM-A2DA-01A | RARA | chr17 | 38487648 | + | THRA | chr17 | 38240088 | + |
72327 | BRCA | TCGA-EW-A6S9-01A | RARA | chr17 | 38487647 | + | TSPYL4 | chr6 | 116571580 | - |
72327 | BRCA | TCGA-EW-A6S9-01A | RARA | chr17 | 38487648 | + | TSPYL4 | chr6 | 116571581 | - |
99295 | BRCA | TCGA-BH-A202 | RARA | chr17 | 38487648 | + | WIPF2 | chr17 | 38430041 | + |
99295 | BRCA | TCGA-BH-A202-01A | RARA | chr17 | 38487647 | + | WIPF2 | chr17 | 38430041 | + |
99295 | BRCA | TCGA-BH-A202-01A | RARA | chr17 | 38487648 | + | WIPF2 | chr17 | 38430042 | + |
99295 | STAD | TCGA-VQ-A8PH | RARA | chr17 | 38474700 | + | WIPF2 | chr17 | 38412642 | + |
99295 | STAD | TCGA-VQ-A8PH | RARA | chr17 | 38487648 | + | WIPF2 | chr17 | 38412642 | + |
99295 | STAD | TCGA-VQ-A8PH-01A | RARA | chr17 | 38474700 | + | WIPF2 | chr17 | 38412643 | + |
99295 | STAD | TCGA-VQ-A8PH-01A | RARA | chr17 | 38487648 | + | WIPF2 | chr17 | 38412643 | + |
103137 | BRCA | TCGA-AR-A0TX | RARA | chr17 | 38474700 | + | ZNF595 | chr4 | 59322 | + |
103137 | BRCA | TCGA-AR-A0TX | RARA | chr17 | 38487648 | + | ZNF595 | chr4 | 59322 | + |
103137 | BRCA | TCGA-AR-A0TX-01A | RARA | chr17 | 38487648 | + | ZNF595 | chr4 | 59323 | + |
95990 | BRCA | TCGA-AR-A0TX-01A | RARA | chr17 | 38487647 | + | ZNF718 | chr4 | 59322 | + |
99298 | BRCA | TCGA-B6-A0I1-01A | RARA | chr17 | 38487648 | + | ZPBP2 | chr17 | 38031507 | + |
100461 | COAD | TCGA-CM-6167-01A | RNF43 | chr17 | 56492687 | - | RARA | chr17 | 38487109 | + |
100461 | PRAD | TCGA-HC-7750 | RPL3 | chr22 | 39711375 | - | RARA | chr17 | 38498827 | + |
100461 | BRCA | TCGA-BH-A1EV-01A | SGCD | chr5 | 156022061 | + | RARA | chr17 | 38504568 | + |
100461 | READ | TCGA-AH-6643 | SMARCE1 | chr17 | 38792182 | - | RARA | chr17 | 38511514 | + |
100461 | READ | TCGA-AH-6643-01A | SMARCE1 | chr17 | 38792183 | - | RARA | chr17 | 38511515 | + |
100461 | BRCA | TCGA-LD-A9QF | SPOP | chr17 | 47755294 | - | RARA | chr17 | 38487108 | + |
100461 | BRCA | TCGA-LD-A9QF-01A | SPOP | chr17 | 47755295 | - | RARA | chr17 | 38487109 | + |
100461 | . | . | STAT5B | chr17 | 40362188 | - | RARA | chr17 | 38504567 | + |
100461 | . | . | STAT5B | chr17 | 40362319 | - | RARA | chr17 | 40362319 | + |
100461 | GBM | TCGA-06-0141-01A | TAOK1 | chr17 | 27718042 | + | RARA | chr17 | 38504568 | + |
100461 | . | . | TBL1XR1 | chr3 | 176769514 | - | RARA | chr17 | 176769514 | + |
100461 | N/A | KF589333 | TBL1XR1 | chr3 | 176769292 | - | RARA | chr17 | 38504568 | + |
100461 | BRCA | TCGA-EW-A1IW-01A | TPCN2 | chr11 | 68830458 | + | RARA | chr17 | 38487109 | + |
100461 | ESCA | TCGA-L5-A43C | WDR59 | chr16 | 74982416 | - | RARA | chr17 | 38487108 | + |
100463 | PCPG | TCGA-WB-A81E-01A | ZBTB4 | chr17 | 7365738 | - | RARA | chr17 | 38487109 | + |
Top |
|
Kaplan-Meier plots with logrank tests of overall survival (OS) |
Cancer type | Translation factor | Coefficent | Hazard ratio | Wald test pval | Likelihool ratio pval | Logrank test pval | # samples |
Top |
|
Differential gene expression between female and male. (Wilcoxon test, pval<0.05) |
Cancer type | Translation factor | pval | adj.p |
BRCA | RARA | 0.000205996189691899 | 0.0056 |
LIHC | RARA | 0.00240149430440428 | 0.062 |
LUAD | RARA | 0.0118532566904607 | 0.3 |
KIRP | RARA | 0.0185514680390074 | 0.45 |
LGG | RARA | 0.0305646448193272 | 0.7 |
KIRC | RARA | 0.0314248658348089 | 0.7 |
LUSC | RARA | 0.0345763583867024 | 0.73 |
TGCT | RARA | 9.33693709708224e-05 | 0.0026 |
Top |
|
Differential gene expression between young and old age groups (Wilcoxon test, pval<0.05) |
Cancer type | Translation factor | pval | adj.p |
STAD | RARA | 0.00240444296036484 | 0.075 |
LUSC | RARA | 0.00140739475261782 | 0.045 |
KIRP | RARA | 0.0240629849609032 | 0.7 |
BRCA | RARA | 3.22729413606381e-05 | 0.0011 |
OV | RARA | 0.00553808612150814 | 0.17 |
UCEC | RARA | 0.0380100868732719 | 1 |
Top |
|
Drugs targeting genes involved in this translation factor. (DrugBank Version 5.1.8 2021-05-08) |
UniProtAcc | DrugBank ID | Drug name | Drug activity | Drug type | Drug status |
P10276 | DB00210 | Adapalene | Small molecule | Approved | |
P10276 | DB00459 | Acitretin | Agonist | Small molecule | Approved |
P10276 | DB00523 | Alitretinoin | Agonist | Small molecule | Approved|Investigational |
P10276 | DB00755 | Tretinoin | Small molecule | Approved|Investigational|Nutraceutical | |
P10276 | DB00799 | Tazarotene | Agonist | Small molecule | Approved|Investigational |
P10276 | DB00926 | Etretinate | Agonist | Small molecule | Withdrawn |
P10276 | DB00982 | Isotretinoin | Other/unknown | Small molecule | Approved |
P10276 | DB04942 | Tamibarotene | Agonist | Small molecule | Investigational |
P10276 | DB05785 | LGD-1550 | Small molecule | Investigational | |
P10276 | DB12808 | Trifarotene | Agonist | Small molecule | Approved|Investigational |
P10276 | DB00210 | Adapalene | |||
P10276 | DB00459 | Acitretin | Agonist | ||
P10276 | DB00523 | Alitretinoin | Agonist | ||
P10276 | DB00755 | Tretinoin | |||
P10276 | DB00799 | Tazarotene | Agonist | ||
P10276 | DB00926 | Etretinate | Agonist | ||
P10276 | DB00982 | Isotretinoin | Other/unknown | ||
P10276 | DB04942 | Tamibarotene | Agonist | ||
P10276 | DB05785 | LGD-1550 | |||
P10276 | DB12808 | Trifarotene | Agonist |
Top |
|
Diseases associated with this translation factor. (DisGeNet 4.0) |
Disease ID | Disease Name | # PubMeds | Disease source |
C0023487 | Acute Promyelocytic Leukemia | 24 | CTD_human;ORPHANET |
C0036341 | Schizophrenia | 3 | PSYGENET |
C0006142 | Malignant neoplasm of breast | 1 | CTD_human |
C0009363 | Congenital ocular coloboma (disorder) | 1 | GENOMICS_ENGLAND |
C0010701 | Phyllodes Tumor | 1 | CTD_human |
C0149940 | Sciatic Neuropathy | 1 | CTD_human |
C0154748 | Lesion of Sciatic Nerve | 1 | CTD_human |
C0206650 | Fibroadenoma | 1 | CTD_human |
C0242013 | Sciatic Neuritis | 1 | CTD_human |
C0600066 | Malignant Cystosarcoma Phyllodes | 1 | CTD_human |
C0678222 | Breast Carcinoma | 1 | CTD_human |
C0751924 | Neuralgia-Neuritis, Sciatic Nerve | 1 | CTD_human |
C0751925 | Sciatic Nerve Palsy | 1 | CTD_human |
C0877578 | Treatment related secondary malignancy | 1 | CTD_human |
C1257931 | Mammary Neoplasms, Human | 1 | CTD_human |
C2239176 | Liver carcinoma | 1 | CTD_human |
C4704874 | Mammary Carcinoma, Human | 1 | CTD_human |